Next Article in Journal
Pet Owners’ Attitudes and Opinions towards Cat and Dog Care Practices in Aotearoa New Zealand
Next Article in Special Issue
Theileria orientalis Ikeda in Cattle, Alabama, USA
Previous Article in Journal
Nutritional Strategies to Promote Bovine Oocyte Quality for In Vitro Embryo Production: Do They Really Work?
Previous Article in Special Issue
Advances in Non-Chemical Tools to Control Poultry Hematophagous Mites
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Detection of Rickettsia hoogstraalii in Hyalomma anatolicum and Haemaphysalis sulcata: Updated Knowledge on the Epidemiology of Tick-Borne Rickettsia hoogstraalii

1
Department of Zoology, Abdul Wali Khan University Mardan, Mardan 23200, Pakistan
2
Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, Riyadh 11451, Saudi Arabia
3
King Abdulaziz City for Science and Technology, Riyadh 12354, Saudi Arabia
4
Department of Biosciences, COMSATS University Islamabad (CUI), Park Road, Chak Shahzad, Islamabad 45550, Pakistan
5
Laboratory of Infectious Diseases, Joint Faculty of Veterinary Medicine, Kagoshima University, Kagoshima 890-0065, Japan
6
Centro de Biotecnologia and Faculdade de Veterinária, Universidade Federal do Rio Grande do Sul, Porto Alegre 90050-170, RS, Brazil
7
Department of Emergency Medicine, Ditmanson Medical Foundation Chia-Yi Christian Hospital, Chiayi 60002, Taiwan
8
Department of Pathology, Ditmanson Medical Foundation Chia-Yi Christian Hospital, Chiayi 60002, Taiwan
9
Department of Cosmetic Science, Chia Nan University of Pharmacy and Science, Tainan 71710, Taiwan
10
Ph.D. Program in Translational Medicine, Rong Hsing Research Center for Translational Medicine, National Chung Hsing University, Taichung 40227, Taiwan
11
Department of Biotechnology and Bioindustry Sciences, College of Bioscience and Biotechnology, National Cheng Kung University, Tainan 70101, Taiwan
*
Authors to whom correspondence should be addressed.
Vet. Sci. 2023, 10(10), 605; https://doi.org/10.3390/vetsci10100605
Submission received: 1 September 2023 / Revised: 23 September 2023 / Accepted: 1 October 2023 / Published: 4 October 2023
(This article belongs to the Special Issue Control Strategies of Ticks and Tick-Borne Pathogens)

Simple Summary

Ticks are hematophagous ectoparasites that spread diseases to both animals and humans through their bites. They are notorious for carrying various disease-causing agents, such as viruses, protozoa, and bacteria, which present substantial risks to both human and animal well-being. Continuous changes in the climate can impact both tick distribution and abundance. Understanding of the epidemiology of tick-borne Rickettsia hoogstraalii is limited, with gaps in its molecular detection, genetic characterization, and absence of data, especially from Pakistan. This study aimed to use molecular methods to genetically analyze Rickettsia species, particularly R. hoogstraalii, in Pakistan while also contributing new insights into the pathogen′s global epidemiology. For this purpose, ticks were collected from different hosts, including goats, sheep, and cattle, from six districts of Khyber-Pakhtunkhwa, Pakistan. This study is the first to genetically characterize R. hoogstraalii in Hyalomma anatolicum ticks globally and Haemaphysalis sulcata in Pakistan. This species was first described in 2006 in Croatia and has also been detected in different species of ticks in different countries. The pathogenicity of R. hoogstraalii in vertebrate hosts is not well understood. Encouraging additional research is essential to unveil the involvement of ticks in the transmission and persistence of R. hoogstraalii across various host species.

Abstract

Ticks are hematophagous ectoparasites that transmit pathogens to animals and humans. Updated knowledge regarding the global epidemiology of tick-borne Rickettsia hoogstraalii is dispersed, and its molecular detection and genetic characterization are missing in Pakistan. The current study objectives were to molecularly detect and genetically characterize Rickettsia species, especially R. hoogstraalii, in hard ticks infesting livestock in Pakistan, and to provide updated knowledge regarding their global epidemiology. Ticks were collected from livestock, including goats, sheep, and cattle, in six districts of Khyber Pakhtunkhwa (KP) Pakistan. Overall, 183 hosts were examined, of which 134 (73.2%), including goats (number = 39/54, 72.2%), sheep (23/40, 57.5%), and cattle (71/89, 80%) were infested by 823 ticks. The most prevalent tick species was Rhipicephalus microplus (number = 283, 34.3%), followed by Hyalomma anatolicum (223, 27.0%), Rhipicephalus turanicus (122, 14.8%), Haemaphysalis sulcata (104, 12.6%), Haemaphysalis montgomeryi (66, 8.0%), and Haemaphysalis bispinosa (25, 3.03%). A subset of 210 ticks was selected and screened for Rickettsia spp. using PCR-based amplification and subsequent sequencing of rickettsial gltA and ompB fragments. The overall occurrence rate of R. hoogstraalii was 4.3% (number = 9/210). The DNA of Rickettsia was detected in Hy. anatolicum (3/35, 8.5%) and Ha. sulcata (6/49, 12.2%). However, no rickettsial DNA was detected in Rh. microplus (35), Rh. turanicus (35), Ha. montgomeryi (42), and Ha. bispinosa (14). The gltA and ompB fragments showed 99–100% identity with R. hoogstraalii and clustered phylogenetically with the corresponding species from Pakistan, Italy, Georgia, and China. R. hoogstraalii was genetically characterized for the first time in Pakistan and Hy. anatolicum globally. Further studies should be encouraged to determine the role of ticks in the maintenance and transmission of R. hoogstraalii in different hosts.

1. Introduction

Ticks are obligate blood-sucking ectoparasites distributed all over the world, especially in tropical and subtropical areas [1,2,3]. The most important hard ticks that transmit pathogens and affect domestic and wild animals belong to different genera such as Rhipicephalus, Hyalomma, Haemaphysalis, Ambylomma, and Ixodes [4]. These hematophagous ectoparasites play a significant role in transmitting pathogens, encompassing bacteria, protozoans, and viruses that lead to zoonotic outcomes threatening human and animal health [5,6]
Rickettsia species are obligatory intracellular Gram-negative bacteria that are divided into major groups: the spotted fever group (SFG), the typhus group, the bellii group, and the limioniae group [7,8]. Among these, tick-borne SFG Rickettsia spp. include a large number of zoonotic agents and are considered important pathogens causing SFG [5,9,10]. Rickettsia spp. of the SFG are mostly transmitted by hard ticks (Ixodidae) to vertebrate hosts [5]. In addition, the human pathogenicity of several rickettsial species has been described, and rickettsial species with undetermined pathogenicity have been observed in ticks [5,11,12].
Rickettsia hoogstraalii is a member of the SFG with unknown pathogenicity and is closely related to Rickettsia felis, an emerging pathogen known to be spread through arthropods, especially ticks and fleas [13,14,15,16]. Rickettsia hoogstraalii was first reported in 2006 in Ha. sulcata ticks in Croatia [17] and later on was detected in various tick species of the genera Heamaphysalis, Rhipicephalus, Argas, Dermacentor, Carios, Ixodes, and Africaniella in Croatia, Pakistan, Georgia, Spain, Cyprus, India, Ethiopia Turkey, Italy, Greece, Iran, USA, Namibia, Zambia, Romania, China, Africa, and Anatolia [15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42]. Notably, it has been detected in Ha. montgomery, infesting goat and sheep from Pakistan [15].
Pakistan is an agricultural country, and livestock is an important part of its economy, as different animals are important sources of income [Pakistan Economic Survey 2022–2023] [43]. Ticks of different genera, such as Hyalomma, Heamaphysalis, Rhiphcephalus, Amblyomma, Ixodes, Ornithodoros, Argas, Carios, and Nosomma, have been reported infesting livestock and wild animals in Pakistan [8,44,45,46,47,48,49,50,51]. These ticks are capable of transmitting pathogens, including Rickettsia spp., Theileria spp., Babesia spp., and Anaplasma spp. [44,45,46]. In Pakistan, studies have reported that tick-borne pathogens infect domestic and wild animals [8,44,45,49,51,52,53,54]. There is no available information regarding the genetic characterization of tick-borne R. hoogstraalii in Pakistan, and knowledge of its global epidemiology is limited. To address this gap, this study aimed to detect Rickettsia species, especially R. hoogstraalii, in ticks infecting livestock hosts in Pakistan and to update and summarize dispersed information on its global epidemiology.

