Cadmium-Induced Kidney Apoptosis Based on the IRE1α-XBP1 Signaling Pathway and the Protective Effect of Quercetin
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Animal Care and Sample Treatment
2.3. Evaluation of Kidney Function
2.4. Hematoxylin and Eosin (HE) Staining Analysis
2.5. TUNEL Method
2.6. RT-PCR
2.7. Western Blot Analysis
2.8. Statistical Analysis
3. Results
3.1. Effects of Que on Renal Function in Cd-Exposed Rats
3.2. Histopathological Injury
3.3. TUNEL Observation of Renal Cell Apoptosis
3.4. mRNA Expression and Protein Levels of Apoptosis-Related Genes
3.5. mRNA and Protein Levels of ERS-Related Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Yuan, J.; Huang, X.; Zhao, Y.; Gu, J.; Yuan, Y.; Liu, Z.; Zou, H.; Bian, J. Rat Hepatocytes Mitigate Cadmium Toxicity by Forming Annular Gap Junctions and Degrading Them via Endosome-Lysosome Pathway. Int. J. Mol. Sci. 2022, 23, 15607. [Google Scholar] [CrossRef]
- Hu, R.; Luo, H.; Ji, Y.; Wang, Z.; Zheng, P.; Ouyang, H.; Wang, X.; Wang, Y.; Bao, B.; Liao, G.; et al. Activation of NLRP3 signaling contributes to cadmium-induced bone defects, associated with autophagic flux obstruction. Sci. Total Environ. 2023, 893, 164787. [Google Scholar] [CrossRef]
- Yan, L.J.; Allen, D.C. Cadmium-Induced Kidney Injury: Oxidative Damage as a Unifying Mechanism. Biomolecules 2021, 11, 1575. [Google Scholar] [CrossRef]
- Klaassen, C.; Liu, J.; Choudhuri, S. Metallothionein: An intracellular protein to protect against cadmium toxicity. Annu. Rev. Pharmacol. Toxicol. 1999, 39, 267–294. [Google Scholar] [CrossRef]
- Godt, J.; Scheidig, F.; Grosse-Siestrup, C.; Esche, V.; Brandenburg, P.; Reich, A.; Groneberg, D. The toxicity of cadmium and resulting hazards for human health. J. Occup. Med. Toxicol. 2006, 1, 22. [Google Scholar] [CrossRef]
- Doccioli, C.; Sera, F.; Francavilla, A.; Cupisti, A.; Biggeri, A. Association of cadmium environmental exposure with chronic kidney disease: A systematic review and meta-analysis. Sci. Total Environ. 2024, 906, 167165. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Ge, M.; Zhu, W.; Wang, P.; Wang, J.; Tai, T.; Wang, Y.; Sun, J.; Shi, G. Protective Effects of Astilbin Against Cadmium-Induced Apoptosis in Chicken Kidneys via Endoplasmic Reticulum Stress Signaling Pathway. Biol. Trace Elem. Res. 2022, 200, 4430–4443. [Google Scholar] [CrossRef]
- Choudhury, C.; Mazumder, R.; Kumar, R.; Dhar, B.; Sengupta, M. Cadmium induced oxystress alters Nrf2-Keap1 signaling and triggers apoptosis in piscine head kidney macrophages. Aquat. Toxicol. 2021, 231, 105739. [Google Scholar] [CrossRef]
- Ding, L.; Wang, K.; Zhu, H.; Liu, Z.; Wang, J. Protective effect of quercetin on cadmium-induced kidney apoptosis in rats based on PERK signaling pathway. J. Trace Elem. Med. Biol. 2024, 82, 127355. [Google Scholar] [CrossRef] [PubMed]
