Developmental Toxicity and Cardiotoxicity of N, N-Dimethylaniline in Zebrafish Embryos
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Zebrafish Rearing and Embryo Acquisition
2.3. Drug Exposure Experiments on Embryos
2.4. Cardiac Morphologic and Functional Analysis
2.5. Oxidative Stress Analysis
2.6. Lipid Accumulation and Apoptosis Analysis
2.7. Histopathological Analysis
2.8. Gene Expression Analysis
2.9. Statistical Analysis
3. Results
3.1. Developmental Toxicity of N, N-Dimethylaniline in Zebrafish Embryos
3.2. N, N-Dimethylaniline Induces Oxidative Stress in Zebrafish Embryos
3.3. N, N-Dimethylaniline Induces Lipid Accumulation and Apoptosis in Zebrafish Embryos
3.4. N, N-Dimethylaniline Causes Cardiac Damage in Zebrafish Embryos
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Yan, N.; Du, Y.; Liu, X.; Chu, C.; Shi, J.; Zhang, H.; Liu, Y.; Zhang, Z. Morphological Characteristics, Nutrients, and Bioactive Compounds of Zizania Latifolia, and Health Benefits of Its Seeds. Molecules 2018, 23, 1561. [Google Scholar] [CrossRef] [PubMed]
- Hu, G.; Li, X.; Lai, A.; Liu, Y.; Zhang, Y.; Wang, J.; Sun, S.; Zhu, J.; Yang, M. Comparative Analysis of the Nutritional Quality of Zizania Latifolia Cultivars Harvested in Different Growing Seasons. Foods 2024, 13, 30. [Google Scholar] [CrossRef]
- Li, F.; Zhang, J.; Zhong, H.; Chen, J. Germicide Fenaminosulf Promots Gall Formation of Zizania latifolia without Directly Affecting the Growth of Endophytic Fungus Ustilago esculenta. BMC Plant Biol. 2022, 22, 418. [Google Scholar] [CrossRef]
- Di, S.; Wang, X.; Wang, L.; Qi, P.; Xu, H.; Wang, Z.; Wang, X. Residue Dynamics of Fenaminosulf in Zizania caduciflora L. Cultivation System. J. Zhejiang Agric. Sci. 2018, 59, 1527–1530. [Google Scholar] [CrossRef]
- National Toxicology Program. Toxicology and Carcinogenesis Studies of N, N-Dimethylaniline (CAS No. 121-69-7) in F344/N Rats and B6C3F1 Mice (Gavage Studies). Natl. Toxicol. Program. Tech. Rep. Ser. 1989, 360, 1–175. [Google Scholar]
- Taningher, M.; Pasquini, R.; Bonatti, S. Genotoxicity Analysis of N, N-Dimethylaniline and N, N-Dimethyl-p-Toluidine. Environ. Mol. Mutagen. 1993, 21, 349–356. [Google Scholar] [CrossRef] [PubMed]
- Moore-Morris, T.; van Vliet, P.P.; Andelfinger, G.; Puceat, M. Role of Epigenetics in Cardiac Development and Congenital Diseases. Physiol. Rev. 2018. [Google Scholar] [CrossRef]
- World Heart Federation. World Heart Report 2023: Confronting the World’s Number One Killer.2023. Available online: https://world-heart-federation.org/wp-content/uploads/World-Heart-Report-2023.pdf (accessed on 25 July 2024).
- Rajagopalan, S.; Landrigan, P.J. Pollution and the Heart. N. Engl. J. Med. 2021, 385, 1881–1892. [Google Scholar] [CrossRef]
- Chowdhury, R.; Ramond, A.; O’Keeffe, L.M.; Shahzad, S.; Kunutsor, S.K.; Muka, T.; Gregson, J.; Willeit, P.; Warnakula, S.; Khan, H.; et al. Environmental Toxic Metal Contaminants and Risk of Cardiovascular Disease: Systematic Review and Meta-Analysis. BMJ 2018, 7, 362. [Google Scholar] [CrossRef] [PubMed]
- Alhamdow, A.; Lindh, C.; Albin, M.; Gustavsson, P.; Tinnerberg, H.; Broberg, K. Early Markers of Cardiovascular Disease Are Associated with Occupational Exposure to Polycyclic Aromatic Hydrocarbons. Sci. Rep. 2017, 7, 9426. [Google Scholar] [CrossRef]
- Zhao, X.; Li, J.; Liu, Y.; Liu, Y.; Jiang, X.; Long, L.; Wang, J.; Yao, Y.; Zhang, Q.; Li, M.; et al. A Prospective Cohort Study of Exposure to Household Pesticide with Cardiovascular Diseases Mortality in Older Adults. J. Hazard. Mater. 2024, 471, 134316. [Google Scholar] [CrossRef]
- Li, M.; Yu, T.; Lai, J.; Han, X.; Hu, J.; Deng, Z.; Li, D.; Ye, Z.; Wang, S.; Hu, C.; et al. Ethoprophos Induces Cardiac Toxicity in Zebrafish Embryos. Ecotoxicol. Environ. Saf. 2021, 228, 113029. [Google Scholar] [CrossRef]
- Saputra, F.; Lai, Y.-H.; Roldan, M.J.M.; Alos, H.C.; Aventurado, C.A.; Vasquez, R.D.; Hsiao, C.-D. The Effect of the Pyrethroid Pesticide Fenpropathrin on the Cardiac Performance of Zebrafish and the Potential Mechanism of Toxicity. Biology 2023, 12, 1214. [Google Scholar] [CrossRef] [PubMed]
- Chen, X. Isoflucypram Cardiovascular Toxicity in Zebrafish (Danio rerio). Sci. Total Environ. 2021, 787, 147529. [Google Scholar] [CrossRef]
- Feitsma, H.; Cuppen, E. Zebrafish as a Cancer Model. Mol. Cancer Res. 2008, 6, 685–694. [Google Scholar] [CrossRef]
- Horzmann, K.A.; Freeman, J.L. Making Waves: New Developments in Toxicology With the Zebrafish. Toxicol. Sci. 2018, 163, 5–12. [Google Scholar] [CrossRef] [PubMed]
- Howe, K.; Clark, M.D.; Torroja, C.F.; Torrance, J.; Berthelot, C.; Muffato, M.; Collins, J.E.; Humphray, S.; McLaren, K.; Matthews, L.; et al. The Zebrafish Reference Genome Sequence and Its Relationship to the Human Genome. Nature 2013, 496, 498–503. [Google Scholar] [CrossRef] [PubMed]
- Tal, T.; Yaghoobi, B.; Lein, P.J. Translational Toxicology in Zebrafish. Curr. Opin. Toxicol. 2020, 23–24, 56–66. [Google Scholar] [CrossRef] [PubMed]
- Ward, A.; Lieschke, G. The Zebrafish as a Model System for Human Disease. Front. Biosci. A J. Virtual Libr. 2002, 7, d827-33. [Google Scholar] [CrossRef]
- Bambino, K.; Chu, J. Chapter Nine-Zebrafish in Toxicology and Environmental Health. In Current Topics in Developmental Biology; Sadler, K.C., Ed.; Zebrafish at the Interface of Development and Disease Research; Academic Press: Cambridge, MA, USA, 2017; Volume 124, pp. 331–367. [Google Scholar]
- Pedroni, A.; Yilmaz, E.; Del Vecchio, L.; Bhattarai, P.; Vidal, I.T.; Dai, Y.-W.E.; Koutsogiannis, K.; Kizil, C.; Ampatzis, K. Decoding the Molecular, Cellular, and Functional Heterogeneity of Zebrafish Intracardiac Nervous System. Nat. Commun. 2024, 15, 10483. [Google Scholar] [CrossRef] [PubMed]
- Stainier, D.Y.R. Zebrafish Genetics and Vertebrate Heart Formation. Nat. Rev. Genet. 2001, 2, 39–48. [Google Scholar] [CrossRef] [PubMed]
- Berghmans, S.; Butler, P.; Goldsmith, P.; Waldron, G.; Kimber, G.; Roach, A.; Alderton, W.; Fleming, A. Zebrafish Based Assays for the Assessment of Cardiac, Visual and Gut Function—Potential Safety Screens for Early Drug Discovery. J. Pharmacol. Toxicol. Methods 2008, 58, 59–68. [Google Scholar] [CrossRef] [PubMed]
- Hoyberghs, J.; Bars, C.; Ayuso, M.; Van Ginneken, C.; Foubert, K.; Van Cruchten, S. DMSO Concentrations up to 1% Are Safe to Be Used in the Zebrafish Embryo Developmental Toxicity Assay. Front. Toxicol. 2021, 3, 804033. [Google Scholar] [CrossRef]
- OECD. The Organisation for Economic Co-Operation and Development (OECD) (Pp. Test No. 236: Fish Embryo Acute Toxicity (FET) Test); OECD: Paris, France, 2013. [Google Scholar]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An Open-Source Platform for Biological-Image Analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [PubMed]
- Schlombs, K.; Wagner, T.; Scheel, J. Site-1 Protease Is Required for Cartilage Development in Zebrafish. Proc. Natl. Acad. Sci. USA 2003, 100, 14024–14029. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Chen, F.; Lu, J.; Wu, M.; Cheng, J.; Xu, W.; Li, Z.; Zhang, Y. Developmental and Cardiovascular Toxicities of Acetochlor and Its Chiral Isomers in Zebrafish Embryos through Oxidative Stress. Sci. Total Environ. 2023, 896, 165296. [Google Scholar] [CrossRef] [PubMed]
- Registration Dossier—ECHA. Available online: https://echa.europa.eu/registration-dossier/-/registered-dossier/5396/6/2/2 (accessed on 26 January 2025).
- Johnson, A.; Carew, E.; Sloman, K.A. The Effects of Copper on the Morphological and Functional Development of Zebrafish Embryos. Aquat. Toxicol. 2007, 84, 431–438. [Google Scholar] [CrossRef]
- Lu, J.; Wang, W.; Zhang, C.; Xu, W.; Chen, W. Characterization of Glyphosate-Induced Cardiovascular Toxicity and Apoptosis in Zebrafish. Sci. Total Environ. 2022, 851, 158308. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; Mu, X.; Wang, K.; Chai, T.; Yang, Y.; Qiu, L.; Wang, C. Cyhalofop-Butyl Has the Potential to Induce Developmental Toxicity, Oxidative Stress and Apoptosis in Early Life Stage of Zebrafish (Danio rerio). Environ. Pollut. 2015, 203, 40–49. [Google Scholar] [CrossRef] [PubMed]
- Klaunig, J.E.; Wang, Z.; Pu, X.; Zhou, S. Oxidative Stress and Oxidative Damage in Chemical Carcinogenesis. Toxicol. Appl. Pharmacol. 2011, 254, 86–99. [Google Scholar] [CrossRef]
- Valavanidis, A.; Vlahogianni, T.; Dassenakis, M.; Scoullos, M. Molecular Biomarkers of Oxidative Stress in Aquatic Organisms in Relation to Toxic Environmental Pollutants. Ecotoxicol. Environ. Saf. 2006, 64, 178–189. [Google Scholar] [CrossRef] [PubMed]
- Ighodaro, O.M.; Akinloye, O.A. First Line Defence Antioxidants-Superoxide Dismutase (SOD), Catalase (CAT) and Glutathione Peroxidase (GPX): Their Fundamental Role in the Entire Antioxidant Defence Grid. Alex. J. Med. 2018, 54, 287–293. [Google Scholar] [CrossRef]
- Niu, B.; Liao, K.; Zhou, Y.; Wen, T.; Quan, G.; Pan, X. Application of Glutathione Depletion in Cancer Therapy: Enhanced ROS-Based Therapy, Ferroptosis, and Chemotherapy. Biomaterials 2021, 277, 121110. [Google Scholar] [CrossRef]
- Yilgor, A.; Demir, C. Determination of Oxidative Stress Level and Some Antioxidant Activities in Refractory Epilepsy Patients. Sci. Rep. 2024. [Google Scholar] [CrossRef] [PubMed]
- Ge, W.; Yan, S.; Wang, J.; Zhu, L.; Chen, A.; Wang, J. Oxidative Stress and DNA Damage Induced by Imidacloprid in Zebrafish (Danio rerio). J. Agric. Food Chem. 2015. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Qin, Y.; Li, X.; Yan, B.; Martyniuk, C.J. Comprehensive Interrogation of Metabolic and Bioenergetic Responses of Early-Staged Zebrafish (Danio rerio) to a Commercial Copper Hydroxide Nanopesticide. Environ. Sci. Technol. 2021, 55, 13033–13044. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.; Liu, C.; Wang, J.; Liang, Y.; Gong, X.; You, L.; Ji, C.; Wang, S.-L.; Wang, C.; Chi, X. Difenoconazole Induces Cardiovascular Toxicity through Oxidative Stress-Mediated Apoptosis in Early Life Stages of Zebrafish (Danio rerio). Ecotoxicol. Environ. Saf. 2021, 216, 112227. [Google Scholar] [CrossRef] [PubMed]
- Yelon, D. Cardiac Patterning and Morphogenesis in Zebrafish. Dev. Dyn. 2001, 222, 552–563. [Google Scholar] [CrossRef] [PubMed]
- Sarmah, S.; Marrs, J. Zebrafish as a Vertebrate Model System to Evaluate Effects of Environmental Toxicants on Cardiac Development and Function. IJMS 2016, 17, 2123. [Google Scholar] [CrossRef]
- Lu, S.; Hu, M.; Wang, Z.; Liu, H.; Kou, Y.; Lyu, Z.; Tian, J. Generation and Application of the Zebrafish Heg1 Mutant as a Cardiovascular Disease Model. Biomolecules 2020, 10, 1542. [Google Scholar] [CrossRef] [PubMed]
- Berdougo, E.; Coleman, H.; Lee, D.H.; Stainier, D.Y.R.; Yelon, D. Mutation of Weak Atrium/Atrial Myosin Heavy Chain Disrupts Atrial Function and Influences Ventricular Morphogenesis in Zebrafish. Development 2003, 130, 6121–6129. [Google Scholar] [CrossRef]
- England, J.; Loughna, S. Heavy and Light Roles: Myosin in the Morphogenesis of the Heart. Cell. Mol. Life Sci. 2013, 70, 1221–1239. [Google Scholar] [CrossRef] [PubMed]
- Yelon, D.; Horne, S.A.; Stainier, D.Y.R. Restricted Expression of Cardiac Myosin Genes Reveals Regulated Aspects of Heart Tube Assembly in Zebrafish. Dev. Biol. 1999, 214, 23–37. [Google Scholar] [CrossRef]
- McCulley, D.J.; Kang, J.-O.; Martin, J.F.; Black, B.L. BMP4 Is Required in the Anterior Heart Field and Its Derivatives for Endocardial Cushion Remodeling, Outflow Tract Septation, and Semilunar Valve Development. Dev. Dyn. Off. Publ. Am. Assoc. Anat. 2009, 237, 3200–3209. [Google Scholar] [CrossRef] [PubMed]
- Just, S.; Hirth, S.; Berger, I.M.; Fishman, M.C.; Rottbauer, W. The Mediator Complex Subunit Med10 Regulates Heart Valve Formation in Zebrafish by Controlling Tbx2b-Mediated Has2 Expression and Cardiac Jelly Formation. Biochem. Biophys. Res. Commun. 2016, 477, 581–588. [Google Scholar] [CrossRef] [PubMed]
- Camenisch, T.D.; Spicer, A.P.; Brehm-Gibson, T.; Biesterfeldt, J.; Augustine, M.L.; Calabro, A.; Kubalak, S.; Klewer, S.E.; McDonald, J.A. Disruption of Hyaluronan Synthase-2 Abrogates Normal Cardiac Morphogenesis and Hyaluronan-Mediated Transformation of Epithelium to Mesenchyme. J. Clin. Investig. 2000, 106, 349–360. [Google Scholar] [CrossRef]
Gene | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|
β-actin | TGGACTCTGGTGATGGTGTGAC | GAGGAAGAAGAGGCAGCGGTTC |
myl7 | CCAAGAGGGGGAAAACTGCT | CGGTTCTGATCTATGCAGCCA |
vmhc | CAGTGAGGCGGTGAAAGGAA | TCTGCAGCCCTCTTGTAAGC |
myh6 | GCTCCTTCCTCGGTGTGAAA | TTTTCAGACTCGGCGCTCTT |
bmp4 | AAGATCCACCAGTCGAGCCA | AGTTCGTCCTCTGGGATGCT |
tbx2b | CGGAGATGCCAAAGCGAATG | ACAATATGGAACCTGGGCTGA |
has2 | CCTGGAGGACTGGTATGATC | CACACAATGCTAACACAACCAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, B.; Peng, B.; Jin, Y.; Tao, Y.; Xu, W.; Zhang, Y.; Li, Z. Developmental Toxicity and Cardiotoxicity of N, N-Dimethylaniline in Zebrafish Embryos. Toxics 2025, 13, 125. https://doi.org/10.3390/toxics13020125
Liu B, Peng B, Jin Y, Tao Y, Xu W, Zhang Y, Li Z. Developmental Toxicity and Cardiotoxicity of N, N-Dimethylaniline in Zebrafish Embryos. Toxics. 2025; 13(2):125. https://doi.org/10.3390/toxics13020125
Chicago/Turabian StyleLiu, Bin, Bo Peng, Yan Jin, Yijie Tao, Wenping Xu, Yang Zhang, and Zhong Li. 2025. "Developmental Toxicity and Cardiotoxicity of N, N-Dimethylaniline in Zebrafish Embryos" Toxics 13, no. 2: 125. https://doi.org/10.3390/toxics13020125
APA StyleLiu, B., Peng, B., Jin, Y., Tao, Y., Xu, W., Zhang, Y., & Li, Z. (2025). Developmental Toxicity and Cardiotoxicity of N, N-Dimethylaniline in Zebrafish Embryos. Toxics, 13(2), 125. https://doi.org/10.3390/toxics13020125