2. Materials and Methods

2.1. Study Area

Present study was conducted in six districts of Khyber Pakhtunkhwa: Buner (34°33′43.6″ N 72°24′37.1″ E), Lakki Marwat (32°36′53.5″ N 70°54′37.6″ E), Bannu (32°59′14.3″ N 70°39′33.0″ E), Karak (33°11′53.7″ N 71°07′57.2″ E), Bajaur (34°42′09.5″ N 71°37′58.6″ E), and Dir-Upper (35°11′52.7″ N 71°52′46.1″ E). Geographic coordinate data were collected using a global positioning system (GPS) and stored in Microsoft Excel v. 2016 (Microsoft Corp., Redmond, WA, USA) for processing. The study area map (Figure 1) was drawn in ArcGIS v. 10.3.1 (ESRI, Redlands, CA, USA).

2.2. Ticks Collection and Identification

Ticks were collected between June 2021 and August 2022 from asymptomatic livestock hosts (cattle, goats, and sheep) at different sites. Ticks were collected from the bodies of the hosts, regardless of their particular location within the planned survey zones or times, whenever they were found in different farms, open fields, or free-roaming animals in pastures. With the use of forceps, 1–10 ticks per animal were collected from each host while examining their entire body. The collected specimens were washed with distilled water followed by 70% ethanol to remove contaminants and stored in Eppendorf tubes with 99.98% ethanol. Morphological identification was performed using a StereoZoom microscope (HT StereoZoom), following taxonomic keys [55,56] and stored in 2 mL microtubes for further molecular analysis.

2.3. DNA Extraction and PCR

Location- and gender-wise, a total of 210 (79 females, 24 males, 107 nymphs) ticks were randomly selected as representatives of the collected ticks for DNA extraction and PCR, comprising 49 specimens (19 F, 4 M, 26 N) from Bajaur, 42 (17 F, 5 M, 20 N) from Buner, 35 (14 F, 6 M, 15 N) from Dir-Upper, 28 (9 F, 2 M, 17 N) from Bannu, 18 (10 F, 3 M, 5 N) from Lakki-Marwat, and 28 (10 F, 4 M, 14 N) from Karak districts. Tick specimens were rinsed with PBS and distilled water followed by 70% ethanol. The washed specimens were kept in an incubator for 20–30 min at 37 °C. Each specimen was cut separately using a sterile blade, and DNA was extracted using the phenol-chloroform method [57]. DNA was quantified using a Nanodrop spectrophotometer (Nano-Q, Optizen, Daejeon, South Korea). The extracted DNA was tested for the presence of Rickettsia spp. using PCR targeting gltA, ompA, and ompB fragments. The PCR reaction mixture was carried out in a total volume of 25 µL, consisting of 1 µL of each (forward and reverse) primer (10 µM) (Table 1), 2 µL genomic DNA template (100 ng/µL), 12.5 µL Master mix (2×) (Thermo Fisher Scientific, Inc., Waltham, MA, USA), and 8.5 µL PCR water. Rickettsia massilliae DNA was utilized as a positive control while “nuclease free” water was used as a negative control. The amplified PCR products were electrophoresed on a 2% gel, stained with ethidium bromide, and visualized using GelDoc (BioDoc-It™ Imaging Systems; Upland, CA, USA). The DNA purification Kit (Invitrogen™JetFlex™, Invitrogen, Waltham, MA, USA) was used to purify amplicons prior to the sequencing process in both directions by MACROGEN (Seoul, Republic of Korea).

2.4. Sequencing and Phylogenetic Analysis

The obtained sequences were trimmed using Seqman 5.0 (DNASTAR, Inc., Madison, WI, USA) to remove poor sequencing reads and primer contaminations. All the obtained sequences were identical; hence, a single consensus sequence was obtained. The consensus sequences were submitted to the Basic Local Alignment Search Tool (BLASTn; National Center for Biotechnology Information [NCBI)]). Higher-identity sequences were aligned using BioEdit alignment editor v. 7.0.5 [61] and were subjected to ClustalW Multiple alignment [62]. The individual phylogenetic trees of gltA and ompB were constructed in accordance with the maximum likelihood method in Molecular Evolutionary Genetics Analysis (MEGA-XI) software [63], using the MUSCLE algorithm [64]. A similar outcome was observed for all the available methods. However, due to its ability to evaluate different phylogenetic trees and models under a statistical framework, the maximum likelihood method is recommended as the actual method for the best evolutionary analysis [65]. Statistical analysis of the nodes was performed using bootstrap resampling analysis, which involved 1000 replicates. This approach provided a rigorous assessment of the reliability of the tree branching patterns and relationships [63]. The acquired fragments of gltA and ompB were used to determine their final positions in the dataset.

2.5. Literature Search

A literature search was carried out using databases (Google Scholar, Web of Science, PubMed and ScienceDirect) to collect published studies on the detection of R. hoogstraalii in various ticks, animals, humans, or soils. The search keywords used included but were not limited to ticks, tick-borne diseases, domestic animals, small ruminants, livestock, sheep, goat, zoonosis, and R. hoogstraalii. A varied keyword approach was employed to gather full-text research articles, reviews, short communications, and conference papers from different sources. In order to identify relevant articles, the reference lists of the retrieved articles were also examined (Table 2).