- Murata, N.; Nishimura, K.; Harada, N.; Kitakaze, T.; Yoshihara, E.; Inui, H.; Yamaji, R. Insulin reduces endoplasmic reticulum stress-induced apoptosis by decreasing mitochondrial hyperpolarization and caspase-12 in INS-1 pancreatic β-cells. Physiol. Rep. 2024, 12, e16106. [Google Scholar] [CrossRef] [PubMed]
- Kaur, H.; Sarmah, D.; Datta, A.; Borah, A.; Yavagal, D.R.; Bhattacharya, P. Stem cells alleviate OGD/R mediated stress response in PC12 cells following a co-culture: Modulation of the apoptotic cascade through BDNF-TrkB signaling. Cell Stress Chaperones 2023, 28, 1041–1051. [Google Scholar] [CrossRef] [PubMed]
- Hetz, C.; Zhang, K.; Kaufman, R.J. Mechanisms, regulation and functions of the unfolded protein response. Nat. Rev. Mol. Cell Biol. 2020, 21, 421–438. [Google Scholar] [CrossRef]
- Ren, J.; Bi, Y.; Sowers, J.R.; Hetz, C.; Zhang, Y. Endoplasmic reticulum stress and unfolded protein response in cardiovascular diseases. Nat. Rev. Cardiol. 2021, 18, 499–521. [Google Scholar] [CrossRef]
- Botrus, G.; Miller, R.M.; Uson Junior, P.L.S.; Kannan, G.; Han, H.; Von Hoff, D.D. Increasing Stress to Induce Apoptosis in Pancreatic Cancer via the Unfolded Protein Response (UPR). Int. J. Mol. Sci. 2022, 24, 577. [Google Scholar] [CrossRef]
- Deepika; Maurya, P.K. Health Benefits of Quercetin in Age-Related Diseases. Molecules 2022, 27, 2498. [Google Scholar] [CrossRef] [PubMed]
- Xu, D.; Hu, M.; Wang, Y.; Cui, Y. Antioxidant Activities of Quercetin and Its Complexes for Medicinal Application. Molecules 2019, 24, 1123. [Google Scholar] [CrossRef]
- Hosseini, A.; Razavi, B.; Banach, M.; Hosseinzadeh, H. Quercetin and metabolic syndrome: A review. Phytother. Res. PTR 2021, 35, 5352–5364. [Google Scholar] [CrossRef] [PubMed]
- Andres, S.; Pevny, S.; Ziegenhagen, R.; Bakhiya, N.; Schäfer, B.; Hirsch-Ernst, K.I.; Lampen, A. Safety Aspects of the Use of Quercetin as a Dietary Supplement. Mol. Nutr. Food Res. 2018, 62, 1700447. [Google Scholar] [CrossRef] [PubMed]
- Ding, L.; Zhu, H.; Wang, K.; Huang, R.; Yu, W.; Yan, B.; Zhou, B.; Wang, H.; Yang, Z.; Liu, Z.; et al. Quercetin alleviates cadmium-induced BRL-3A cell apoptosis by inhibiting oxidative stress and the PERK/IRE1α/ATF6 signaling pathway. Environ. Sci. Pollut. Res. 2023, 30, 125790–125805. [Google Scholar] [CrossRef]
- Bernhoft, R.A. Cadmium toxicity and treatment. Sci. World J. 2013, 2013, 394652. [Google Scholar] [CrossRef]
- Ma, Y.; Su, Q.; Yue, C.; Zou, H.; Zhu, J.; Zhao, H.; Song, R.; Liu, Z. The Effect of Oxidative Stress-Induced Autophagy by Cadmium Exposure in Kidney, Liver, and Bone Damage, and Neurotoxicity. Int. J. Mol. Sci. 2022, 23, 13491. [Google Scholar] [CrossRef]
- Ma, Y.; Yue, C.; Sun, Q.; Wang, Y.; Gong, Z.; Zhang, K.; Da, J.; Zou, H.; Zhu, J.; Zhao, H.; et al. Cadmium exposure exacerbates kidney damage by inhibiting autophagy in diabetic rats. Ecotoxicol. Environ. Saf. 2023, 267, 115674. [Google Scholar] [CrossRef] [PubMed]
