A Transcriptome Approach Evaluating the Effects of Atractylenolide I on the Secretion of Estradiol and Progesterone in Feline Ovarian Granulosa Cells
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. AT-I Structure
2.2. Culture of Primary Feline Ovarian Granulosa Cells
2.3. Morphological Observations
2.4. Immunofluorescence Identification
2.5. Cell Viability Assay
2.6. Cytotoxicity of AT-I Against Primary Feline Ovarian Granulosa Cells
2.7. Determination of Estradiol (E2) and Progesterone (P4) Concentration
2.8. AT-I Treatment
2.9. RNA Library Construction and Sequencing
2.10. Statistical Analysis of Transcription Data
2.11. Validation by Quantitative Reverse Transcription PCR
2.12. Biochemical Verification
2.13. Statistical Analysis
3. Results
3.1. Identification of Cultured Feline Ovarian Granulosa Cells
3.2. Cell Viability Test Results
3.3. Cytotoxicity of AT-I on the Primary FOGCs
3.4. The Effect of AT-I on the Synthesis of E2 and P4 in FOGCs
3.5. Classification of Transcriptional Sequencing Data
3.6. Analysis of Differentially Expressed Genes
3.7. Functional Enrichment Analysis of Differentially Expressed Genes
3.8. Validation of the Selected Genes by Quantitative Reverse Transcription PCR and Biochemical Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| AMK | Atractylodes macrocephala Koidz | 
| AT-I | atractylenolide I | 
| FOGCs | primary feline ovarian granulosa cells | 
| RNA-seq | transcriptome sequencing | 
| CL | corpus luteum | 
| LLCs | large luteum cells | 
| SLCs | small luteum cells | 
| E2 | estradiol | 
| P4 | progesterone | 
| ELISA | enzyme-linked immunosorbent assay | 
| DEGs | differentially expressed genes | 
| GO | Gene Ontology | 
| KEGG | Kyoto Encyclopedia of Genes and Genomes | 
| FC | fold change | 
| FPKM | fragmented per kilobases of exon per million fragments mapped | 
| RIN | RNA integrity number | 
| RT-qPCR | quantitative reverse transcription PCR | 
| DPBS | Dulbecco’s phosphate-buffered saline | 
| DMEM/F12 | Ham’s F-12 nutrient mixture | 
| COCs | cumulus–oocyte complexes | 
| HE | hematoxylin-eosin | 
| FSHR | Follicle-stimulating hormone receptor | 
| DAPI | 4,6-diamidino-2-phenylindole | 
| CCK-8 | Cell Counting Kit-8 | 
| OD | value optical density value | 
| TC | total cholesterol | 
| LDL-C | low-density lipoprotein cholesterol | 
| HDL-C | high-density lipoprotein cholesterol | 
| SD | standard deviation | 
References
- Little, S. Feline reproduction: Problems and clinical challenges. J. Feline Med. Surg. 2011, 13, 508–515. [Google Scholar] [CrossRef] [PubMed]
 - Johnson, A.K. Normal feline reproduction: The queen. J. Feline Med. Surg. 2022, 24, 204–211. [Google Scholar] [CrossRef] [PubMed]
 - MV, R.K. Clinical management of pregnancy in cats. Theriogenology 2006, 66, 145–150. [Google Scholar] [CrossRef]
 - Zhu, B.; Zhang, Q.L.; Hua, J.W.; Cheng, W.L.; Qin, L.P. The traditional uses, phytochemistry, and pharmacology of Atractylodes macrocephala Koidz.: A review. J. Ethnopharmacol. 2018, 226, 143–167. [Google Scholar] [CrossRef]
 - Song, H.P.; Hou, X.Q.; Li, R.Y.; Yu, R.; Li, X.; Zhou, S.N.; Huang, H.Y.; Cai, X.; Zhou, C. Atractylenolide I stimulates intestinal epithelial repair through polyamine-mediated Ca2+ signaling pathway. Phytomedicine 2017, 28, 27–35. [Google Scholar] [CrossRef]
 - Long, F.; Wang, T.; Jia, P.; Wang, H.; Qing, Y.; Xiong, T.; He, M.; Wang, X. Anti-Tumor Effects of Atractylenolide-I on Human Ovarian Cancer Cells. Med. Sci. Monit. 2017, 23, 571–579. [Google Scholar] [CrossRef]
 - Li, W.; Zhi, W.; Liu, F.; He, Z.; Wang, X.; Niu, X. Atractylenolide I restores HO-1 expression and inhibits Ox-LDL-induced VSMCs proliferation, migration and inflammatory responses in vitro. Exp. Cell Res. 2017, 353, 26–34. [Google Scholar] [CrossRef]
 - Ji, G.; Chen, R.; Zheng, J. Atractylenolide I inhibits lipopolysaccharide-induced inflammatory responses via mitogen activated protein kinase pathways inRAW264.7 cells. Immunopharmacol. Immunotoxicol. 2014, 36, 420–425. [Google Scholar] [CrossRef]
 - Mesen, T.B.; Young, S.L. Progesterone and the luteal phase: A requisite to reproduction. Obstet. Gynecol. Clin. N. Am. 2015, 42, 135–151. [Google Scholar] [CrossRef]
 - Nardo, L.G.; Sallam, H.N. Progesterone supplementation to prevent recurrent miscarriage and to reduce implantation failure in assisted reproduction cycles. Reprod. Biomed. Online 2006, 13, 47–57. [Google Scholar] [CrossRef]
 - Niswender, G.D.; Juengel, J.L.; Silva, P.J.; Rollyson, M.K.; McIntush, E.W. Mechanisms controlling the function and life span of the corpus luteum. Physiol. Rev. 2000, 80, 1–29. [Google Scholar] [CrossRef] [PubMed]
 - Arikan, S.; Yigit, A.A. Effects of cholesterol and cAMP on progesterone production in cultured luteal cells isolated from pseudopregnant cat ovaries. Anim. Reprod. Sci. 2009, 115, 238–246. [Google Scholar] [CrossRef] [PubMed]
 - Tsutsui, T.; Suzuki, Y.; Toyonaga, M.; Oba, H.; Mizutani, T.; Hori, T. The role of the ovary for the maintenance of pregnancy in cats. Reprod. Domest. Anim. 2009, 44 (Suppl. 2), 120–124. [Google Scholar] [CrossRef] [PubMed]
 - Braun, B.C.; Zschockelt, L.; Dehnhard, M.; Jewgenow, K. Progesterone and estradiol in cat placenta--biosynthesis and tissue concentration. J. Steroid Biochem. Mol. Biol. 2012, 132, 295–302. [Google Scholar] [CrossRef] [PubMed]
 - Vannuccini, S.; Bocchi, C.; Severi, F.M.; Challis, J.R.; Petraglia, F. Endocrinology of human parturition. Ann. Endocrinol. 2016, 77, 105–113. [Google Scholar] [CrossRef]
 - Zhang, G.; Zhang, R.-Q.; Shen, W.; Li, L. RNA-seq based gene expression analysis of ovarian granulosa cells exposed to zearalenone in vitro: Significance to steroidogenesis. Oncotarget 2017, 8, 64001–64014. [Google Scholar] [CrossRef]
 - Maher, C.A.; Kumar-Sinha, C.; Cao, X.; Kalyana-Sundaram, S.; Han, B.; Jing, X.; Sam, L.; Barrette, T.; Palanisamy, N.; Chinnaiyan, A.M. Transcriptome sequencing to detect gene fusions in cancer. Nature 2009, 458, 97–101. [Google Scholar] [CrossRef]
 - Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. Embnet J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
 - Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
 - Anders, S.; Huber, W. Differential expression analysis for sequence count data. Genome Biol. 2010, 11, R106. [Google Scholar] [CrossRef]
 - Livak KJ, S.T. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. Methods Mol. Biol. 2001, 25, 402–408. [Google Scholar] [CrossRef]
 - Verstegen, J.P.; Onclin, K.; Silva, L.D.; Wouters-Ballman, P.; Delahaut, P.; Ectors, F. Regulation of progesterone during pregnancy in the cat: Studies on the roles of corpora lutea, placenta and prolactin secretion. J. Reprod. Fertil. Suppl. 1993, 47, 165–173. [Google Scholar] [PubMed]
 - Hryciuk, M.M.; Braun, B.C.; Bailey, L.D.; Jewgenow, K. Functional and Morphological Characterization of Small and Large Steroidogenic Luteal Cells From Domestic Cats Before and During Culture. Front. Endocrinol. 2019, 10, 724. [Google Scholar] [CrossRef]
 - Havelock, J.C.; Rainey, W.E.; Carr, B.R. Ovarian granulosa cell lines. Mol. Cell Endocrinol. 2004, 228, 67–78. [Google Scholar] [CrossRef] [PubMed]
 - Chiara Perego, M.; Bellitto, N.; Maylem, E.R.S.; Caloni, F.; Spicer, L.J. Effects of selected hormones and their combination on progesterone and estradiol production and proliferation of feline granulosa cells cultured in vitro. Theriogenology 2021, 168, 1–12. [Google Scholar] [CrossRef]
 - Devoto, L.; Kohen, P.; Muñoz, A.; Strauss, J.F., III. Human corpus luteum physiology and the luteal-phase dysfunction associated with ovarian stimulation. Reprod. BioMed. Online 2009, 18 (Suppl. 2), S19–S24. [Google Scholar] [CrossRef]
 - Richards, J.S.; Pangas, S.A. The ovary: Basic biology and clinical implications. J. Clin. Investig. 2010, 120, 963–972. [Google Scholar] [CrossRef]
 - Amelkina, O.; Braun, B.C.; Dehnhard, M.; Jewgenow, K. The corpus luteum of the domestic cat: Histologic classification and intraluteal hormone profile. Theriogenology 2015, 83, 711–720. [Google Scholar] [CrossRef]
 - Stocco, C.; Telleria, C.; Gibori, G. The molecular control of corpus luteum formation, function, and regression. Endocr. Rev. 2007, 28, 117–149. [Google Scholar] [CrossRef]
 - Wiktorowska-Owczarek, A.; Berezinska, M.; Nowak, J.Z. PUFAs: Structures, Metabolism and Functions. Adv. Clin. Exp. Med. 2015, 24, 931–941. [Google Scholar] [CrossRef]
 - AM, A.L.; Syed, D.N.; Ntambi, J.M. Insights into Stearoyl-CoA Desaturase-1 Regulation of Systemic Metabolism. Trends Endocrinol. Metab. 2017, 28, 831–842. [Google Scholar] [CrossRef]
 - Miranda-Jimenez, L.; Murphy, B.D. Lipoprotein receptor expression during luteinization of the ovarian follicle. Am. J. Physiol. Endocrinol. Metab. 2007, 293, E1053–E1061. [Google Scholar] [CrossRef] [PubMed]
 - Shimano, H.; Sato, R. SREBP-regulated lipid metabolism: Convergent physiology—divergent pathophysiology. Nat. Rev. Endocrinol. 2017, 13, 710–730. [Google Scholar] [CrossRef] [PubMed]
 - Woollett, L.A. Where does fetal and embryonic cholesterol originate and what does it do? Annu. Rev. Nutr. 2008, 28, 97–114. [Google Scholar] [CrossRef]
 - Li, Y.X.; Guo, X.; Gulappa, T.; Menon, B.; Menon, K.M.J. SREBP Plays a Regulatory Role in LH/hCG Receptor mRNA Expression in Human Granulosa-Lutein Cells. J. Clin. Endocrinol. Metab. 2019, 104, 4783–4792. [Google Scholar] [CrossRef]
 - Craig, Z.R.; Wang, W.; Flaws, J.A. Endocrine-disrupting chemicals in ovarian function: Effects on steroidogenesis, metabolism and nuclear receptor signaling. Reproduction 2011, 142, 633–646. [Google Scholar] [CrossRef]
 - Wang, H.; Humbatova, A.; Liu, Y.; Qin, W.; Lee, M. Mutations in SREBF1, Encoding Sterol Regulatory Element Binding Transcription Factor 1, Cause Autosomal-Dominant IFAP Syndrome. Am. J. Hum. Genet. 2020, 107, 34–45. [Google Scholar] [CrossRef]
 - Lindholm, D.; Bornhauser, B.C.; Korhonen, L. Mylip makes an Idol turn into regulation of LDL receptor. Cell. Mol. Life Sci. 2009, 66, 3399–3402. [Google Scholar] [CrossRef]
 - Iborra, R.T.; Machado-Lima, A.; Castilho, G.; Nunes, V.S.; Abdalla, D.S.; Nakandakare, E.R.; Passarelli, M. Advanced glycation in macrophages induces intracellular accumulation of 7-ketocholesterol and total sterols by decreasing the expression of ABCA-1 and ABCG-1. Lipids Health Dis. 2011, 10, 2–7. [Google Scholar] [CrossRef]
 









| Gene Name | Nucleotide Sequence (5′-3′) | |
|---|---|---|
| GAPDH | Forward | CAAGGCTGTGGGCAAGGTCATC | 
| Reverse | TTCTCCAGGCGGCAGGTCAG | |
| SREBF1 | Forward | GGCATCGCAAGCAGGCTGAC | 
| Reverse | GGTGGGAGGTGGGCAGTGG | |
| ABCG1 | Forward | ACATGCTGTTGCCACACCTCAC | 
| Reverse | TCCTGCCTTCGTCCTTCTCCTG | |
| ABCA1 | Forward | GGCAACGGCACTGAGGAAGATG | 
| Reverse | TGCGGGAAAGAGGACTGGACTC | |
| LDLR | Forward | GCCAGCAGAGGAGACGAGGAG | 
| Reverse | CCCGAAGCCCAGGAGGATGAG | |
| SCD | Forward | AAATTCCCTTCGGCCAATGAC | 
| Reverse | TCTCACCTCCTCTTGCAGCAA | |
| CYP1A1 | Forward | TGGCACCATCAACAAGGCACTG | 
| Reverse | AAAGACCTCCAAGCGGGCAATG | |
| FADS2 | Forward | GGATATGCGGGCGTAGAAGC | 
| Reverse | GTGCCGTGCAAATAGGTGGA | |
| StAR | Forward | GTGGAGCACATGGAAGCGATGG | 
| Reverse | GCAGCCAACTCGTGGGTGATG | |
| MYLIP | Forward | AACGAGGGAGCAGGGTTGAA | 
| Reverse | ACACTGCCGAGACAGAGGTT | |
| Sample | Means for Raw Reads | Means for Mapping | ||||
|---|---|---|---|---|---|---|
| No. of Raw Reads | No. of Valid Reads | Q20 (%) | No. of Map Reads | No. of Uniquely Mapped Reads | Uniquely Mapped Ratio (%) | |
| Control cells | 52,950,059 | 52,340,848 | 98.03 | 51,014,192 | 48,058,826 | 91.82 | 
| Treated cells | 58,841,865 | 58,189,124 | 98.24 | 56,730,426 | 53,563,083 | 92.06 | 
| Gene Name | Gene Description | Fold Change | p-Adjust | Regulation | 
|---|---|---|---|---|
| ABCA1 | ATP binding cassette subfamily A member 1 | 4.554 | 0.000006 | up | 
| SCD | stearoyl-CoA desaturase | 2.48 | 0.003099 | up | 
| LDLR | low-density lipoprotein receptor | 1.934 | 0.025723 | up | 
| CYP1A1 | cytochrome P450 1A1 | 0.451 | 0.026415 | down | 
| FADS2 | fatty acid desaturase 2 | 1.609 | 0.034371 | up | 
| ABCG1 | ATP binding cassette subfamily G member 1 | 3.724 | 0.044671 | up | 
| SREBF1 | sterol regulatory element binding transcription factor 1 | 1.839 | 0.040339 | up | 
| StAR | steroidogenic acute regulatory protein | 1.48 | 0.042111 | up | 
| MYLIP | myosin regulatory light chain interacting protein | 2.451 | 0.002304 | up | 
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.  | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guo, Y.; Liu, J.; Zhang, S.; Sun, D.; Dong, Z.; Cao, J. A Transcriptome Approach Evaluating the Effects of Atractylenolide I on the Secretion of Estradiol and Progesterone in Feline Ovarian Granulosa Cells. Vet. Sci. 2024, 11, 663. https://doi.org/10.3390/vetsci11120663
Guo Y, Liu J, Zhang S, Sun D, Dong Z, Cao J. A Transcriptome Approach Evaluating the Effects of Atractylenolide I on the Secretion of Estradiol and Progesterone in Feline Ovarian Granulosa Cells. Veterinary Sciences. 2024; 11(12):663. https://doi.org/10.3390/vetsci11120663
Chicago/Turabian StyleGuo, Yuli, Junping Liu, Shuangyi Zhang, Di Sun, Zhiying Dong, and Jinshan Cao. 2024. "A Transcriptome Approach Evaluating the Effects of Atractylenolide I on the Secretion of Estradiol and Progesterone in Feline Ovarian Granulosa Cells" Veterinary Sciences 11, no. 12: 663. https://doi.org/10.3390/vetsci11120663
APA StyleGuo, Y., Liu, J., Zhang, S., Sun, D., Dong, Z., & Cao, J. (2024). A Transcriptome Approach Evaluating the Effects of Atractylenolide I on the Secretion of Estradiol and Progesterone in Feline Ovarian Granulosa Cells. Veterinary Sciences, 11(12), 663. https://doi.org/10.3390/vetsci11120663
        