3. Results

3.1. Ticks and Host Description

Among 183 examined livestock hosts in Buner district (12 goats, 10 sheep, and 14 cattle), Bajaur (10 goats, 8 sheep and 15 cattle), Lakki Marwat (12 sheep and 14 cattle), Bannu (8 goats and 15 cattles), Dir-Upper (8 goats, 10 sheep and 10 cattle), and Karak (16 goats and 21 cattle), 134 were tick-infested (Table 3). Nymphs were most prevalent (353, 42.8%), while the least prevalence was observed for females (297, 36%) and males (173, 21%) (Table 3). A total of 823 ticks from different life stages were collected and morphologically classified into three genera and five species as follows: Rhipicephalus spp. (405 specimens, 49.2% of all ticks), Hyalomma spp. (223 specimens, 27% of all ticks), and Haemaphysalis spp. (195 specimens, 23% of all ticks). The most abundant species was Rh. (Boophilus) microplus (283 specimens, 34.3% of all ticks), followed by Hy. anatolicum (223 specimens, 27% of all ticks), Rh. turanicus (122 specimens, 14.8% of all ticks), Ha. sulcata (104 specimens, 12.6% of all ticks), Ha. montgomeryi (66 specimens, 8%), and Ha. bispinosa (25 specimens, 3.03% of all ticks). The overall prevalence of tick infestation among livestock hosts was 73.2%, with the heaviest tick burden recorded in domestic animals of district Bajaur (158, 19.9%), followed by Buner (146, 17.7%), Karak (144, 17.4%), Lakki Marwat (133, 16.1%), Bannu (126, 15.3), and Dir-Upper (116, 14%). Among domestic animals, cattle were infested the most with 506 ticks, including Rh. microplus (283) and Hy. anatolicum (223), followed by goats, infested with 202 ticks, including Rh. turanicus (122), Ha. sulcata (49) and Ha. montgomeryi (31). Sheep were the least infested with 115 ticks, including Ha. sulcata (55), Ha. montgomeryi (35), and Ha. bispinosa (25).

3.2. Detection of Rickettsial DNA in Ticks

Ticks positive for rickettsial gltA were also positive for the ompB fragment, whereas ompA-based PCR amplification was unsuccessful in all PCR reactions. The overall occurrence of Rickettsia spp. was 4.3% (9/210) based on gltA and ompB partial fragments. The occurrence of Rickettsia spp. was highest in Ha. sulcata (6/49, 12.2%) followed by Hy. anatolicum (3/35, 8.5%). However, no rickettsial DNA was detected in Rh. microplus (35), Rh. turanicus (35), Ha. montgomeryi (42), and Ha. bispinosa (14). Location-wise, the occurrence of Rickettsia-positive ticks was highest in district Bannu (2/28, 7.1%), followed by Bajaur (3/49, 6.1%), Lakki Marwat (1/18, 5.5%), Buner (2/42, 4.7%), and Dir-Upper (1/35, 2.8%) (Table 3).

3.3. Sequences and Phylogenetic Analysis

After a BLAST search of the NCBI database, the gltA sequence revealed 100% identity and 100% query identity with R. hoogstraalii reported in Italy and Pakistan. On the other hand, the ompB (773 bp) sequence of R. hoogstraalii revealed 99.2–99.7% high identity and 100% query to the reported sequences from China and the USA. In the phylogenetic tree of gltA, the obtained sequences clustered with those of R. hoogstraalii from Italy (KY418024 and KY418025) and Pakistan (OQ160792) (Figure 2). In the phylogenetic tree of ompB, the obtained sequence clustered with R. hoogstraalii from Georgia (EF629536 and MH717095) and China (MZ367030) (Figure 3).

4. Discussion

Ticks cause economic losses to the livestock industry and transmit various pathogens, including SFG Rickettsia spp., to humans and wild and domestic animals. There is a huge variety of Rickettsia spp., of which few have been proven to be zoonotic [5]. Rickettsia hoogstraalii is a member of the SFG Rickettsia, but there are no available reports on its pathogenicity in vertebrates [33]. The diagnosis of Rickettsia in ticks, not only for the identification of infected ticks but also for the assessment of exposure risk to humans, is important [66,67]. Previously, various studies have documented the occurrence of diverse Rickettsia spp. in various ticks infesting different hosts in Pakistan, but there is a lack of information regarding the occurrence and genetic characterization of R. hoogstraalii. To fill this gap, we detected and genetically characterized R. hoogstraalii in hard ticks infesting livestock. The collected ticks were taxonomically identified as Rh. microplus, Rh. turanicus, Hy. anatolicum, Ha. bispinosa, and Ha. sulcata and screened for the detection of rickettsial DNA. Among these, R. hoogstraalii was identified in Hy. anatolicum and Ha. sulcata based on gltA and ompB sequences for the first time in Pakistan.
Tick species such as Rh. microplus, Rh. turanicus, Rh. sanguienus, Rh. haemaphysaloides, Hy. anatolicum, Hy. dromedarii, Ha. sulcata, Ha. bispinosa, Ha. kashmirensis, Ha. cornupunctata, and Ha. montgomeryi have been found to infect different livestock hosts (especially cattle, goats, and sheep) in different regions of Pakistan [2,8,15,44,48,49,50]. Rhipicephalus microplus and Hy. anatolicum, which are the most prevalent in the area, were found most frequently [2,8]. The environmental conditions in the different survey districts varied from one another. The annual mean temperature of study areas such as Lakki Marwat, Bannu, Bajaur, Upper-Dir, Karak, and Buner were 30–42 °C and 4–17 °C, recorded in the summer and winter, respectively, (worldweatheronline.com: accessed on 1 March 2023). High summer temperatures in the target area were correlated with increased tick infestation compared to winter; therefore, high tick infestation was noted during summer. Moreover, several tick species have been found to exhibit low incidences of infestation as a result of lower temperatures in certain districts. These results are consistent with previous regional reports [2,68,69].
Hyalomma anatolicum and Ha. sulcata infesting cattle, goats, and sheep were found positive for R. hoogstraalii. Previously, R. hoogstraalii has been detected in various tick genera, including Haemaphysalis, Rhipicephalus, Argas, Dermacentor, Carios, Ixodes, and Africaniella, infesting goats, sheep, cattle, cows, mouflons, lizards, bat, dog, and birds in different countries [15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42]. Recently, R. hoogstraalii was reported to contain a short fragment of gltA in Ha. montgomeryi infesting goats and sheep in Pakistan [15]. Rickettsia hoogstraalii has been detected in all life stages of different ticks, such as adult females, males, larvae, and nymphs [15,28,33,34]. So far, information about the detection of R. hoogstraalii in Hy. anatolicum and Ha. sulcata ticks infesting livestock hosts such as cattle, goats, and sheep were unavailable. Herein, R. hoogstraalii was detected for the first time in Hy. anatolicum globally and in Ha. sulcata in Pakistan. This study presents the first molecular evidence of R. hoogstraalii in nymphs and adult female ticks of Hy. anatolicum and Ha. sulcata. It also suggests that these ticks may play a possible role in the spread of R. hoogstraalii. R. hoogstraalii DNA was detected both in nymph and adult female ticks. Consequently, there are chances that this Rickettsia was ingested from the blood of the infected hosts. Rickettsia spp.-infected ticks may pose unknown health risks to livestock owners, indicating that other tick species in the area might be potential vectors of these infectious agents [5].
Genetic markers such as gltA, ompA, and ompB have been used to distinguish several Rickettsia spp. at the species level [58,60,70]. Thus, the characterization of R. hoogstraalii has been validated through the use of these standard markers [15,16,20]. We molecularly detected R. hoogstraalii based on the gltA and ompB sequences. Using these genetic markers, the obtained sequences were closely related to R. hoogstraalii in the Palearctic and Neotropic regions. Additionally, sequence analysis of gltA and ompB showed that R. hoogstraalii is closely related to R. felis, making it a distinct species in the spotted fever group [48]. PCR-based detection of this species was also attempted based on the ompA fragment; however, the amplification was unsuccessful, as reported previously [28]. Amplification failure is common for ompA, which may be the absence of targeted genes, as demonstrated by the rickettsial transition group, or due to primer mismatch [35,71]. There is no available information regarding the pathogenicity of R. hoogstraalii in vertebrate hosts including humans [33], and its zoonotic outcomes are yet to be determined in Pakistan. Further studies are required to elucidate the pathogenicity of R. hoogstraalii in mammals.