- Carrillo-Martinez, E.J.; Flores-Hernández, F.Y.; Salazar-Montes, A.M.; Nario-Chaidez, H.F.; Hernández-Ortega, L.D. Quercetin, a Flavonoid with Great Pharmacological Capacity. Molecules 2024, 29, 1000. [Google Scholar] [CrossRef] [PubMed]
- Srivastava, A.; Kumari, A.; Jagdale, P.; Ayanur, A.; Pant, A.B.; Khanna, V.K. Potential of Quercetin to Protect Cadmium Induced Cognitive Deficits in Rats by Modulating NMDA-R Mediated Downstream Signaling and PI3K/AKT-Nrf2/ARE Signaling Pathways in Hippocampus. Neuromol. Med. 2023, 25, 426–440. [Google Scholar] [CrossRef]
- Alshammari, G.M.; Al-Qahtani, W.H.; AlFaris, N.A.; Albekairi, N.A.; Alqahtani, S.; Eid, R.; Yagoub, A.E.A.; Al-Harbi, L.N.; Yahya, M.A. Quercetin alleviates cadmium chloride-induced renal damage in rats by suppressing endoplasmic reticulum stress through SIRT1-dependent deacetylation of Xbp-1s and eIF2α. Biomed. Pharmacother. 2021, 141, 111862. [Google Scholar] [CrossRef]
- Huang, J.; Ma, X.T.; Xu, D.D.; Yao, B.J.; Zhao, D.Q.; Leng, X.Y.; Liu, J. Xianling Gubao Capsule Prevents Cadmium-Induced Kidney Injury. BioMed Res. Int. 2021, 2021, 3931750. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Yang, Z.; Lin, L.; Zhao, Z.; Liu, Z.; Liu, X. Protective effect of naringenin against lead-induced oxidative stress in rats. Biol. Trace Elem. Res. 2012, 146, 354–359. [Google Scholar] [CrossRef]
- Renugadevi, J.; Prabu, S.M. Quercetin protects against oxidative stress-related renal dysfunction by cadmium in rats. Exp. Toxicol. Pathol. Off. J. Ges. Fur Toxikol. Pathol. 2010, 62, 471–481. [Google Scholar] [CrossRef]
- Shi, Y.; Wang, K.; Ling, H.; Mao, J.; Xu, B.; Liu, Z.; Wang, J. Quercetin attenuates cadmium-induced hepatotoxicity by suppressing oxidative stress and apoptosis in rat. J. Trace Elem. Med. Biol. Organ Soc. Miner. Trace Elem. (GMS) 2024, 86, 127554. [Google Scholar] [CrossRef] [PubMed]
- Moore, C.L.; Savenka, A.V.; Basnakian, A.G. TUNEL Assay: A Powerful Tool for Kidney Injury Evaluation. Int. J. Mol. Sci. 2021, 22, 412. [Google Scholar] [CrossRef] [PubMed]
- Nakagawa, T.; Zhu, H.; Morishima, N.; Li, E.; Xu, J.; Yankner, B.A.; Yuan, J. Caspase-12 mediates endoplasmic-reticulum-specific apoptosis and cytotoxicity by amyloid-beta. Nature 2000, 403, 98–103. [Google Scholar] [CrossRef] [PubMed]
- Moradipour, A.; Dariushnejad, H.; Ahmadizadeh, C.; Lashgarian, H.E. Dietary flavonoid carvacrol triggers the apoptosis of human breast cancer MCF-7 cells via the p53/Bax/Bcl-2 axis. Med. Oncol. 2022, 40, 46. [Google Scholar] [CrossRef]
- Biagioli, M.; Pifferi, S.; Ragghianti, M.; Bucci, S.; Rizzuto, R.; Pinton, P. Endoplasmic reticulum stress and alteration in calcium homeostasis are involved in cadmium-induced apoptosis. Cell Calcium 2008, 43, 184–195. [Google Scholar] [CrossRef] [PubMed]
- Ibrahim, I.M.; Abdelmalek, D.H.; Elfiky, A.A. GRP78, A cell’s response to stress. Life Sci. 2019, 226, 156–163. [Google Scholar] [CrossRef]
- Du, H.; Li, J.; Wei, X.; Yang, D.; Zhang, B.; Fan, X.; Zhao, M.; Zhu, R.; Zhang, Z.; Zhang, Y.; et al. Methylparaben induces hepatic glycolipid metabolism disorder by activating the IRE1α-XBP1 signaling pathway in male mice. Environ. Int. 2024, 184, 108445. [Google Scholar] [CrossRef] [PubMed]
- Park, S.B.; Cho, G.H.; Park, Y.E.; Chun, H.S. Emodin, an Emerging Mycotoxin, Induces Endoplasmic Reticulum Stress-Related Hepatotoxicity through IRE1α-XBP1 Axis in HepG2 Cells. Toxins 2023, 15, 455. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Jiao, Y.; Tao, Y.; Li, Z.; Yu, H.; Han, S.; Yang, Y. Monobutyl phthalate can induce autophagy and metabolic disorders by activating the ire1a-xbp1 pathway in zebrafish liver. J. Hazard. Mater. 2021, 412, 125243. [Google Scholar] [CrossRef]
- Hu, X.; Cai, J.; Zhu, J.; Lang, W.; Zhong, J.; Zhong, H.; Chen, F. Arsenic trioxide potentiates Gilteritinib-induced apoptosis in FLT3-ITD positive leukemic cells via IRE1a-JNK-mediated endoplasmic reticulum stress. Cancer Cell Int. 2020, 20, 250. [Google Scholar] [CrossRef] [PubMed]
Genes | Product Length | Primer Sequences (5′ → 3′) |
---|---|---|
Caspase-12 | 121 bp | Forward: TCGGAGAAGGAGCGAGCTTA Reverse: AGCTGTTTGTCGGAATTGGC |
Caspase-3 | 156 bp | Forward: GCAGCAGCCTCAAATTGTTGACTA Reverse: TGCTCCGGCTCAAACCATC |
Bcl-2 | 108 bp | Forward: CAAGCCGGGAGAACAGGGTA Reverse: CCCACCGAACTCAAAGAAGGC |
GRP78 | 124 bp | Forward: ATGGTGTGGGAGATCCTGTTTTC Reverse: CAAGACGCACAGGGATACGC |
IRE1α | 98 bp | Forward: GCGCAGGTGCAATGACATAC Reverse: CATGCAAACTTCCGTCCAGG |
XBP1 | 188 bp | Forward: CTGAGTCCGCAGCAGGTG Reverse: GACCTCTGGGAGTTCCTCCA |
β-actin | 168 bp | Forward: AGGGAAATCGTGCGTGACAT Reverse: CCTCGGGGCATCGGAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, L.; Cao, W.; Wu, T. Cadmium-Induced Kidney Apoptosis Based on the IRE1α-XBP1 Signaling Pathway and the Protective Effect of Quercetin. Toxics 2025, 13, 129. https://doi.org/10.3390/toxics13020129
Wang L, Cao W, Wu T. Cadmium-Induced Kidney Apoptosis Based on the IRE1α-XBP1 Signaling Pathway and the Protective Effect of Quercetin. Toxics. 2025; 13(2):129. https://doi.org/10.3390/toxics13020129
Chicago/Turabian StyleWang, Liuxin, Weiwei Cao, and Ting Wu. 2025. "Cadmium-Induced Kidney Apoptosis Based on the IRE1α-XBP1 Signaling Pathway and the Protective Effect of Quercetin" Toxics 13, no. 2: 129. https://doi.org/10.3390/toxics13020129
APA StyleWang, L., Cao, W., & Wu, T. (2025). Cadmium-Induced Kidney Apoptosis Based on the IRE1α-XBP1 Signaling Pathway and the Protective Effect of Quercetin. Toxics, 13(2), 129. https://doi.org/10.3390/toxics13020129