Equine Herpesvirus-1 Induced Respiratory Disease in Dezhou Donkey Foals: Case Study from China, 2024
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Herd History and Case Presentation
2.2. Nucleic Extraction, PCR Amplification and Sequencing
2.3. Pathological Examination
2.4. Isolation of the Virus from Positive Lung Samples
2.5. Morphological Observations Using Transmission Electron Microscope
2.6. Indirect Immunofluorescence
2.7. The ORF33 of LC126 Amplification and Phylogenetic Analysis
2.8. Infection of BALB/c
2.9. Statistical Analysis
3. Results
3.1. Case Presentation and Pathogen Identification
3.2. Identification of EHV-1 in the Isolates
3.3. Phylogenetic Analysis of the ORF33 Gene
3.4. Replication Characteristics and Pathogenicity of EHV-1 Isolate in BALB/C Mice
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Afify, A.F.; Hassanien, R.T.; El Naggar, R.F.; Rohaim, M.A.; Munir, M. Unmasking the ongoing challenge of equid herpesvirus-1 (EHV-1): A comprehensive review. Microb. Pathog. 2024, 193, 106755. [Google Scholar] [CrossRef]
- Tau, R.L.; Ferreccio, C.; Bachir, N.; Torales, F.; Romera, S.A.; Maidana, S.S. Comprehensive analysis of equid herpesvirus recombination: An insight into the repeat regions. J. Equine Vet. Sci. 2023, 130, 104916. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Hu, L.; Liu, M.; Wang, T.; Hu, X.; Li, Y.; Liu, W.; Li, Y.; Wang, Y.; Ren, H.; et al. The emergence of viral encephalitis in donkeys by equid herpesvirus 8 in China. Front. Microbiol. 2022, 13, 840754. [Google Scholar] [CrossRef]
- Garvey, M.; Suarez, N.M.; Kerr, K.; Hector, R.; Moloney-Quinn, L.; Arkins, S.; Davison, A.J.; Cullinane, A. Equid herpesvirus 8: Complete genome sequence and association with abortion in mares. PLoS ONE 2018, 13, e0192301. [Google Scholar] [CrossRef]
- Doll, E.R.; Wallace, E.; Richards, M.G. Thermal, hematological, and serological responses of weanling horses following inoculation with equine abortion virus: Its similarity to equine influenza. Cornell Vet. 1954, 44, 181–190. [Google Scholar] [PubMed]
- Oladunni, F.S.; Horohov, D.W.; Chambers, T.M. EHV-1: A constant threat to the horse industry. Front. Microbiol. 2019, 10, 2668. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Li, S.; Li, W.; Yu, Y.; Sun, Q.; Chen, W.; Zhou, H.; Wang, C.; Li, L.; Xu, M.; et al. Rutin prevents EqHV-8-induced infection and oxidative stress via Nrf2/HO-1 signaling pathway. Front. Cell. Infect. Microbiol. 2024, 14, 1386462. [Google Scholar] [CrossRef]
- Li, L.; Cui, X.; Yu, Y.; Sun, Q.; Li, W.; Li, Y.; Li, S.; Chen, L.; Khan, M.Z.; Wang, C.; et al. Blebbistatin as a novel antiviral agent targeting equid herpesvirus type 8. Front. Vet. Sci. 2024, 11, 1390304. [Google Scholar]
- Li, S.; Li, L.; Sun, Y.; Khan, M.Z.; Yu, Y.; Ruan, L.; Chen, L.; Zhao, J.; Jia, J.; Li, Y.; et al. Protective role of cepharanthine against equid herpesvirus type 8 through AMPK and Nrf2/HO-1 pathway activation. Viruses 2024, 16, 1765. [Google Scholar] [CrossRef]
- Tong, P.; Pan, J.; Dang, Y.; Yang, E.; Jia, C.; Duan, R.; Tian, S.; Palidan, N.; Kuang, L.; Wang, C.; et al. First identification and isolation of equine herpesvirus type 1 in aborted fetal lung tissues of donkeys. Virol. J. 2024, 21, 117. [Google Scholar] [CrossRef]
- Wang, T.; Xi, C.; Yu, Y.; Liu, W.; Akhtar, M.F.; Li, Y.; Wang, C.; Li, L. Characteristics and epidemiological investigation of equid herpesvirus 8 in donkeys in Shandong, China. Arch. Virol. 2023, 168, 99. [Google Scholar] [CrossRef]
- Wang, T.; Hu, L.; Wang, Y.; Liu, W.; Liu, G.; Zhu, M.; Zhang, W.; Wang, C.; Ren, H.; Li, L. Identification of equine herpesvirus 8 in donkey abortion: A case report. Virol. J. 2022, 19, 10. [Google Scholar] [CrossRef]
- Wang, T.; Du, Q.; Niu, Y.; Zhang, X.; Wang, Z.; Wu, X.; Yang, X.; Zhao, X.; Liu, S.L.; Tong, D.; et al. Cellular p32 is a critical regulator of porcine circovirus type 2 nuclear egress. J. Virol. 2019, 93, e00979-19. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Wang, J.; Chen, L.; Ren, Q.; Akhtar, M.F.; Liu, W.; Wang, C.; Cao, S.; Liu, W.; Zhao, Q.; et al. Diltiazem HCl suppresses porcine reproductive and respiratory syndrome virus infection in susceptible cells and in swine. Vet. Microbiol. 2024, 292, 110054. [Google Scholar] [CrossRef]
- Wang, T.; Hu, L.; Li, R.; Ren, H.; Li, S.; Sun, Q.; Ding, X.; Li, Y.; Wang, C.; Li, L. Hyperoside inhibits EHV-8 infection via alleviating oxidative stress and IFN production through activating JNK/Keap1/Nrf2/HO-1 signaling pathways. J. Virol. 2024, 98, e0015924. [Google Scholar] [CrossRef] [PubMed]
- Fuentealba, N.A.; Sguazza, G.H.; Zanuzzi, C.N.; Bravi, M.E.; Scrochi, M.R.; Valera, A.R.; Corva, S.G.; Gimeno, E.J.; Pecoraro, M.R.; Galosi, C.M. Immunoprotective response induced by recombinant glycoprotein D in the BALB/c respiratory mouse model of Equid alphaherpesvirus 1 infection. Rev. Argent. Microbiol. 2019, 51, 119–129. [Google Scholar] [CrossRef]
- Walker, C.; Ruitenberg, K.M.; Love, D.N.; Millar Whalley, J. Immunization of BALB/c mice with DNA encoding equine herpesvirus 1 (EHV-1) glycoprotein D affords partial protection in a model of EHV-1-induced abortion. Vet. Microbiol. 2000, 76, 211–220. [Google Scholar] [CrossRef]
- Zhang, Z.; Huang, B.; Wang, Y.; Zhu, M.; Liu, G.; Wang, C. A survey report on the donkey original breeding farms in China: Current aspects and future prospective. Front. Vet. Sci. 2023, 10, 1126138. [Google Scholar] [CrossRef] [PubMed]
- Seyiti, S.; Kelimu, A. Donkey industry in China: Current aspects, suggestions and future challenges. J. Equine Vet. Sci. 2021, 102, 103642. [Google Scholar] [CrossRef]
- Li, L.; Li, S.; Ma, H.; Akhtar, M.F.; Tan, Y.; Wang, T.; Liu, W.; Khan, A.; Khan, M.Z.; Wang, C. An overview of infectious and non-infectious causes of pregnancy losses in equine. Animals 2024, 14, 1961. [Google Scholar] [CrossRef]
- Rickards, K.J.; Thiemann, A.K. Respiratory disorders of the donkey. Vet. Clin. North Am. Equine Pract. 2019, 35, 561–573. [Google Scholar] [CrossRef]
- Yang, H.; Xiao, Y.; Meng, F.; Sun, F.; Chen, M.; Cheng, Z.; Chen, Y.; Liu, S.; Chen, H. Emergence of H3N8 equine influenza virus in donkeys in China in 2017. Vet. Microbiol. 2018, 214, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Yongfeng, Y.; Xiaobo, S.; Nan, X.; Jingwen, Z.; Wenqiang, L. Detection of the epidemic of the H3N8 subtype of the equine influenza virus in large-scale donkey farms. Int. J. Vet. Sci. Med. 2020, 8, 26–30. [Google Scholar] [CrossRef]
- Pusterla, N.; Sandler-Burtness, E.; Barnum, S.; Hill, L.A.; Mendonsa, E.; Khan, R.; Portener, D.; Ridland, H.; Schumacher, S. Frequency of detection of respiratory pathogens in nasal secretions from healthy sport horses attending a spring show in California. J. Equine Vet. Sci. 2022, 117, 104089. [Google Scholar] [CrossRef] [PubMed]
- Pusterla, N.; Leutenegger, C.M.; Barnum, S.; Wademan, C.; Hodzic, E. Challenges in navigating molecular diagnostics for common equine respiratory viruses. Vet. J. 2021, 276, 105746. [Google Scholar] [CrossRef]
- Liu, C.; Guo, W.; Lu, G.; Xiang, W.; Wang, X. Complete genomic sequence of an equine herpesvirus type 8 Wh strain isolated from China. J. Virol. 2012, 86, 5407. [Google Scholar] [CrossRef]
- Otzdorff, C.; Beckmann, J.; Goehring, L.S. Equine arteritis virus (EAV) outbreak in a show stallion population. Viruses 2021, 13, 2142. [Google Scholar] [CrossRef]
- Rivas, J.; Neira, V.; Mena, J.; Brito, B.; Garcia, A.; Gutierrez, C.; Sandoval, D.; Ortega, R. Identification of a divergent genotype of equine arteritis virus from South American donkeys. Transbound. Emerg. Dis. 2017, 64, 1655–1660. [Google Scholar] [CrossRef]
- Stadejek, T.; Mittelholzer, C.; Oleksiewicz, M.B.; Paweska, J.; Belak, S. Highly diverse type of equine arteritis virus (EAV) from the semen of a South African donkey: Short communication. Acta Vet. Hung. 2006, 54, 263–270. [Google Scholar] [CrossRef]
- Negussie, H.; Gizaw, D.; Tesfaw, L.; Li, Y.; Oguma, K.; Sentsui, H.; Tessema, T.S.; Nauwynck, H.J. Detection of equine herpesvirus (EHV)-1, -2, -4, and -5 in Ethiopian equids with and without respiratory problems and genetic characterization of EHV-2 and EHV-5 strains. Transbound. Emerg. Dis. 2017, 64, 1970–1978. [Google Scholar] [CrossRef]
- Temesgen, T.; Getachew, Y.; Negussie, H. Molecular identification of equine herpesvirus 1, 2, and 5 in equids with signs of respiratory disease in central Ethiopia. Vet. Med. 2021, 12, 337–345. [Google Scholar] [CrossRef]
- Mesquita, L.P.; Arévalo, A.F.; Zanatto, D.A.; Miyashiro, S.I.; Cunha, E.M.S.; de Souza, M.D.C.C.; Villalobos, E.M.C.; Mori, C.M.C.; Maiorka, P.C.; Mori, E. Equine herpesvirus type 1 induces both neurological and respiratory disease in Syrian hamsters. Vet. Microbiol. 2017, 203, 117–124. [Google Scholar] [CrossRef] [PubMed]
- Abas, O.; Abdo, W.; Kasem, S.; Alwazzan, A.; Saleh, A.G.; Saleh, I.G.; Fukushi, H.; Yanai, T.; Haridy, M. Time Course-Dependent Study on Equine Herpes Virus 9-Induced Abortion in Syrian Hamsters. Animals 2020, 10, 1369. [Google Scholar] [CrossRef] [PubMed]
Primers | Primer Sequences (5′-3′) | PCR Product Sizes |
---|---|---|
EHV-1-gB-F | GAACCTCAGCCAACCCA | 792 bp |
EHV-1-gB-R | GCACTTTGCGGACGAAC | |
EHV-4-gB-F | CTTAATCGCATTTAGACCGATG | 1591 bp |
EHV-4-gB R | CCGGAACTAGAAAGATGTTATGC | |
EHV-8-gG-F | TCAGACTGTCACTCGTGGGA | 316 bp |
EHV-8-gG-R | CCTGGAGGCCGTTTAACACA | |
EAV-N-F | ATGGCGTCAAGACGATCAC | 333 bp |
EAV-N-R | TTACGGCCCTGCTGGAGGC | |
H3N8-HA-F | ATTCATCACCCGAGTTCAAA | 595 bp |
H3N8-HA-R | TTTCATTAATCTGGTCGATGGC | |
H3N8-M-F | ACTGTGACAACCGAAGTG | 224 bp |
H3N8-M-R | TGCCTGGCCTTACTAGC | |
EHV-1-ORF33-F | ATGTCCTCTGGTTGCCGTTC | 2943 bp |
EHV-1-ORF33-R | TTAAACCATTTTTTCATTTTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ruan, L.; Li, L.; Yang, R.; You, A.; Khan, M.Z.; Yu, Y.; Chen, L.; Li, Y.; Liu, G.; Wang, C.; et al. Equine Herpesvirus-1 Induced Respiratory Disease in Dezhou Donkey Foals: Case Study from China, 2024. Vet. Sci. 2025, 12, 56. https://doi.org/10.3390/vetsci12010056
Ruan L, Li L, Yang R, You A, Khan MZ, Yu Y, Chen L, Li Y, Liu G, Wang C, et al. Equine Herpesvirus-1 Induced Respiratory Disease in Dezhou Donkey Foals: Case Study from China, 2024. Veterinary Sciences. 2025; 12(1):56. https://doi.org/10.3390/vetsci12010056
Chicago/Turabian StyleRuan, Lian, Liangliang Li, Rongze Yang, Anrong You, Muhammad Zahoor Khan, Yue Yu, Li Chen, Yubao Li, Guiqin Liu, Changfa Wang, and et al. 2025. "Equine Herpesvirus-1 Induced Respiratory Disease in Dezhou Donkey Foals: Case Study from China, 2024" Veterinary Sciences 12, no. 1: 56. https://doi.org/10.3390/vetsci12010056
APA StyleRuan, L., Li, L., Yang, R., You, A., Khan, M. Z., Yu, Y., Chen, L., Li, Y., Liu, G., Wang, C., & Wang, T. (2025). Equine Herpesvirus-1 Induced Respiratory Disease in Dezhou Donkey Foals: Case Study from China, 2024. Veterinary Sciences, 12(1), 56. https://doi.org/10.3390/vetsci12010056