5. Conclusions

This study provides preliminary information regarding the occurrence of R. hoogstraalii in Hyalomma and Haemaphysalis ticks including Hy. anatolicum and Ha. sulcata. To our knowledge, tick-borne R. hoogstraalii was detected and genetically characterized for the first time in globally in Hy. anatolicum and for the first time in Pakistan in Ha. sulcata. These findings indicate that ticks that infest goats, sheep, and cattle ultimately pose unknown health risks to livestock holders who mostly share living habitats. These findings enhance our understanding of the occurrence of R. hoogstraalii in ticks parasitizing livestock in Pakistan. To prevent zoonotic outcomes, it is important to examine the vector potential of different ticks for other rickettsial pathogens.

Author Contributions

A.A. (Abid Ali), M.M.A., A.A. (Abdulaziz Alouffi), S.-C.C. and C.-C.C. designed the study, provided supervision, and conducted project administration. A.A. (Abid Ali), H.A. and A.A. (Aneela Aneela) collected the tick samples. A.A. (Abid Ali), A.A. (Aneela Aneela) M.M.A., S.-C.C., C.-C.C. A.A. (Abdulaziz Alouffi), H.A., I.d.S.V.J. and T.T. wrote the initial draft. All authors have read and agreed to the published version of the manuscript.

Funding

The researchers support project number (RSP2023R494), King Saud University, Riyadh, Saudi Arabia.

Institutional Review Board Statement

The research study was approved by the Advanced Studies Research Board (ASRB) committee members of Abdul Wali Khan University Mardan, Khyber Pakhtunkhwa, Pakistan (Dir/A&R/AWKUM/2023/0014).

Informed Consent Statement

Ethical consent was obtained from the Advanced Studies Research Board members (Dir/A&R/AWKUM/2023/0014) at the Department of Zoloogy, Abdul Wali Khan University Mardan. The owner of animals provided oral/written consent.

Data Availability Statement

The data set of the current study can be found in the online repository under the accession numbers present in the article.

Acknowledgments

This study was carried out under the financial support by the Higher Education Commission of Pakistan and Pakistan Science Foundation.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Dantas-Torres, F.; Chomel, B.B.; Otranto, D. Ticks and tick-borne diseases: A One Health perspective. Trends Parasitol. 2012, 28, 437–446. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Ali, A.; Zahid, H.; Zeb, I.; Tufail, M.; Khan, S.; Haroon, M.; Bilal, M.; Hussain, M.; Alouffi, A.S.; Muñoz-Leal, S.; et al. Risk factors associated with tick infestations on equids in Khyber Pakhtunkhwa, Pakistan, with notes on Rickettsia massiliae detection. Parasit. Vectors 2021, 14, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Guglielmone, A.A.; Nava, S.; Robbins, R.G. Geographic distribution of the hard ticks (Acari: Ixodida: Ixodidae) of the world by countries and territories. Zootaxa 2023, 52, 274–511. [Google Scholar] [CrossRef] [Scilit]
  4. Shih, C.M.; Yang, P.W.; Chao, L.L. Molecular Detection and genetic identification of Rickettsia infection in Ixodes granulatus ticks, an incriminated vector for geographical transmission in Taiwan. Microorganisms 2021, 9, 1309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Parola, P.; Paddock, C.D.; Socolovschi, C.; Labruna, M.B.; Mediannikov, O.; Kernif, T.; Abdad, M.Y.; Stenos, J.; Bitam, I.; Fournier, P.E.; et al. Update on tick-borne rickettsioses around the world: A geographic approach. Clin. Microbiol. Rev. 2013, 26, 657–702. [Google Scholar] [CrossRef] [Scilit]
  6. Boulanger, N.; Boyer, P.; Talagrand-Reboul, E.; Hansmann, Y. Medecine et maladies infectieuses. Ticks. Tick. Borne. Dis. 2019, 49, 87–97. [Google Scholar]
  7. Yan, P.; Qiu, Z.; Zhang, T.; Li, Y.; Wang, W.; Li, M.; Yu, Z.; Liu, J. Microbial diversity in the tick Argas japonicus (Acari: Argasidae) with a focus on Rickettsia pathogens. Med. Vet. Entomol. 2019, 33, 327–335. [Google Scholar] [CrossRef] [Scilit]
  8. Ali, A.; Numan, M.; Khan, M.; Aiman, O.; Muñoz-Leal, S.; Chitimia-Dobler, L.; Labruna, M.B.; Nijhof, A.M. Ornithodoros (Pavlovskyella) ticks associated with a Rickettsia sp. in Pakistan. Parasit. Vectors 2022, 15, 138. [Google Scholar] [CrossRef] [Scilit]
  9. Jay, R.; Armstrong, P.A. Clinical characteristics of Rocky Mountain spotted fever in the United States: A literature review. Vector Borne Zoonotic Dis. 2020, 57, 114. [Google Scholar] [CrossRef] [Scilit]
  10. Moonga, L.C.; Hayashida, K.; Mulunda, N.R.; Nakamura, Y.; Chipeta, J.; Moonga, H.B.; Namangala, B.; Sugimoto, C.; Mtonga, Z.; Mutengo, M.; et al. Molecular detection and characterization of Rickettsia asembonensis in human blood, Zambia. Emerg. Infect. Dis. 2021, 27, 2237. [Google Scholar] [CrossRef] [Scilit]
  11. Raoult, D.; Fournier, P.E.; Abboud, P.; Caron, F. First documented human Rickettsia aeschlimannii infection. Emerg. Infect. Dis. 2002, 8, 748. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Germanakis, A.; Chochlakis, D.; Angelakis, E.; Tselentis, Y.; Psaroulaki, A. Rickettsia aeschlimannii infection in a man, Greece. Emerg. Infect. Dis. 2013, 19, 1176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Dieme, C.; Bechah, Y.; Socolovschi, C.; Audoly, G.; Berenger, J.M.; Faye, O.; Raoult, D.; Parola, P. Transmission potential of Rickettsia felis infection by Anopheles gambiae mosquitoes. Proc. Natl. Acad. Sci. USA 2015, 112, 8088–8093. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Moonga, L.C.; Hayashida, K.; Nakao, R.; Lisulo, M.; Kaneko, C.; Nakamura, I.; Eshita, Y.; Mweene, A.S.; Namangala, B.; Sugimoto, C.; et al. Molecular detection of Rickettsia felis in dogs, rodents and cat fleas in Zambia. Parasit. Vectors 2019, 12, 168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Khan, S.M.; Khan, M.; Alouffi, A.; Almutairi, M.M.; Numan, M.; Ullah, S.; Obaid, M.K.; Islam, Z.U.; Ahmed, H.; Tanaka, T.; et al. Phylogenetic Position of Haemaphysalis kashmirensis and Haemaphysalis cornupunctata, with Notes on Rickettsia spp. Genes 2023, 14, 360. [Google Scholar] [CrossRef] [Scilit]
  16. Abreu-Yanes, E.; Abreu-Acosta, N.; Foronda, P. Study of tick-borne zoonotic pathogens in questing and feeding ticks in Tenerife, Canary Islands, Spain. J. Vector Ecol. 2023, 48, 59–62. [Google Scholar] [CrossRef] [Scilit]
  17. Duh, D.; Punda-Polić, V.O.L.G.A.; Trilar, T.; Petrovec, M.; Bradarić, N.; Avšič-Županc, T.A. Molecular identification of Rickettsia felis like bacteria in Haemaphysalis sulcata ticks collected from domestic animals in southern Croatia. Ann. N. Y. Acad.Sci. 2006, 1078, 347–351. [Google Scholar] [CrossRef] [Scilit]
  18. Mattila, J.T.; Burkhardt, N.Y.; Hutcheson, H.J.; Munderloh, U.G.; Kurtti, T.J. Isolation of cell lines and a rickettsial endosymbiont from the soft tick Carios capensis (Acari: Argasidae: Ornithodorinae). J. Med. Entomol. 2007, 44, 1091–1101. [Google Scholar] [CrossRef] [Scilit]
  19. Márquez, F.J. Spotted fever group Rickettsia in ticks from southeastern Spain natural parks. Exp. Appl. Acarol. 2008, 45, 185–194. [Google Scholar] [CrossRef] [Scilit]
  20. Portillo, A.; Santibáñez, P.; Santibáñez, S.; Pérez-Martínez, L.; Oteo, J.A. Detection of Rickettsia spp. in Haemaphysalis ticks collected in La Rioja, Spain. Vector Borne Zoonotic Dis. 2008, 8, 653–658. [Google Scholar] [CrossRef] [Scilit]
  21. Dietrich, M.; Lebarbenchon, C.; Jaeger, A.; Le Rouzic, C.; Bastien, M.; Lagadec, E.; McCoy, K.D.; Pascalis, H.; Le Corre, M.; Dellagi, K.; et al. Rickettsia spp. in seabird ticks from western Indian Ocean islands, 2011–2012. Emerg. Infect. Dis. 2014, 20, 838. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Duh, D.; Punda-Polic, V.; Avsic-Zupanc, T.; Bouyer, D.; Walker, D.H.; Popov, V.L.; Jelovsek, M.; Gracner, M.; Trilar, T.; Bradaric, N.; et al. Rickettsia hoogstraalii sp. nov., isolated from hard-and soft-bodied ticks. Int. J. Syst. Evol. Microbiol. 2010, 60, 977–984. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Chochlakis, D.; Ioannou, I.; Sandalakis, V.; Dimitriou, T.; Kassinis, N.; Papadopoulos, B.; Tselentis, Y.; Psaroulaki, A. Spotted fever group Rickettsiae in ticks in Cyprus. Microb. Ecol. 2012, 63, 314–323. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Pader, V.; Buniak, J.N.; Abdissa, A.; Adamu, H.; Tolosa, T.; Gashaw, A.; Cutler, R.R.; Cutler, S.J. Candidatus Rickettsia hoogstraalii in Ethiopian Argas persicus ticks. Ticks. Tick. Borne. Dis. 2012, 3, 338–345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Orkun, Ö.; Karaer, Z.; Çakmak, A.; Nalbantoğlu, S. Spotted fever group rickettsiae in ticks in Turkey. Ticks. Tick. Borne. Dis. 2014, 5, 213–218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Keskin, A.; Bursali, A.; Keskin, A.; Tekin, S. Molecular detection of spotted fever group rickettsiae in ticks removed from humans in Turkey. Ticks. Tick. Borne. Dis. 2016, 7, 951–953. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Chisu, V.; Leulmi, H.; Masala, G.; Piredda, M.; Foxi, C.; Parola, P. Detection of Rickettsia hoogstraalii, Rickettsia helvetica, Rickettsia massiliae, Rickettsia slovaca and Rickettsia aeschlimannii in ticks from Sardinia, Italy. Ticks. Tick. Borne. Dis. 2017, 8, 347–352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Tomassone, L.; Ceballos, L.A.; Ragagli, C.; Martello, E.; De Sousa, R.; Stella, M.C.; Mannelli, A. Importance of common wall lizards in the transmission dynamics of tick-borne pathogens in the northern Apennine Mountains, Italy. Microb. Ecol. 2017, 74, 961–968. [Google Scholar] [CrossRef] [Scilit]
  29. Latrofa, M.S.; Angelou, A.; Giannelli, A.; Annoscia, G.; Ravagnan, S.; Dantas-Torres, F.; Capelli, G.; Halos, L.; Beugnet, F.; Papadopoulos, E.; et al. Ticks and associated pathogens in dogs from Greece. Parasit. Vectors 2017, 10, 301. [Google Scholar] [CrossRef] [Scilit]
  30. Moraga-Fernández, A.; Chaligiannis, Ι.; Cabezas-Cruz, A.; Papa, A.; Sotiraki, S.; de la Fuente, J.; G Fernández de Mera, I. Molecular identification of spotted fever group Rickettsia in ticks collected from dogs and small ruminants in Greece. Exp. Appl. Acarol. 2019, 78, 421–430. [Google Scholar] [CrossRef] [Scilit]
  31. Kooshki, H.; Goudarzi, G.; Faghihi, F.; Telmadarraiy, Z.; Edalat, H.; Hosseini-Chegeni, A. The first record of Rickettsia hoogstraalii (Rickettsiales: Rickettsiaceae) from Argas persicus (Acari: Argasidae) in Iran. Syst. Appl. Acarol. 2020, 25, 1611–1617. [Google Scholar]
  32. Latas, P.; Auckland, L.D.; Teel, P.D.; Hamer, S.A. Argas (Persicargas) giganteus soft tick infection with Rickettsia hoogstraali and relapsing fever Borrelia on wild avian species of the desert southwest, USA. J. Wildl. Dis. 2020, 56, 113–125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Orkun, Ö.; Emir, H. Identification of tick-borne pathogens in ticks collected from wild animals in Turkey. Parasitol. Res. 2020, 119, 3083–3091. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Sukhiashvili, R.; Zhgenti, E.; Khmaladze, E.; Burjanadze, I.; Imnadze, P.; Jiang, J.; John, H.S.; Farris, C.M.; Gallagher, T.; Obiso, R.J.; et al. Identification and distribution of nine tick-borne spotted fever group rickettsiae in the country of Georgia. Ticks. Tick. Borne. Dis. 2020, 11, 101470. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Reeves, W.K.; Mans, B.J.; Durden, L.A.; Miller, M.M.; Gratton, E.M.; Laverty, T.M. Rickettsia hoogstraalii and a Rickettsiella from the Bat Tick Argas transgariepinus, in Namibia. J. Parasitol. 2020, 106, 663–669. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Qiu, Y.; Simuunza, M.; Kajihara, M.; Chambaro, H.; Harima, H.; Eto, Y.; Simulundu, E.; Squarre, D.; Torii, S.; Takada, A.; et al. Screening of tick-borne pathogens in argasid ticks in Zambia: Expansion of the geographic distribution of Rickettsia lusitaniae and Rickettsia hoogstraalii and detection of putative novel Anaplasma species. Ticks Tick-Borne Dis. 2021, 12, 101720. [Google Scholar] [CrossRef] [Scilit]
  37. Pascucci, I.; Antognini, E.; Canonico, C.; Montalbano, M.G.; Necci, A.; di Donato, A.; Moriconi, M.; Morandi, B.; Morganti, G.; Crotti, S.; et al. One Health Approach to Rickettsiosis: A Five-Year Study on Spotted Fever Group Rickettsiae in Ticks Collected from Humans. Microorganisms 2021, 10, 35. [Google Scholar] [CrossRef] [Scilit]
  38. Ivan, T.; Matei, I.A.; Novac, C.Ș.; Kalmár, Z.; Borșan, S.D.; Panait, L.C.; Gherman, C.M.; Ionică, A.M.; Papuc, I.; Mihalca, A.D. Spotted Fever Group Rickettsia spp. diversity in ticks and the first report of Rickettsia hoogstraalii in Romania. Vet. J. 2022, 9, 343. [Google Scholar] [CrossRef] [Scilit]
  39. Pan, Y.S.; Cui, X.M.; Du, L.F.; Xia, L.Y.; Du, C.H.; Bell-Sakyi, L.; Zhang, M.Z.; Zhu, D.Y.; Dong, Y.; Wei, W.; et al. Coinfection of Two Rickettsia Species in a Single Tick Species Provides New Insight into Rickettsia-Rickettsia and Rickettsia-Vector Interactions. Microbiol. Spectr. 2022, 10, e0232322. [Google Scholar] [CrossRef] [Scilit]
  40. Duan, D.Y.; Liu, Y.K.; Liu, L.; Liu, G.H.; Cheng, T.Y. Microbiome analysis of the midguts of different developmental stages of Argas persicus in China. Ticks. Tick. Borne. Dis 2022, 10, 1868. [Google Scholar] [CrossRef] [Scilit]
  41. Hornok, S.; Kontschán, J.; Takács, N.; Chaber, A.L.; Halajian, A.; Szekeres, S.; Sándor, A.D.; Plantard, O. Rickettsiaceae in two reptile-associated tick species, Amblyomma exornatum and Africaniella transversale: First evidence of Occidentia massiliensis in hard ticks (Acari: Ixodidae). Ticks. Tick. Borne. Dis. 2022, 13, 101830. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Orkun, Ö. Comprehensive screening of tick-borne microorganisms indicates that a great variety of pathogens are circulating between hard ticks (Ixodoidea: Ixodidae) and domestic ruminants in natural foci of Anatolia. Ticks. Tick. Borne. Dis. 2022, 13, 102027. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Pakistan Economic Survey 2022–2023. Available online: https://www.finance.gov.pk/survey (accessed on 1 March 2023).
  44. Karim, S.; Budachetri, K.; Mukherjee, N.; Williams, J.; Kausar, A.; Hassan, M.J.; Adamson, S.; Dowd, S.E.; Apanskevich, D.; Arijo, A.; et al. A study of ticks and tick-borne livestock pathogens in Pakistan. PLoS Negl. Trop. Dis. 2017, 11, 0005681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Ullah, S.; Alouffi, A.; Almutairi, M.M.; Islam, N.; Rehman, G.; Ul Islam, Z.; Ahmed, H.; Júnior, I.D.S.V.; Labruna, M.B.; Tanaka, T.; et al. First Report of Rickettsia conorii in Hyalomma kumari Ticks. Animals 2023, 13, 1488. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Selmi, R.; Ben Said, M.; Ben Yahia, H.; Abdelaali, H.; Messadi, L. Molecular epidemiology and phylogeny of spotted fever group Rickettsia in camels (Camelus dromedarius) and their infesting ticks from Tunisia. Transbound. Emerg. Dis. 2020, 67, 733–744. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Zahid, H.; Muñoz-Leal, S.; Khan, M.Q.; Alouffi, A.S.; Labruna, M.B.; Ali, A. Life cycle and genetic identification of Argas persicus infesting domestic fowl in Khyber Pakhtunkhwa, Pakistan. Front. Vet. Sci. 2021, 8, 664731. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Alam, S.; Khan, M.; Alouffi, A.; Almutairi, M.M.; Ullah, S.; Numan, M.; Islam, N.; Khan, Z.; Aiman, O.; Zaman Safi, S. Spatio-temporal patterns of ticks and molecular survey of Anaplasma marginale, with notes on their phylogeny. Microorganisms 2022, 10, 1663. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Khan, M.; Islam, N.; Khan, A.; Islam, Z.U.; Muñoz-Leal, S.; Labruna, M.B.; Ali, A. New records of Amblyomma gervaisi from Pakistan, with detection of a reptile-associated Borrelia sp. Ticks. Tick. Borne. Dis. 2022, 13, 102047. [Google Scholar] [CrossRef] [Scilit]
  50. Khan, Z.; Shehla, S.; Alouffi, A.; Kashif Obaid, M.; Zeb Khan, A.; Almutairi, M.M.; Numan, M.; Aiman, O.; Alam, S.; Ullah, S.; et al. Molecular survey and genetic characterization of Anaplasma marginale in ticks collected from livestock hosts in Pakistan. Animals 2022, 12, 1708. [Google Scholar] [CrossRef] [Scilit]
  51. Numan, M.; Islam, N.; Adnan, M.; Zaman Safi, S.; Chitimia-Dobler, L.; Labruna, M.B.; Ali, A. First genetic report of Ixodes kashmiricus and associated Rickettsia sp. Parasit. Vectors 2022, 15, 378. [Google Scholar] [CrossRef] [Scilit]
  52. Ali, A.; Khan, M.A.; Zahid, H.; Yaseen, P.M.; Qayash Khan, M.; Nawab, J.; Ur Rehman, Z.; Ateeq, M.; Khan, S.; Ibrahim, M. Seasonal dynamics, record of ticks infesting humans, wild and domestic animals and molecular phylogeny of Rhipicephalus microplus in Khyber Pakhtunkhwa Pakistan. Front. Physiol. 2019, 10, 793. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Ali, A.; Shehla, S.; Zahid, H.; Ullah, F.; Zeb, I.; Ahmed, H.; da Silva Vaz, I., Jr.; Tanaka, T. Molecular survey and spatial distribution of Rickettsia spp. in ticks infesting free-ranging wild animals in Pakistan (2017–2021). Pathogens 2022, 11, 162. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Ali, A.; Numan, M.; Ullah, S.; Khan, M.; Kamran, K. Genetic characterization of Haemaphysalis (Rhipistoma) indica and Haemaphysalis (Segalia) montgomeryi ticks (Ixodoidea: Ixodidae). Ticks. Tick. Borne. Dis. 2023, 14, 102105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Geevarghese, G.; Dhanda, V. The Indian Hyalomma Ticks (Ixodoidea: Ixodidae). The Indian Hyalomma Ticks (Ixodoidea: Ixodidae); I.C.A.R.: New Delhi, India, 1987. [Google Scholar]
  56. Walker, A. The Genus Rhipicephalus (Acari, Ixodidae): A Guide to the Brown Ticks of the World; Jane B. Walker, James E. Keirans and Ivan G. Horak. Trop. Anim. Health Prod. 2000, 32, 417. [Google Scholar] [CrossRef] [Scilit]
  57. Sambrook, J. A Laboratory Manual. Molecular Cloning; Cold Spring Harbor Laboratory: New York, NY, USA, 2001; Volume 1. [Google Scholar]
  58. Labruna, M.B.; Whitworth, T.; Horta, M.C.; Bouyer, D.H.; McBride, J.W.; Pinter, A.; Popov, V.; Gennari, S.M.; Walker, D.H. Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of Sao Paulo, Brazil, where Brazilian spotted fever is endemic. Clin. Microbiol. Infect. 2004, 42, 90–98. [Google Scholar]
  59. Roux, V.; Fournier, P.E.; Raoult, D. Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. Clin. Microbiol. Infect. 1996, 34, 2058–2065. [Google Scholar] [CrossRef] [Scilit]
  60. Roux, V.; Raoult, D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB). Int. J.Syst. Evol. Microbiol. 2000, 50, 1449–1455. [Google Scholar] [CrossRef] [Scilit]
  61. Hall, T.; Biosciences, I.; Carlsbad, C.J.G.B.B. BioEdit: An important software for molecular biology. GERF Bull. Biosci. 2011, 2, 60–61. [Google Scholar]
  62. Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [Scilit]
  63. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [Scilit]
  64. Edgar, R.C. MUSCLE: A multiple sequence alignment method with reduced time and space complexity. BMC Bioinform. 2004, 5, 113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Guindon, S.; Gascuel, O. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 2003, 52, 696–704. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  66. Parola, P.; Raoult, D. Ticks and tick-borne bacterial diseases in humans: An emerging infectious threat. Clin. Infect. Dis. 2001, 32, 897–928. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  67. Moutailler, S.; Valiente Moro, C.; Vaumourin, E.; Michelet, L.; Tran, F.H.; Devillers, E.; Cosson, J.F.; Gasqui, P.; Van, V.T.; Mavingui, P.; et al. Co-infection of ticks: The rule rather than the exception. PLoS. Negl. Trop. Dis. 2016, 10, 0004539. [Google Scholar] [CrossRef] [Scilit]
  68. Kamran, K.; Ali, A.; Villagra, C.A.; Bazai, Z.A.; Iqbal, A.; Sajid, M.S. Hyalomma anatolicum resistance against ivermectin and fipronil is associated with indiscriminate use of acaricides in southwestern Balochistan, Pakistan. Parasitol. Res. 2021, 120, 15–25. [Google Scholar]
  69. Shehla, S.; Ullah, F.; Alouffi, A.; Almutairi, M.M.; Khan, Z.; Tanaka, T.; Labruna, M.B.; Tsai, K.-H.; Ali, A. Association of SFG Rickettsia massiliae and Candidatus Rickettsia shennongii with Different Hard Ticks Infesting Livestock Hosts. Pathogens 2023, 12, 1080. [Google Scholar] [CrossRef] [Scilit]
  70. Fournier, P.E.; Roux, V.; Raoult, D. Phylogenetic analysis of spotted fever group rickettsiae by study of the outer surface protein rOmpA. Int. J. Syst. Evol. Microbiol. 1998, 48, 839–849. [Google Scholar]
  71. Thu, M.J.; Qiu, Y.; Matsuno, K.; Kajihara, M.; Mori-Kajihara, A.; Omori, R.; Monma, N.; Chiba, K.; Seto, J.; Gokuden, M.; et al. Diversity of spotted fever group rickettsiae and their association with host ticks in Japan. Sci. Rep. 2019, 9, 1500. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Map showing the locations (black triangles) of tick collection in specific districts of Khyber Pakhtunkhwa (KP), Pakistan.
Figure 1. Map showing the locations (black triangles) of tick collection in specific districts of Khyber Pakhtunkhwa (KP), Pakistan.
Vetsci 10 00605 g001
Figure 2. A maximum likelihood phylogenetic tree of R. hoogstraalii was constructed based on the gltA fragment. R. canadensis was used as an outgroup. The bootstrap values (1000-replication) are shown at each node. The obtained sequence (OR392758) of the present study is marked in bold and underlined font.
Figure 2. A maximum likelihood phylogenetic tree of R. hoogstraalii was constructed based on the gltA fragment. R. canadensis was used as an outgroup. The bootstrap values (1000-replication) are shown at each node. The obtained sequence (OR392758) of the present study is marked in bold and underlined font.
Vetsci 10 00605 g002
Figure 3. A maximum likelihood phylogenetic tree of R. hoogstraalii was constructed based on the ompB partial fragment. R. prowazekii was used as the outgroup. Bootstrap values (1000-replication) are shown at each node. The obtained sequence (OR392759) of the present study is marked in bold and underlined font.
Figure 3. A maximum likelihood phylogenetic tree of R. hoogstraalii was constructed based on the ompB partial fragment. R. prowazekii was used as the outgroup. Bootstrap values (1000-replication) are shown at each node. The obtained sequence (OR392759) of the present study is marked in bold and underlined font.
Vetsci 10 00605 g003
Table 1. List of primers used in the present study for the amplification of Rickettsia spp.
Table 1. List of primers used in the present study for the amplification of Rickettsia spp.
Gene Primer Primers Sequence 5′-3′ Amplicons Reference
Rickettsia gltA CS-78 GCAAGTATCGGTGAGGATGTAAT 401 bp [58]
CS-323 GCTTCCTTAAAATTCAATAAATCAGGAT
Rickettsia ompA Rrl9O.70 ATGGCGAATATTTCTCCAAAA 631 bp [59]
Rr190.701n GTTCCGTTAATGGCAGCATCT
Rickettsia ompB 120-M59 CCGCAGGGTTGGTAACTGC 862 bp [60]
120–807CCTTTTAGATTACCGCCTAA
Table 2. Global epidemiology of tick-borne R. hoogstraalii detected in different ticks infesting various hosts using different methods.
Table 2. Global epidemiology of tick-borne R. hoogstraalii detected in different ticks infesting various hosts using different methods.
Country/YearTick Specie/SourceDetected in HostSerologically/Molecularly (PCR)Reference
Croatia 2006Ha. sulcata Sheep PCR[17]
Goats
Georgia, USA 2007 “Candidatus R. hoogstraaliiCarios capensis Brown pelicans PCR[18]
Southeastern Spain 2008 Ha. punctata VegetationPCR[19]
Ha. sulcata
La Rioja, Spain 2008Ha. punctataSheepPCR[20]
Ha. sulcataCow
Western India 2011–2012 C. capensis Seabird PCR[21]
Croatia 2010Ha. sulcata Sheep PCR/TEM[22]
Cyprus 2011 Ha. punctata Mouflons (Wild sheep) PCR[23]
Ethiopia 2012Ar. persicusCracks and crevices of livestock areasPCR[24]
Turkey 2014Ha. parvaHumansPCR[25]
Turkey 2016Ha. parvaHumansPCR[26]
Italy 2016 Ha. punctataMouflonsPCR[27]
Ha. sulcata
Italy 2017 I. ricinus Lizards PCR[28]
Ha. sulcata
Greece 2017 Ha. parva DogPCR[29]
Greece 2019 Ha. sulcata GoatsPCR[30]
Ha. parva, and Ha. sulcataSheep
Iran 2020Ar. persicusAviaryPCR[31]
DESERT SOUTHWEST, USA 2020 Ar. persicus Birds PCR[32]
Turkey 2020 Ha. parva Wild animals include wolves, fox, hare, and lynx,PCR[33]
Georgia 2020D. marginatusDomestic animalsPCR[34]
Ha. sulcata
Namibia 2020 Argus transgariepinus Bat PCR[35]
Zambia 2021 Ar. walkerae Chicken coop PCR[36]
Italy 2021I. ricinusDomestic animalsPCR[37]
Romania 2022 Rh. rossicus DogPCR[38]
China 2022 Ha. montgomeryi GoatsPCR[39]
China 2022 Ar. persicus From Cracks in hen house PCR[40]
Africa 2022 Africaniella transversale Python regiusPCR[41]
Anatolia 2022 Ha. parvaCattle, Sheep, and GoatsPCR[42]
Ha. sulcata
Pakistan 2023 Ha. montgomeryi GoatsPCR[15]
Sheep
Spain 2023Ha. formosensisVegetationPCR[16]
Table 3. Information regarding ticks, hosts, locality, and the molecular detection of R. hoogstraalii in this study.
Table 3. Information regarding ticks, hosts, locality, and the molecular detection of R. hoogstraalii in this study.
DistrictExamined HostTicks SpeciesInfested/Examined (%)Number of Ticks (%) (F, M, N)Ticks Subjected to PCR (F, M, N)Rickettsia hoogstraalii Detected via Both gltA, and ompB
BunerGoatsRh. turanicus8/12 (66.6)25 (17.1), (7,5,13)2, 1, 4-
Ha. sulcata18 (11.3), (8,3,7)2, 2, 31 N
SheepHa. bispinosa6/10 (60)15 (10.2), (7,3,5)4, 0, 3-
Ha. sulcata12 (7.6), (4,3,5)2, 1, 41 N
Ha. montgomeryi10 (6.8), (3,2,5)3, 1, 3-
CattleRh. microplus10/14 (71.4)66 (41.7), (21,14,31)4, 0, 3-
Total24/36 (66.6)146 (17.7), (50, 30, 66)17, 5, 202 N
BajaurGoatsRh. turanicus6/10 (60)18 (11.3), (5,4,9)3, 0, 4-
Ha. sulcata13 (8.2), (3,2,8)3, 1, 31 N
Ha. montgomeryi9 (5.6), (3,2,4)3, 1, 3-
SheepHa. bispinosa5/8 (62.5)10 (6.5), (4,2,4)2, 1, 4-
Ha. sulcata15 (9.3), (5,2,8)4, 0, 32F
CattleRh. microplus13/15(86.6)50 (31.6), (19,10,21)2, 0, 5-
Hy. anatolicum43 (26.0), (16,9,18)2, 1, 4-
Total25/33 (75.7)158 (19.9), (55, 31, 72)19, 4, 262 F, 1 N
Lakki MarwatSheepHa. sulcata6/12 (50)18 (13.5), (5,4,9)3, 1, 3-
Ha. montgomeryi13(9.7), (5,2,6)2, 1, 4-
CattleRh. microplus12/14 (85.7)60 (45.1), (20,17,23)2, 1, 4-
Hy. anatolicum42 (13.5), (15,10,17)3, 0, 41 N
Total18/26 (75)133 (16.1), (45, 33, 55)10, 3, 51 N
BannuGoatsRh. turanicus5/8 (62.5)19 (15.0), (7,4,8)3, 1, 3-
Ha. montgomeryi10 (7.9), (4,2,4)3, 0, 4-
CattleRh. microplus12/15 (80)47 (44.3), (19,8,20)2, 0, 5-
Hy. anatolicum50 (39.6), (18,11,21)1, 1, 51F, 1 N
Total17/23 (74)126 (15.3), (48, 25, 53)9, 2, 171 F, 1 N
Dir-UpperGoatsRh. turanicus6/8 (75)30 (25.8), (11,4,15)2, 2, 3-
Ha. sulcata18 (15.5), (6,2,10)4, 1, 21 N
SheepHa. sulcata6/10 (60)10 (8.6), (4,2,4)3, 1, 3
Ha. montgomeryi12 (10.3), (4,3,5)2, 2, 3-
CattleHy. anatolicum8/10 (80)46 (27.7), (14,14,18)3, 0, 4-
Total20/28 (71.4)116 (14.1), (39, 25, 52)14, 6, 151 N
KarakGoatsRh. turanicus14/16 (87.5)30 (20.8), (12,5,13)2, 1, 4-
Ha. montogomeryi12 (8.3), (4,2,6)3, 1, 3-
CattleRh. microplus16/21 (76.1)60 (41.6), (22,13,25)3, 0, 4-
Hy. anatolicun42 (23.2), (16,9,17)2, 2, 3-
Total30/37 (81.0)144 (17.5), (54, 29, 61)10, 4, 14-
Overall Total134/183 (73.2)823 (297, 173, 353)210 (79, 24, 107)9 (3 F, 6 N) (4.3%)
Note: N = nymphs; M = males; F = adult females.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Aneela, A.; Almutairi, M.M.; Alouffi, A.; Ahmed, H.; Tanaka, T.; da Silva Vaz, I., Junior; Chang, S.-C.; Chen, C.-C.; Ali, A. Molecular Detection of Rickettsia hoogstraalii in Hyalomma anatolicum and Haemaphysalis sulcata: Updated Knowledge on the Epidemiology of Tick-Borne Rickettsia hoogstraalii. Vet. Sci. 2023, 10, 605. https://doi.org/10.3390/vetsci10100605

AMA Style

Aneela A, Almutairi MM, Alouffi A, Ahmed H, Tanaka T, da Silva Vaz I Junior, Chang S-C, Chen C-C, Ali A. Molecular Detection of Rickettsia hoogstraalii in Hyalomma anatolicum and Haemaphysalis sulcata: Updated Knowledge on the Epidemiology of Tick-Borne Rickettsia hoogstraalii. Veterinary Sciences. 2023; 10(10):605. https://doi.org/10.3390/vetsci10100605

Chicago/Turabian Style

Aneela, Aneela, Mashal M. Almutairi, Abdulaziz Alouffi, Haroon Ahmed, Tetsuya Tanaka, Itabajara da Silva Vaz, Junior, Shun-Chung Chang, Chien-Chin Chen, and Abid Ali. 2023. "Molecular Detection of Rickettsia hoogstraalii in Hyalomma anatolicum and Haemaphysalis sulcata: Updated Knowledge on the Epidemiology of Tick-Borne Rickettsia hoogstraalii" Veterinary Sciences 10, no. 10: 605. https://doi.org/10.3390/vetsci10100605

APA Style

Aneela, A., Almutairi, M. M., Alouffi, A., Ahmed, H., Tanaka, T., da Silva Vaz, I., Junior, Chang, S.-C., Chen, C.-C., & Ali, A. (2023). Molecular Detection of Rickettsia hoogstraalii in Hyalomma anatolicum and Haemaphysalis sulcata: Updated Knowledge on the Epidemiology of Tick-Borne Rickettsia hoogstraalii. Veterinary Sciences, 10(10), 605. https://doi.org/10.3390/vetsci10100605

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop