Next Article in Journal
Evaluation of Presumptive Normal Feline Tonsils with Low-Field Magnetic Resonance Imaging: A Preliminary Retrospective Study
Next Article in Special Issue
Estimating Microbial Protein Synthesis in the Rumen—Can ‘Omics’ Methods Provide New Insights into a Long-Standing Question?
Previous Article in Journal
The Use of Additives to Prevent Urolithiasis in Lambs Fed Diets with a High Proportion of Concentrate
Previous Article in Special Issue
Beta-Adrenergic Agonists, Dietary Protein, and Rumen Bacterial Community Interactions in Beef Cattle: A Review
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Effects of Milk Replacer Supplemented with Ascophyllum nodosum as a Novel Ingredient to Prevent Neonatal Diarrhea in Dairy Calves and Improve Their Health Status

1
Department Civil, Environmental, Architectural Engineering and Mathematics—DICATAM, University of Brescia, 25123 Brescia, Italy
2
Department of Veterinary Medicine and Animal Sciences—DIVAS, University of Milan, 26900 Lodi, Italy
3
Department of Biotechnology and Nutrigenomics, Institute of Genetics and Animal Biotechnology of the Polish Academy of Sciences, Jastrzębiec, 05-552 Magdalenka, Poland
*
Author to whom correspondence should be addressed.
Vet. Sci. 2023, 10(10), 618; https://doi.org/10.3390/vetsci10100618
Submission received: 26 July 2023 / Revised: 4 October 2023 / Accepted: 10 October 2023 / Published: 13 October 2023

Simple Summary

The pre-weaning period in calves is a critical phase in cattle farming, where neonatal calf diarrhea can affect animal welfare, leading to death in the most severe cases. Improving animal health is necessary to reduce antibiotic use, thereby reducing antibiotic resistance. Functional ingredients such as brown seaweeds could be integrated into the calf’s nutritional plan for preventive purposes to increase gut health and metabolism. These seaweeds have a high content of bioactive compounds, such as polysaccharides, polyunsaturated fatty acids, antioxidants, peptides, vitamins, and minerals. This study evaluated the effects of using a macroalgae, Ascophyllum nodosum, as a supplement in pre-weaning calf nutrition on zootechnical performance, blood metabolism, and fecal bacteria. It was found to be particularly effective in cases of moderate diarrhea.

Abstract

Nutrition and health during pre-weaning affect the calves’ future fertility, calving age, production, and carrier length. Calves are highly susceptible to neonatal calf diarrhea (NCD), which can be fatal. NCD is due to hypovolemia and acidosis, which may involve anorexia and ataxia. The One Health principle calls for a drastic reduction in antimicrobial use. One approach is to improve animal health and reduce the use of antibiotics and functional ingredients that have beneficial effects due to bioactive compounds. Several functional ingredients and additives can be considered, and, in particular for this study, Ascophyllum nodosum was considered. The present study aimed to evaluate the role of A. nodosum as a functional ingredient implemented into the milk replacer in neonatal calves. Twelve pre-weaned Holstein Frisian calves, housed in twelve individual pens in the same environmental conditions, were divided into two groups of six animals: a control group (CTRL, n = 6) fed with a milk replacer, and a treatment group receiving milk enriched with 10 g of A. nodosum in their diet (TRT, n = 6) for 42 days. The fecal score was evaluated daily (3–0 scale) to monitor the incidence of diarrhea in the two groups. The body weight was evaluated weekly, and every two weeks feces were collected for microbiological evaluation using a selective medium for plate counting of total, lactic acid, and coliform bacteria. To verify the presence of Lactobacillus, Bifidobacterium, and Escherichia coli, real-time qPCR was used. At the beginning and at the end of the trial, blood samples were obtained for serum metabolite analysis. The growth performance did not differ in either of the two groups, but significant differences were observed in the incidence of moderate diarrhea (p-value < 0.0113), where the TRT group showed a lower incidence of cases during the 42-day period. Serum analysis highlighted higher contents of albumin, calcium, phosphorus, and total cholesterol in the TRT group compared to CTRL (p-value < 0.05). In conclusion, implementation of A. nodosum in the diet of calves can lead to better animal welfare and may reduce the use of antibiotics.

1. Introduction

The health status of calves has maximum attention during the pre-weaning period, with positive effects for the herd’s economy, ensuring the well-being and regular growth performance of calves and better milk quality and production in terms of future perspectives. Managerial success in this phase of life allows the overcoming of future and current challenges. Colostrum is the first strategy that allows calves to obtain passive immunity, ensuring animal health [1]. Despite progress in understanding the physiopathology of intestinal disease, neonatal diarrhea remains the principal cause of illness in dairy calves. The first period in calves’ lives is crucial due to increased susceptibility to pathogens [2]. Numerous infectious agents are involved in calf diarrhea, and the group of enteric pathogens is the most representative. Escherichia coli, one of the most common, is characterized by several pathotypes and represents a health challenge for calves raised worldwide [3]. The incidence of neonatal diarrhea in calves is due to a series of complex factors, including infectious agents and environmental aspects, and animal welfare should also be considered. If the calves are in poor health, this leads to lower growth performance, higher antimicrobial use, and significant costs for animal care [4,5]. Furthermore, if diarrhea is not appropriately managed, there may be increased mortality rates due to hypovolemia and acidosis, leading to anorexia and ataxia in the calves [6]. Due to high antibiotic resistance, drugs should be used following the 3Rs principle approved by the European Food Safety Authority (EFSA), and antibiotic alternatives are required [7,8]. Functional ingredients and additives can reduce the spread of antimicrobial resistance and help prevent long-lasting immunocompromising effects on the intestinal microbiome with consequent digestive tract dysfunctions. During pre-weaning, farm management plays a role in: (i) preventing diseases from spreading; (ii) ensuring future profitability, productivity, and the fertility of the herd; and (iii) reducing antimicrobial use [9,10]. The European Food Safety Authority (EFSA) has highlighted the importance of promoting new strategies that could reduce the effects of diarrhea and protect global health from a One Health perspective [11]. One approach to increase animal health and reduce the use of antibiotics is to exploit natural organisms with functional properties due to containing bioactive compounds [6,12]. One such natural organism is seaweed, also known as macroalgae, a heterogeneous group of pluricellular marine organisms rich in bioactive substances such as polysaccharides, proteins, lipids, and polyphenols that give them antibacterial, antiviral, and antifungal properties [13,14]. Many studies on animal nutrition have reported the antioxidant effects of macroalgae due to the high content of polyphenols, bioactive compounds, minerals (I, K, Ca, Mg, P, Fe, and Zn), and vitamins (C, B1, B2, and E), which are higher than in microalgae and cyanobacteria. Macroalgae also have antimicrobial effects, especially towards E. coli [13]. However, the heterogeneity of the macroalgae group influences the inclusion levels in the diet due to the different properties and biochemical composition [15,16]. There appear to be no adverse effects on monogastric animals’ performance and physiological parameters. There have been positive outcomes in treating pigs during weaning [17], and including such additives in pig feed positively impacts gut health [18]. Although monogastric species have been investigated in some depth, this is different for ruminant species. Our aim was thus to evaluate Ascophyllum nodosum and its effects as an additive in milk replacer to dairy calves during pre-weaning to test animal health, growth performance, incidence of diarrhea, and blood parameters.

2. Materials and Methods

2.1. Animals, Housing, Experimental Design and Treatment

The experimental trial was approved by the Animal Welfare Organization of the University of Milan (OPBA authorization 129/2021) and performed following European regulations in an intensive dairy farm in the north of Italy.
A total of 12 pre-weaned Holstein Frisian calves were involved in the trial at the same period of life (under one week of age), housed in individual pens, and maintained under homogeneous environmental conditions for the entire duration of the experiment. The dimensions of each pen complied with EU regulations [19]. The calves were administered a standard quantity (4 L) of colostrum within four hours after birth, and the subsequent study lasted 42 days. The quality of colostrum was assessed at 27% using a Brix refractometer. The calves were divided into two balanced groups considering the initial weight (37.79 ± 4.900 kg), the age (all the subjects had an age under one week of life when involved in the trial), and the sex (50% male, 50% female) to re-create the conditions typically present in livestock, where the pathologies related to the pre-weaning period affect both males and females. The experimental group received the same basal diet; specifically, the control group (CTRL, n = 6) was fed with milk replacer (Gruppo Veronesi S.p.a., Verona, Italy) (Table 1), and the treatment group (TRT, n = 6) was fed with milk replacer supplemented with 10 g/day of A. nodosum powder (Italfeed S.r.l., Milan, Italy). The inclusion rate was established, based on previous studies [20] that included A. nodosum and brown algae at 0.2–0.3% in monogastric feed [21,22], aiming to increase the palatability and ensuring a proper milk suspension due to the partial solubility of algal powder. The A. nodosum used in the present study contained 92% of dry matter (DM), 21.41% of ash, 8.25% of crude protein (CP), 3.3% of ether extract (EE), and 3.57% of crude fiber (CF). The nutrient composition of the alga was analyzed following the official methods (AOAC, 2019) for the evaluation of DM, CP, EE, and ash content. Each parameter has been determined in triplicate. The DM was determined after drying the alga in a forced air oven at 65 °C for 24 h (AOAC method 930.15). Nitrogen content was determined using the Kjeldahl method (AOAC method 2001.11), and CP content was calculated as N × 6.25. The EE was obtained with a Soxhlet system, using an ether extraction (AOAC method 2003.05). Finally, ash content was obtained after incineration in a muffle furnace at 550 °C (AOAC method 942.05).
The animals were fed twice a day. At the beginning of the trial, calves received 4 L of milk replacer equally distributed for the two meals (quantity of powder = 100g/L as indicated by the manufacturers Lattover, Veronesi Verona S.p.A., Verona, Italy), which was increased every week following the nutritional guidelines for calves [19,23] and their growth curve [24]. Fecal score was checked daily for the presence of diarrhea. The fecal score was assessed using a four-level scale: 0 = normal consistency (feces firm and well-formed); 1 = soft consistency (feces soft and formed); 2 = mild diarrhea (fluid and yellowish); 3 = severe diarrhea (fluid and projectile) [25]. A fecal score ≤ 1 was considered normal, whereas a fecal > 1 was defined as diarrhea. Moreover, in order to monitor the animal welfare, the health status was also screened daily by observing the vitality of the animals [26]. Each animal was individually weighed once a week, and the feed intake was evaluated by measuring the feed refused. Average daily feed intake (ADFI) was calculated. Every two weeks, feces were collected in sterile tubes and stored at −20 °C until the DNA extraction. The sampling was performed after the administration of the morning meal through rectal stimulation. Blood samples were collected on days 0 and 42, before the administration of the morning meal, from the jugular vein using 10 mL vacuum tubes without any anticoagulant. After the sampling, the blood was allowed to clot at room temperature and centrifugated at 3000 rpm for 15 min at 4 °C to obtain the serum that was immediately stored at −20 °C.

2.2. Metabolic Profile, Antioxidant Barrier, and Immunoenzymatic Analysis in Serum Samples

2.2.1. Metabolic Profile

The serum aliquots were analyzed using a multiparametric autoanalyzer for clinical chemistry (ILab 650; Instrumentation Laboratory Company, Lexington, MA, USA), and the following parameters were considered: albumin (g/L); globulin (g/L); albumin/globulin (A/G ratio); beta-hydroxybutyrate (mmol/L); gamma-glutamyl transferase (IU/L); non-esterified fatty acids (mmol/L); glucose (mmol/L); urea (mmol/L); total bilirubin (µmol/L); total cholesterol (mmol/L); triglycerides (mmol/L); phosphorus (mmol/L); calcium (mmol/L); and magnesium (mmol/L). The serums were analyzed by the Experimental Institute of Lombardy and Emilia Romagna (IZSLER).

2.2.2. Antioxidant Barrier

The oxidative status of the calf serum was evaluated through two commercial kits: an OXY-Adsorbent test and a dROMs test (DIACRON INTERNATIONAL research and diagnostic, Grosseto, Italy). The OXY-Adsorbent test was used to evaluate the capacity of a serum sample to counteract a massive oxidant insult in vitro inducted from a solution of HClO. A chromogenic technique was used to obtain a numerical result through a photometric reading. The dROMs test measures the oxidant capacity towards a modified aromatic amine used for its chromogen effect (DIACRON, 2022). The absorbance of each sample was read at a wavelength of 546 nm through a spectrophotometer (V630 UV–Vis, Jasco GmBH, Pfungstadt, Germany).

2.2.3. Immunoenzymatic Tests for Serum Concentration of Trefoil Factor 3 and Diamine Oxidase

Immunoenzymatic tests and the enzyme-linked immunoassay (ELISA) were used to analyze the serum and thus highlight the animals’ health status by indirect markers. Specific kits were used for the detection of diamine oxidase (DAO) and trefoil factor 3 (TFF-3) as indirect markers of gut integrity directly implicated in the intestinal integrity of calves (Li StarFish S.r.l., Milan, Italy).

2.3. Microbiological and Molecular Analysis of Fecal Samples

2.3.1. Bacterial Count

After collection, the feces were placed at 4 °C overnight, and plate counting was performed. One gram of each fecal sample was homogenized with 9 mL of sterile physiological solution and centrifuged (3000 rpm for 10 min at RT) to collect the supernatant. Samples were progressively diluted up to 10−10 [27] and then plated in three replicates in Petri dishes to count the total bacteria, lactic acid bacteria, and coliform bacteria using:
(i)
Total bacteria: Plate Count Agar (PCA) (Liofilchem, Teramo, Italy). Incubation lasted three days at 30 °C (Merck, Taufkirchen, Germany);
(ii)
Lactic acid bacteria: de Man, Rogosa and Sharpe Agar (MRSA) (Liofilchem, Teramo, Italy). Incubation lasted three days at 30 °C under microaerophilic conditions (Merck, Taufkirchen, Germany);
(iii)
Coliform bacteria: Violet Red Bile Lactose Agar (VRBLA) (Liofilchem, Teramo, Italy). Incubation lasted 18–24 h at 35 °C under microaerophilic conditions (Merck, Taufkirchen, Germany).
All the results were expressed as log10 of colony-forming units per gram of fresh feces (Log10 CFU/g).

2.3.2. Bacterial DNA Extraction and Real-Time PCR

Fecal swabs were collected every two weeks and stored at −20 °C until further processing. The total DNA was extracted from swabs using the QIAamp Power Faecal Pro DNA kit (QIAGEN, Düsseldorf, Germany) using the manufacturer’s instructions. DNA concentration and DNA quality were evaluated using a Nanodrop BioteK Synergy HTX spectrophotometer (Agilent, Carpinteria, CA, USA). A real-time PCR was conducted to evaluate the relative abundances of different bacterial populations. E. coli was used as representative pathogenic bacteria and Lactobacillus spp. and Bifbifidobacterium spp. as beneficial bacteria (Table 2). A comparative ∆∆CT approach was used in the real-time PCR, while the quantification of total bacteria was used as an endogenous control [28]. The qRT-PCR was carried out with the CFX Opus 96 (BioRAD, Richmond, CA, USA). The PCR mixing was performed in a total of 25 μL containing 12.5 μL of 2X SsoAdvanced Universal SYBR Green Supermix (BioRad, Richmond, CA, USA), 0.5 µM of each primer, and 50 ng of DNA template. The parameters for the amplification were as follows: for the Lactobacillus spp. used for an initial denaturation of 2′ at 98 °C, followed by 40 cycles of 15″ at 98 °C, 30″ of annealing at 56.5 °C and 40″ of extension at 60 °C. Instead, the amplification of total bacteria, E. coli spp. and Bifidobacterium spp. were the same for an initial denaturation of 2′ at 98 °C, followed by 40 cycles of 15″ at 9 °C and, 40″ of annealing/extension at 60 °C. The melting curve for all the amplification was determined in 60–95 °C range with increments every 5′ of 0.5 °C.

2.4. Statistical Analysis

The number of animals (six for each group) was defined using the GPower software, version 3.1.9.7., considering an observable difference of two independent samples for a power test set at 80%, a protection level of 95%, and an effect size of 1.12%.
Data analysis was conducted using GraphPad Prism (v. 9.00, Boston, MA, USA). The normality distribution of the data was evaluated by the Shapiro–Wilk test. Zootechnical performance, fecal score data, and fecal bacterial counts were analyzed using a repeated-measures two-way ANOVA. The results were evaluated using a full factorial model (Treatment: Trt, Time: Time, Interaction: Trt × Time). Daily data of feed intake were analyzed using the weekly average for each calf. Multiple comparisons among groups were evaluated by performing Tukey’s honest significance difference test (Tukey’s HSD).
To adjust the initial variability of serum samples, serum metabolite data, OXY and dROMs tests, and ELISA results were evaluated after analyzing the covariances (ANCOVA) to adjust for the initial individual variability. The results were statistically different at p-values lower than 0.05 and are presented as the mean ± standard error or standard deviation.

3. Results

3.1. Zootechnical Performances

The seaweed supplementation in the milk replacer did not influence the performance of pre-weaning calves (Figure 1). The treatment did not affect the acceptability of the animals’ diet; the experimental groups showed similar average daily feed intakes (ADFI) (Figure 1b). The results showed a constant and comparable increase in body weight in both experimental groups during the entire trial period (42 days). As for the other zootechnical parameters, ADG did not differ between TRT and CTRL groups and constantly increased from 0.16 ± 0.235 kg at T1, reaching 0.84 ± 0.200 kg at T6 for the CTRL group and from 0.17 ± 0.191 kg to 0.84 ± 0.260 kg for the TRT group. Also, FCR did not differ between TRT and CTRL groups, starting from 5.34 ± 14.870 kg at T1 and reaching 1.05 ± 0.286 kg at T6 for the CTRL group and starting from 7.45 ± 7.480 kg and reaching 1.12 ± 0.349 kg for the TRT group.

3.2. Metabolic Profile, Antioxidant Barrier, and Immunoenzymatic Analysis of Serum Samples

3.2.1. Metabolic Profile

Analysis of the metabolic profile in the TRT group showed that the albumin, calcium, phosphorus, and total cholesterol levels (p < 0.05; Table 3) were significantly higher than in the CTRL group.

3.2.2. Oxidative Status of Blood Serum

Data from the OXY-adsorbent test and the d-ROMs test revealed no significant differences between experimental groups after 42 days of the trial (Figure 2). The OXY-adsorbent test value at the end of the trial was 264.40 ± 91.781 µmol HClO/mL in the control group and 320.69 ± 53.634 µmol HClO/mL in the treatment group (Figure 2a). Consequently, the dROMs test shows no significant differences at day 42 in the CTRL and TRT groups (145.44 ± 36.511 and 182.85 ± 19.297 UCARR, respectively) (Figure 2b).

3.2.3. Immunoenzymatic Test

As well as the previous parameters considered, the enzyme immunoassays performed showed no significant differences between the two test groups. Specifically, DAO decreased during the trial in both experimental groups, and TFF-3 did not differ after 42 days between the CRTL and TRT group (Table 4).

3.3. Diarrhea Occurrence and Fecal Samples Analysis

The occurrence of diarrhea, assessed by fecal score determination, was found to have a constant trend throughout the trial period (Figure 3). Specifically, the data obtained showed that the TRT group had a reduced fecal score during all weeks of the trial compared with the CTRL group. This difference was also statistically significant (p < 0.05) during the fourth week of the trial.
These findings in lower fecal score value in the TRT group align with the registered days of diarrhea occurrence. Figure 4 shows the daily distribution of fecal scores between the two groups. Darker colors indicate a low fecal score with a lower incidence of diarrhea. In comparison, lighter colors are associated with higher fecal scores and a higher incidence of diarrhea and the critical period (fecal score over 2) in the CRTL group lasted over 34 days (p < 0.024). In contrast, in the TRT group, the fecal score began to drop at around day 19, with a more excellent distribution of more compact feces.
The fecal scores were further evaluated by adding the total number of cases of moderate diarrhea (fecal score 2) and severe diarrhea (fecal score 3) throughout the trial (Figure 5). There was a difference between the two groups in cases of fecal score 2, where the animals showed a reduction of moderate diarrhea of 50.66% in TRT compared to CTRL during the experimental trial, but there were no significant differences in severe diarrhea cases (FS 3). The number of total days with fecal score = 2, considering all the animals, was 150 days for the CRTL group and 74 days for the TRT group, and were significantly lower in the TRT group, suggesting a possible ability of A. nodosum to counteract the onset of moderate diarrhea (Figure 5) [33,34].

3.4. Bacterial Count in Fecal Samples

No differences between groups have been revealed regarding total bacteria, lactic acid, and coliform bacteria count; high individual variability is observed during the trial (Figure 6).

3.5. PCR, Molecular Microbiology

The relative abundance of health-promoting and Gram-negative pathogenic bacteria in the feces was determined by real-time PCR. The values were normalized considering the CTRL group to have a value of 1. Figure 7 shows no statistical differences between Bifidobacterium spp., Lactobacillus spp., and E. Coli between CTRL and TRT groups (p > 0.05).

4. Discussion

4.1. Zootechnical Performances

Zootechnical performances of calves are related to several factors, and can be implemented through correct management, that can involve, for example, new technological systems correlated to the innovative approach of precision livestock that aims to look at physiological, behavioral, and production indicators to improve management and performance [35], or nutritional aspects directly correlated with animal growth and future milk production [36]. Our results, related to zootechnical performance, showed no differences between the experimental groups. This result highlights that the inclusion of 10 g/day of A. nodosum did not affect the growth of animals. This is in line with previous studies reported in literature. In fact, studies reported that use a higher inclusion level (25 g/4L) did not disclose significant differences either [37]. Therefore, choosing a lower dosage of inclusion is a good strategy from a cost/benefit ratio perspective. Average daily feed intakes (ADFI), along with body weight (BW), and the feed conversion ratio (FCR), are commonly used for evaluating the zootechnical performances of animals during feeding trials. An animal’s growth can be considered an indirect index of its health status, where a phenotypical evaluation correlates to animal welfare. Our results on the performances of calves that were fed with A. nodosum align with other studies [37], where the zootechnical performance did not differ between the two groups. BW and ADFI constantly increased during the trial, in line with previous studies in each group [38].

4.2. Metabolic Profile, Antioxidant Barrier, and Immunoenzymatic Analysis of Serum Samples

Metabolic profile, antioxidant barrier, and immunoenzymatic evaluations in calves provided additional data on their health status. Metabolic profile differed between groups. Albumin is produced in the liver, and is a serum protein involved in osmotic pressure maintenance. Its principal role is the metabolite transport of, for example, calcium, lipids, hormones, and drugs. The increase in albumin could be directly correlated with the presence of calcium, phosphorus, and total cholesterol because albumin is directly related to their transport. At different days of life, a significant modification in total protein, albumin, and globulin levels has been observed (p < 0.001) [39]. In previous work [39], albumin constantly increased significantly from birth up to day 84 of age (p < 0.001). This indicator partially reflects hepatic synthesis and could be related to compensation of decreasing serum osmotic pressure due to a decline in globulin levels. In our study, after 42 days (p < 0.05), the TRT group exhibited an increased concentration of total cholesterol and no difference in triglyceride levels compared with the CTRL group. The quantity of fat absorbed from the gastrointestinal tract (GIT) and re-esterified lipids (in various lipoproteins) into low-density lipoproteins (LDL) by the liver determines the cholesterol serum levels in calves [40]. A. nodosum increased lipid metabolism in rats, thereby promoting antioxidant activity [41]. One of the principal mineral elements in A. nodosum is iodine, which is related to higher levels of total cholesterol. This mineral in animal nutrition is involved in the activation of energy metabolism [42]. The hypometabolic profile represented by the whole cholesterol level was thus different among groups [26]; the treated group had a greater total cholesterol concentration than the control group. The higher levels in the treated group could result from higher systemic metabolic activity due to the mineral and functional characteristics of A. nodosum [43]. There were different minerals in the two study groups due to the high mineral content of A. nodosum, especially iodine, calcium, phosphorus, and potassium [43,44]. An increase in circulating calcium and phosphorus levels in the bloodstream of the treated group could be related to the supplementation with A. nodosum, which provides an increased level of micronutrients. In addition, calcium and phosphorus homeostasis reveals the animal’s healthy bone structures, which were under the hormonal control of calcitonin and parathormone [45]. High circulating levels suggested ample mineral availability and, thus, an increased basal metabolism in favor of free calcium and phosphorus. In particular, albumin is directly correlated with diarrhea presence. Previous studies disclosed that the animals with diarrhea had lower albumin values compared to those without diarrhea, thus supporting the correlation between the albumin value and the diarrhea cases [46]. Calves with diarrhea often have decreased levels of total cholesterol. These changes in lipid levels are thought to be due to the liver’s increased cholesterol metabolism in response to diarrhea. The liver produces bile acids from cholesterol, which are then used to digest fats in the small intestine. When calves have diarrhea, they lose fluids and electrolytes, including bile acids. This can lead to decreased cholesterol levels in the blood [47]. The higher level of calcium and phosphorus observed in the TRT group could be correlated to the inclusion of algae in the milk replacement. A. nodosum is rich in minerals and reports a high level of calcium and phosphorus [44]. Regarding oxidative status, the obtained outcomes in the oxidative group of blood serums suggest that the algae supplementation did not impair the serum antioxidant barrier, thus highlighting the overall good health status of the animals. Regarding the immunoenzymatic test, DAO and TFF-3 were chosen as indirect markers of the gastrointestinal integrity of the calves, and no differences were observed in either of the results. The treatment did not influence these parameters. The TFF-3 was considered in this study as a marker of the calves’ diarrhea status, as it has been shown that a higher serum concentration of this biomarker is correlated with diarrhea in calves [48]. The increase in TFF-3 in serum is also associated with mucosal damage [45]. DAO is an enzyme that has demonstrated, like TFF-3, a correlation with intestinal wall permeability and, consequently, the barrier’s functionality [45]. DAO is implicated in the degradation in the small intestine of histamine, a cytoplasmatic enzyme localized in the mucosa. This enzyme in serum helps assess diarrhea in humans, rats, and calves [49].

4.3. Diarrhea Occurrence and Fecal Samples Analysis

Fecal score (FS) 0–1 was considered as an index of normal feces, while FS 2–3 showed a watery consistency of waste (considered diarrhea) [25,50,51]. Different management, hygiene, and colostrum assumptions can modify the duration of passive immunity [52]; after the initial period of life, the animals gradually reduce passive immunity [53]. The previous finding could be due to the supplementation of A. nodosum, which has shown an interesting antimicrobial effect against several pathogens involved in diarrhea [13]. In addition, the period between T3–T4 corresponds to the acquirement of active immunity by calves, which in TRT probably resulted in more resilient animals with improved fecal consistency. A. nodosum is a functional ingredient that reduces mild diarrhea cases, not acting on severe diarrhea. The results suggested a preventive effect of algal supplementation in mild diarrhea cases (Figure 5).

4.4. Bacterial Count in Fecal Samples

Immediately after calving, the newborn colonizes their gastrointestinal tract, the starting point of developing microbiota, until the gut microbiota stabilizes with animal growth [54]. Weaning calves are particularly subject to gastrointestinal infections and diarrhea is often associated with pathogens. Nevertheless, an alteration in the gut microbial population plays an important role. As a consequence, we assessed the principal fecal microbial classes.

4.5. PCR, Molecular Microbiology

Our plate counting method resulted in an overall indication of the principal bacterial composition in feces. We also conducted a molecular approach based on qPCR for fecal samples to identify the principal bacterial population. In our study on calves, the counting method and q-PCR disclosed similar results. A slight increase in Lactobacillus spp. in the TRT group at T6 has been observed. On the other hand, a slight increase in E. coli was observed in the CTRL group simultaneously. This suggests that adding A. nodosum to the milk replacer does not impair the fecal bacterial composition in calves. However, more studies are needed to increase the sample size population that, in the present study, could be a limitation due to the smallness of the sample size. Moreover, these data should be considered preliminary. In fact, for a more profound knowledge of the effects of A. nodosum supplementation on the intestinal microbiota composition, it is necessary to define the interaction in the gut microbiota. Previous studies on tributyrin in piglets showed a reduction in the Lactobacillus spp. [55], and a significant increase in the beta diversity of gut microbiota with a positive modulation of several bacteria, which are generally positively correlated with animal performance and health.

5. Conclusions

The dietary supplementation of A. nodosum in a milk replacer of Holstein Frisian calves during the pre-weaning period revealed an improvement in the fecal score in the treated group, thus suggesting a possible counteracting effect, particularly in terms of reducing the moderate diarrhea frequency. Differences in the serum metabolic profile were found in the concentrations of albumin, total cholesterol, calcium, and phosphorus, which were higher in the treated group, suggesting a positive effect on animal health, such as the correlations of albumin and cholesterol with diarrhea. Therefore, our study highlights that supplementing A. nodosum in pre-weaning calves could be used as a method in disease prevention strategies and in improving health status according to the One Health principles.

Author Contributions

Conceptualization, L.R. and E.S.; methodology, E.S. and S.R.; software, S.F. and M.D.; validation, S.F. and M.H.; formal analysis E.S. and S.R; investigation, E.S., S.R. and S.F.; resources, M.D. and M.H.; data curation, E.S., S.F. and S.R.; writing—original draft preparation, E.S. and B.C.; writing—review and editing, E.S., B.C. and S.R.; visualization, E.S. and L.R.; supervision, L.R.; project administration, L.R.; funding acquisition, L.R. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the University of Milan, “POR FERS 2014-2020 (FOODTECH)”; funding number: RL_DG-UNI17LROSS_01.

Institutional Review Board Statement

The experimental trial was approved by the Animal Welfare Organization of the 98 University of Milan (OPBA authorization 129/2021) and performed following European 99 regulations in an intensive dairy farm in the north of Italy.

Informed Consent Statement

All animal owners were informed and agreed to our research.

Data Availability Statement

The data presented in this study are not deposited in an official repository. Data are available within the article and from the corresponding author upon reasonable request.

Acknowledgments

The authors acknowledge the support of the APC central fund of the University of Milan.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Thomas, B.L.; Guadagnin, A.R.; Fehlberg, L.K.; Sugimoto, Y.; Shinzato, I.; Drackley, J.K.; Cardoso, F.C. Feeding rumen-protected lysine to dairy cows prepartum improves performance and health of their calves. J. Dairy Sci. 2022, 105, 2256–2274. [Google Scholar] [CrossRef] [Scilit]
  2. Smith, D.R. Field Disease Diagnostic Investigation of Neonatal Calf Diarrhea. Vet. Clin. Food Anim. Pract. 2012, 28, 465–481. [Google Scholar] [CrossRef] [Scilit]
  3. Weber, L.P.; Dreyer, S.; Heppelmann, M.; Schaufler, K.; Homeier-Bachmann, T.; Bachmann, L. Prevalence and Risk Factors for ESBL/AmpC-E. coli in Pre-Weaned Dairy Calves on Dairy Farms in Germany. Microorganisms 2021, 9, 2135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. De Campos, J.L.; Kates, A.; Steinberger, A.; Sethi, A.; Suen, G.; Shutske, J.; Safdar, N.; Goldberg, T.; Ruegg, P.L. Quantification of antimicrobial usage in adult cows and preweaned calves on 40 large Wisconsin dairy farms using dose-based and mass-based metrics. J. Dairy Sci. 2021, 104, 4727–4745. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Hommels, N.M.C.; Ferreira, F.C.; van den Borne, B.H.P.; Hogeveen, H. Antibiotic use and potential economic impact of implementing selective dry cow therapy in large US dairies. J. Dairy Sci. 2021, 104, 8931–8946. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Maier, G.U.; Breitenbuecher, J.; Gomez, J.P.; Samah, F.; Fausak, E.; Van Noord, M. Vaccination for the Prevention of Neonatal Calf Diarrhea in Cow-Calf Operations: A Scoping Review. Vet. Anim. Sci. 2022, 15, 100238. [Google Scholar] [CrossRef] [Scilit]
  7. Bokma, J.; Boone, R.; Deprez, P.; Pardon, B. Risk factors for antimicrobial use in veal calves and the association with mortality. J. Dairy Sci. 2019, 102, 607–618. [Google Scholar] [CrossRef] [Scilit]
  8. EUR-Lex. Regulation (EU) 2019/6 of the European Parliament and of the Council of 11 December 2018 on veterinary medicinal products and repealing Directive 2001/82/EC. Off. J. Eur. Union 2019, 276, 43–167. [Google Scholar]
  9. Heinrichs, A.J.; Heinrichs, B.S. A prospective study of calf factors affecting first-lactation and lifetime milk production and age of cows when removed from the herd1. J. Dairy Sci. 2011, 94, 336–341. [Google Scholar] [CrossRef] [Scilit]
  10. Palczynski, L.J.; Bleach, E.C.L.; Brennan, M.L.; Robinson, P.A. Appropriate Dairy Calf Feeding from Birth to Weaning: “It’s an Investment for the Future”. Animals 2020, 10, 116. [Google Scholar] [CrossRef] [Scilit]
  11. European Parliament and Council. Regulation (EC) No 1831/2003 of the European Parliament and of the Council of 22 September 2003 on additives for use in animal nutrition. Off. J. Eur. Union 2003, 268, 29–43. [Google Scholar]
  12. Morais, T.; Inácio, A.; Coutinho, T.; Ministro, M.; Cotas, J.; Pereira, L.; Bahcevandziev, K. Seaweed Potential in the Animal Feed: A Review. J. Mar. Sci. Eng. 2020, 8, 559. [Google Scholar] [CrossRef] [Scilit]
  13. Frazzini, S.; Scaglia, E.; Dell’Anno, M.; Reggi, S.; Panseri, S.; Giromini, C.; Lanzoni, D.; Sgoifo Rossi, C.A.; Rossi, L. Antioxidant and Antimicrobial Activity of Algal and Cyanobacterial Extracts: An In Vitro Study. Antioxidants 2022, 11, 992. [Google Scholar] [CrossRef] [Scilit]
  14. Garcia-Vaquero, M.; Rajauria, G.; O’Doherty, J.V.; Sweeney, T. Polysaccharides from macroalgae: Recent advances, innovative technologies and challenges in extraction and purification. Food Res. Int. 2017, 99, 1011–1020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Narayan, B.; Kumar, C.S.; Sashima, T.; Maeda, H.; Hosokawa, M.; Miyashita, K. Composition, functionality and potential applications of seaweed lipids. In Biocatalysis and Bioenergy; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2008; pp. 463–490. [Google Scholar] [CrossRef] [Scilit]
  16. Peñalver, R.; Lorenzo, J.M.; Ros, G.; Amarowicz, R.; Pateiro, M.; Nieto, G. Seaweeds as a Functional Ingredient for a Healthy Diet. Mar. Drugs 2020, 18, 301. [Google Scholar] [CrossRef] [Scilit]
  17. Michiels, J.; Missotten, J.A.M.; Fremaut, D.; De Smet, S.; Dierick, N.A. In vitro characterisation of the antimicrobial activity of selected essential oil components and binary combinations against the pig gut flora. Anim. Feed. Sci. Technol. 2009, 151, 111–127. [Google Scholar] [CrossRef] [Scilit]
  18. Lallès, J.P.; Bosi, P.; Smidt, H.; Stokes, C.R. Nutritional management of gut health in pigs around weaning. Proc. Nutr. Soc. 2007, 66, 260–268. [Google Scholar] [CrossRef] [Scilit]
  19. Council Directive 2008/119/EC of 18 December 2008 Laying Down Minimum Standards for the Protection of Calves (Codified Version). 2019. Available online: http://data.europa.eu/eli/dir/2008/119/2019-12-14/eng (accessed on 10 July 2023).
  20. Samarasinghe, M.B.; Sehested, J.; Weisbjerg, M.R.; Van Der Heide, M.E.; Nørgaard, J.V.; Vestergaard, M.; Hernández-Castellano, L.E. Feeding milk supplemented with Ulva sp., Ascophyllum nodosum, or Saccharina latissima to preweaning dairy calves: Effects on growth, gut microbiota, gut histomorphology, and short-chain fatty acids in digesta. J. Dairy Sci. 2021, 104, 12117–12126. [Google Scholar] [CrossRef] [Scilit]
  21. Michiels, J.; Skrivanova, E.; Missotten, J.; Ovyn, A.; Mrazek, J.; De Smet, S.; Dierick, N. Intact Brown Seaweed (Ascophyllum Nodosum) in Diets of Weaned Piglets: Effects on Performance, Gut Bacteria and Morphology and Plasma Oxidative Status. J. Anim. Physiol. Anim. Nutr. 2012, 96, 1101–1111. [Google Scholar] [CrossRef] [Scilit]
  22. Gahan, D.A.; Lynch, M.B.; Callan, J.J.; O’Sullivan, J.T.; O’Doherty, J.V. Performance of Weanling Piglets Offered Low-, Medium- or High-Lactose Diets Supplemented with a Seaweed Extract from Laminaria spp. Animal 2009, 3, 24–31. [Google Scholar] [CrossRef] [Scilit]
  23. Amaral-Phillips, D.M.; Scharko, P.B.; Johns, J.T.; Franklin, S. Feeding and Managing Baby Calves from Birth to 3 Months of Age. UK Cooperative Extension Service, University of Kentucky, ASC-161. 2006. Available online: http://www2.ca.uky.edu/agcomm/pubs/asc/asc161/ASC161.PDF (accessed on 10 July 2023).
  24. Dell’Anno, M.; Reggi, S.; Caprarulo, V.; Hejna, M.; Sgoifo Rossi, C.A.; Callegari, M.L.; Baldi, A.; Rossi, L. Evaluation of Tannin Extracts, Leonardite and Tributyrin Supplementation on Diarrhoea Incidence and Gut Microbiota of Weaned Piglets. Animals 2021, 11, 1693. [Google Scholar] [CrossRef] [Scilit]
  25. Rossi, L.; Dell’Orto, V.; Vagni, S.; Sala, V.; Reggi, S.; Baldi, A. Protective effect of oral administration of transgenic tobacco seeds against verocytotoxic Escherichia coli strain in piglets. Vet. Res. Commun. 2014, 38, 39–49. [Google Scholar] [CrossRef] [Scilit]
  26. Dell’Anno, M.; Scaglia, E.; Reggi, S.; Grossi, S.; Sgoifo Rossi, C.A.; Frazzini, S.; Caprarulo, V.; Rossi, L. Evaluation of tributyrin supplementation in milk replacer on diarrhoea occurrence in preweaning Holstein calves. Animal 2023, 17, 100791. [Google Scholar] [CrossRef] [Scilit]
  27. Bellali, S.; Lagier, J.-C.; Raoult, D.; Bou Khalil, J. Among Live and Dead Bacteria, the Optimization of Sample Collection and Processing Remains Essential in Recovering Gut Microbiota Components. Front. Microbiol. 2019, 10, 1606. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Matsui, H.; Imai, T.; Kondo, M.; Ban-Tokuda, T.; Yamada, Y. Effects of the supplementation of a calcium soap containing medium-chain fatty acids on the fecal microbiota of pigs, lactating cows, and calves. Anim. Sci. J. 2021, 92, e13636. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Dubernet, S.; Desmasures, N.; Guéguen, M. A PCR-based method for identification of lactobacilli at the genus level. FEMS Microbiol. Lett. 2002, 214, 271–275. [Google Scholar] [CrossRef]
  30. Matsuki, T.; Watanabe, K.; Fujimoto, J.; Kado, Y.; Takada, T.; Matsumoto, K.; Tanaka, R. Quantitative PCR with 16S rRNA-gene-targeted species-specific primers for analysis of human intestinal bifidobacteria. Appl. Environ. Microbiol. 2004, 70, 167–173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Kakinuma, K.; Fukushima, M.; Kawaguchi, R. Detection and identification of Escherichia coli, Shigella, and Salmonella by microarrays using the gyrB gene. Biotechnol. Bioeng. 2003, 83, 721–728. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Abrar, A.; Kondo, M.; Kitamura, T.; Ban-Tokuda, T.; Matsui, H. Effect of Supplementation of Rice Bran and Fumarate Alone or in Combination on in Vitro Rumen Fermentation, Methanogenesis and Methanogens. Anim. Sci. J. 2016, 87, 398–404. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Sweeney, T.; Meredith, H.; Vigors, S.; McDonnell, M.J.; Ryan, M.; Thornton, K.; O’Doherty, J.V. Extracts of laminarin and laminarin/fucoidan from the marine macroalgal species Laminaria digitata improved growth rate and intestinal structure in young chicks, but does not influence Campylobacter jejuni colonisation. Anim. Feed Sci. Technol. 2017, 232, 71–79. [Google Scholar] [CrossRef] [Scilit]
  34. O’Doherty, J.V.; Venardou, B.; Rattigan, R.; Sweeney, T. Feeding Marine Polysaccharides to Alleviate the Negative Effects Associated with Weaning in Pigs. Animals 2021, 11, 2644. [Google Scholar] [CrossRef] [Scilit]
  35. Silva, F.G.; Conceição, C.; Pereira, A.M.F.; Cerqueira, J.L.; Silva, S.R. Literature Review on Technological Applications to Monitor and Evaluate Calves’ Health and Welfare. Animals 2023, 13, 1148. [Google Scholar] [CrossRef] [Scilit]
  36. Gelsinger, S.L.; Heinrichs, A.J.; Jones, C.M. A meta-analysis of the effects of preweaned calf nutrition and growth on first-lactation performance. J. Dairy Sci. 2016, 99, 6206–6214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Samarasinghe, M.B.; Sehested, J.; Weisbjerg, M.R.; Vestergaard, M.; Hernández-Castellano, L.E. Milk supplemented with dried seaweed affects the systemic innate immune response in preweaning dairy calves. J. Dairy Sci. 2021, 104, 3575–3584. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Curtis, G.; Argo, C.M.; Jones, D.; Grove-White, D. The impact of early life nutrition and housing on growth and reproduction in dairy cattle. PLoS ONE 2018, 13, e0191687. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Mohri, M.; Sharifi, K.; Eidi, S. Hematology and serum biochemistry of Holstein dairy calves: Age related changes and comparison with blood composition in adults. Res. Vet. Sci. 2007, 83, 30–39. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Ferronato, G.; Cattaneo, L.; Trevisi, E.; Liotta, L.; Minuti, A.; Arfuso, F.; Lopreiato, V. Effects of Weaning Age on Plasma Biomarkers and Growth Performance in Simmental Calves. Animals 2022, 12, 1168. [Google Scholar] [CrossRef] [Scilit]
  41. Tung, Y.-T.; Wu, C.-H.; Chen, W.-C.; Pan, C.-H.; Chen, Y.-W.; Tsao, S.-P.; Chen, C.-J.; Huang, H.-Y. Ascophyllum nodosum and Fucus vesiculosus Extracts Improved Lipid Metabolism and Inflammation in High-Energy Diet–Induced Hyperlipidemia Rats. Nutrients 2022, 14, 4665. [Google Scholar] [CrossRef] [Scilit]
  42. Evglevskiy, A.A.; Shvets, O.M.; Mikhaleva, T.I. Clinical and metabolic effects of the original iodine metabolic composition in the experiment on calves. E3S Web Conf. 2021, 285, 04003. [Google Scholar] [CrossRef] [Scilit]
  43. Makkar, H.P.S.; Tran, G.; Heuzé, V.; Giger-Reverdin, S.; Lessire, M.; Lebas, F.; Ankers, P. Seaweeds for livestock diets: A review. Anim. Feed Sci. Technol. 2016, 212, 1–17. [Google Scholar] [CrossRef] [Scilit]
  44. Pereira, L.; Morrison, L.; Shukla, P.S.; Critchley, A.T. A concise review of the brown macroalga Ascophyllum nodosum (Linnaeus) Le Jolis. J. Appl. Phycol. 2020, 32, 3561–3584. [Google Scholar] [CrossRef] [Scilit]
  45. Li, F.-C.; Li, Y.-K.; Fan, Y.-C.; Wang, K. Plasma concentration of diamine oxidase (DAO) predicts 1-month mortality of acute-on-chronic hepatitis B liver failure. Clin. Chim. Acta 2018, 484, 164–170. [Google Scholar] [CrossRef] [Scilit]
  46. Choi, K.-S.; Kang, J.-H.; Cho, H.-C.; Yu, D.-H.; Park, J. Changes in serum protein electrophoresis profiles and acute phase proteins in calves with diarrhea. Can. J. Vet. Res. Rev. Can. Rech. Vet. 2021, 85, 45–50. [Google Scholar]
  47. Bozukluhan, K.; Merhan, O.; Gokce, H.I.; Deveci, H.A.; Gokce, G.; Ogun, M.; Marasli, S. Alterations in lipid profile in neonatal calves affected by diarrhea. Vet. World 2017, 10, 786–789. [Google Scholar] [CrossRef] [Scilit]
  48. Ok, M.; Yildiz, R.; Hatipoglu, F.; Baspinar, N.; Ider, M.; Üney, K.; Ertürk, A.; Durgut, M.K.; Terzi, F. Use of intestine-related biomarkers for detecting intestinal epithelial damage in neonatal calves with diarrhea. Am. J. Vet. Res. 2020, 81, 139–146. [Google Scholar] [CrossRef] [Scilit]
  49. Fukuda, T.; Tsukano, K.; Nakatsuji, H.; Suzuki, K. Plasma diamine oxidase activity decline with diarrhea severity in calves indicating systemic dysfunction related to intestinal mucosal damage. Res. Vet. Sci. 2019, 126, 127–130. [Google Scholar] [CrossRef] [Scilit]
  50. Santos, F.H.R.; Paula, M.R.D.; Lezier, D.; Silva, J.T.; Santos, G.; Bittar, C.M.M. Essential oils for dairy calves: Effects on performance, scours, rumen fermentation and intestinal fauna. Animal 2015, 9, 958–965. [Google Scholar] [CrossRef] [Scilit]
  51. Gomez, D.E.; Arroyo, L.G.; Costa, M.C.; Viel, L.; Weese, J.S. Characterization of the fecal bacterial microbiota of healthy and diarrheic dairy calves. J. Vet. Intern. Med. 2017, 31, 928–939. [Google Scholar] [CrossRef] [Scilit]
  52. Barry, J.; Bokkers, E.A.M.; Berry, D.P.; de Boer, I.J.M.; McClure, J.; Kennedy, E. Associations between colostrum management, passive immunity, calf-related hygiene practices, and rates of mortality in preweaning dairy calves. J. Dairy Sci. 2019, 102, 10266–10276. [Google Scholar] [CrossRef] [Scilit]
  53. Lora, I.; Gottardo, F.; Contiero, B.; Dall Ava, B.; Bonfanti, L.; Stefani, A.; Barberio, A. Association between passive immunity and health status of dairy calves under 30 days of age. Prev. Vet. Med. 2018, 152, 12–15. [Google Scholar] [CrossRef] [Scilit]
  54. Meale, S.J.; Li, S.; Azevedo, P.; Derakhshani, H.; Plaizier, J.C.; Khafipour, E.; Steele, M.A. Development of Ruminal and Fecal Microbiomes Are Affected by Weaning But Not Weaning Strategy in Dairy Calves. Front. Microbiol. 2016, 7, 582. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Miragoli, F.; Patrone, V.; Prandini, A.; Sigolo, S.; Dell’Anno, M.; Rossi, L.; Senizza, A.; Morelli, L.; Callegari, M.L. Implications of Tributyrin on Gut Microbiota Shifts Related to Performances of Weaning Piglets. Microorganisms 2021, 9, 584. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Zootechnical performance of control (CTRL) and treatment groups (TRT) measured over 42 days of experimental trial including the animal’s body weight over time (a), and the average daily feed intake averaged for each week of trial over time (b). Data are expressed as means ± standard deviation (SD). Abbreviations: BW = body weight; ADFI = average daily feed intake.
Figure 1. Zootechnical performance of control (CTRL) and treatment groups (TRT) measured over 42 days of experimental trial including the animal’s body weight over time (a), and the average daily feed intake averaged for each week of trial over time (b). Data are expressed as means ± standard deviation (SD). Abbreviations: BW = body weight; ADFI = average daily feed intake.
Vetsci 10 00618 g001
Figure 2. Oxidant serum status for control (CTRL) and treatment (TRT) groups at day 42 of the trial, including OXY-adsorbent test on serum samples (µmol HClO/mL) (a) and d-ROMs test (UCARR) (b). Data are expressed as means ± standard deviation (SD).
Figure 2. Oxidant serum status for control (CTRL) and treatment (TRT) groups at day 42 of the trial, including OXY-adsorbent test on serum samples (µmol HClO/mL) (a) and d-ROMs test (UCARR) (b). Data are expressed as means ± standard deviation (SD).
Vetsci 10 00618 g002
Figure 3. Average weekly fecal score in treatment (TRT) and control (CRTL) groups during 42 days of the experimental trial. T0–T1 = days 0–7, T1–T2 = days 7–14, T2–T3 = days 14–21, T3–T4 = days 21–28, T4–T5 = days 28–35, T5-T6 = days 35–42. * Asterisk indicates statistically significant differences between groups (p < 0.05). Data are presented as mean ± standard deviation.
Figure 3. Average weekly fecal score in treatment (TRT) and control (CRTL) groups during 42 days of the experimental trial. T0–T1 = days 0–7, T1–T2 = days 7–14, T2–T3 = days 14–21, T3–T4 = days 21–28, T4–T5 = days 28–35, T5-T6 = days 35–42. * Asterisk indicates statistically significant differences between groups (p < 0.05). Data are presented as mean ± standard deviation.
Vetsci 10 00618 g003
Figure 4. Daily distribution of fecal score in treatment and control groups, from day 0 to day 42. Darker colors indicate greater fecal consistency = minor cases of diarrhea; lighter colors indicate minor fecal consistency = greater prevalence of diarrhea.
Figure 4. Daily distribution of fecal score in treatment and control groups, from day 0 to day 42. Darker colors indicate greater fecal consistency = minor cases of diarrhea; lighter colors indicate minor fecal consistency = greater prevalence of diarrhea.
Vetsci 10 00618 g004
Figure 5. Total diarrhea cases recorded during the 42-day trial for the control (CTRL) and treatment groups (TRT). Data are expressed as the sum of recorded cases of diarrhea measured daily, considering: (a) Cases of moderate diarrhea, fecal score (FS) = 2; (b) Cases of severe diarrhea, fecal score (FS) = 3. ** Asterisks indicate statistically significant differences between groups (p = 0.0024). ** p-value < 0.05 for fecal score 2 (moderate diarrhea) and no differences for fecal score 3 (severe diarrhea).
Figure 5. Total diarrhea cases recorded during the 42-day trial for the control (CTRL) and treatment groups (TRT). Data are expressed as the sum of recorded cases of diarrhea measured daily, considering: (a) Cases of moderate diarrhea, fecal score (FS) = 2; (b) Cases of severe diarrhea, fecal score (FS) = 3. ** Asterisks indicate statistically significant differences between groups (p = 0.0024). ** p-value < 0.05 for fecal score 2 (moderate diarrhea) and no differences for fecal score 3 (severe diarrhea).
Vetsci 10 00618 g005
Figure 6. Bacteria count, total bacteria, lactic acid, and coliform bacteria at T0 = day 0, T2 = day 14, T4 = day 28, and T6 = day 42. CRTL: control group, TRT: treatment group. (a) total bacteria count, (b) lactic acid bacteria count, and (c) coliform bacteria count.
Figure 6. Bacteria count, total bacteria, lactic acid, and coliform bacteria at T0 = day 0, T2 = day 14, T4 = day 28, and T6 = day 42. CRTL: control group, TRT: treatment group. (a) total bacteria count, (b) lactic acid bacteria count, and (c) coliform bacteria count.
Vetsci 10 00618 g006
Figure 7. Target DNA of principal microbial indicators of gut microbiota in control and treatment groups at day 0 (T0) and day 42 (T6). (a) Bifidobacterium spp., (b) E. coli, (c) Lactobacillus spp.
Figure 7. Target DNA of principal microbial indicators of gut microbiota in control and treatment groups at day 0 (T0) and day 42 (T6). (a) Bifidobacterium spp., (b) E. coli, (c) Lactobacillus spp.
Vetsci 10 00618 g007
Table 1. Nutritional composition of milk replacer (data provided by the producer: Gruppo Veronesi S.p.a., Italy).
Table 1. Nutritional composition of milk replacer (data provided by the producer: Gruppo Veronesi S.p.a., Italy).
AnalyteComposition (% as Fed)
Crude protein23.00
Ether extract18.00
Crude fiber0.10
Ash7.50
Lys2.10
Ca1.00
P0.70
Na0.50
Additives per kg: vitamins, pro-vitamins, and substances with similar effects: vitamin A 20,000 IU; vitamin D3 4000 IU; vitamin E 100 mg; vitamin C 150 mg; vitamin B1 6 mg; vitamin B2 12 mg; vitamin B6 6 mg; vitamin B12 80 mg; niacin 30 mg; calcium D-pantothenate 25 mg; vitamin K3 4 mg; betaine hydrochloride 250 mg; trace elements: iron 75 mg; copper 6 mg; zinc 85 mg; iodine 1 mg; manganese 30 mg; selenium 0.3 mg.
Table 2. Sequence of nucleotide used for the bacteria strain detection by PCR.
Table 2. Sequence of nucleotide used for the bacteria strain detection by PCR.
TargetForward/ReverseNucleotide SequenceAmplicon (bp)Reference
Lactobacillus spp.Fw5′–CTTGTACACACCGCCCGTCA–3′250 [29]
Rv5′–CTCAAAACTAAACAAAGTTTC–3′
Bifidobacterium spp.Fw5′–CTCCTGGAAACGGGTGG–3′549–563 [30]
Rv5′–GGTGTTCTTCCCGATATCTACA–3′
E. coliFw5′–ATGCTTAGTGCTGGTTTAGGG–3′248 [31]
Rv5′–GCCTTCATCATTTCGCTTTC–3′
Total bacteriaFw5′–CGGCAACGAGCGCAACCC–3′130[32]
Rv5′–CCATTGTAGCACGTGTGTAGCC–3′
Table 3. Metabolic profile of serum samples in treatment (TRT) and control (CRTL) groups after 42 days of the trial.
Table 3. Metabolic profile of serum samples in treatment (TRT) and control (CRTL) groups after 42 days of the trial.
AnalyteLSMeansSEp-Value
CTRLTRT
Albumin (g/L)41.96 *48.43 *1.3740.014 *
Albumin/globulin (A/G)1.221.250.0900.869
Beta-hydroxyb-utyrate (mmol/L)0.070.090.0100.165
Calcium (mmol/L)3.75 *4.48 *0.1610.018 *
Gamma-glutamyl transferase (IU/L)39.4245.755.2120.414
Globulin (g/L)35.6239.733.0790.436
Glucose (mmol/L)8.369.660.4910.118
Magnesium (mmol/L)1.171.260.0520.296
Non-esterified fatty acid (mmol/L)0.670.660.0730.207
Phosphorus (mmol/L)4.01 *4.84 *0.1700.012 *
Total bilirubin (µmol/L)5.566.444.7700.267
Total cholesterol (mmol/L)4.47 *6.61 *0.3920.006 *
Total protein (g/L)77.5188.274.0190.133
Triglycerides (mmol/L)0.810.980.1000.260
Urea (mmol/L)2.722.780.2330.842
* Asterisk indicates statistically significant differences (p-value < 0.05).
Table 4. Serum concentration of diamine oxidase (DAO) and trefoil factor 3 (TFF-3) in control (CTRL) and treatment (TRT) groups at 0 and 42 days of the trial.
Table 4. Serum concentration of diamine oxidase (DAO) and trefoil factor 3 (TFF-3) in control (CTRL) and treatment (TRT) groups at 0 and 42 days of the trial.
Mean ± SDCTRL T6TRT T6
DAO21.11 ± 1.97218.56 ± 3.504
TFF-31.61 ± 0.5231.70 ± 0.202
Results are presented as mean and standard deviation. T6 = day 42. p > 0.05.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Scaglia, E.; Reggi, S.; Canala, B.; Frazzini, S.; Dell’Anno, M.; Hejna, M.; Rossi, L. The Effects of Milk Replacer Supplemented with Ascophyllum nodosum as a Novel Ingredient to Prevent Neonatal Diarrhea in Dairy Calves and Improve Their Health Status. Vet. Sci. 2023, 10, 618. https://doi.org/10.3390/vetsci10100618

AMA Style

Scaglia E, Reggi S, Canala B, Frazzini S, Dell’Anno M, Hejna M, Rossi L. The Effects of Milk Replacer Supplemented with Ascophyllum nodosum as a Novel Ingredient to Prevent Neonatal Diarrhea in Dairy Calves and Improve Their Health Status. Veterinary Sciences. 2023; 10(10):618. https://doi.org/10.3390/vetsci10100618

Chicago/Turabian Style

Scaglia, Elena, Serena Reggi, Benedetta Canala, Sara Frazzini, Matteo Dell’Anno, Monika Hejna, and Luciana Rossi. 2023. "The Effects of Milk Replacer Supplemented with Ascophyllum nodosum as a Novel Ingredient to Prevent Neonatal Diarrhea in Dairy Calves and Improve Their Health Status" Veterinary Sciences 10, no. 10: 618. https://doi.org/10.3390/vetsci10100618

APA Style

Scaglia, E., Reggi, S., Canala, B., Frazzini, S., Dell’Anno, M., Hejna, M., & Rossi, L. (2023). The Effects of Milk Replacer Supplemented with Ascophyllum nodosum as a Novel Ingredient to Prevent Neonatal Diarrhea in Dairy Calves and Improve Their Health Status. Veterinary Sciences, 10(10), 618. https://doi.org/10.3390/vetsci10100618

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop