Next Article in Journal
Triptolide Causes Spermatogenic Disorders by Inducing Apoptosis in the Mitochondrial Pathway of Mouse Testicular Spermatocytes
Previous Article in Journal
Human Health Risk Assessment of Chlorinated Hydrocarbons in Groundwater Based on Multi-Pathway Analysis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Toxics
Volume 12
Issue 12
10.3390/toxics12120895
toxics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A Mechanism of Reducing Methane Production During Sewage Sludge Composting by Adding Urea

by
Ke Zhang
1,2,
Haopeng Guo
1,
Yujing Liang
1,
Fuyong Liu
1,2,
Guodi Zheng
3,
Jun Zhang
4,
Aihua Gao
5,
Nan Liu
1,2 and
Chuang Ma
1,2,*
1
School of Material and Chemical Engineering, Zhengzhou University of Light Industry, Zhengzhou 450000, China
2
Collaborative Innovation Center of Environmental Pollution Control and Ecological Restoration, Zhengzhou 450000, China
3
Institute of Geographic Sciences and Natural Resources Research, Chinese Academy of Sciences, Beijing 100101, China
4
College of Environmental Science and Engineering, Guilin University of Technology, Guilin 541004, China
5
Zhongyuan Ecological Environment Technology Innovation Center (Henan) Co., Ltd., Zhengzhou 450000, China
*
Author to whom correspondence should be addressed.
Toxics 2024, 12(12), 895; https://doi.org/10.3390/toxics12120895
Submission received: 7 November 2024 / Revised: 29 November 2024 / Accepted: 4 December 2024 / Published: 10 December 2024
(This article belongs to the Section Ecotoxicology)
Browse Figures
Versions Notes

Abstract

The study of the effect of the mechanism of urea addition to sewage sludge and sawdust-composting substrates on methane production is still limited. In the present study, the systematic investigation of the effect of urea addition (0.18, 0.9 and 1.8 kg) on methane production is discussed through the dynamics of physical properties, enzymes, and the microbial community during composting. The results showed that high urea addition (1.8 kg) suppressed methane production, with a lower rate and a shorter duration of warming in the thermophilic phase, but significantly enhanced cellulase activity, urease, and peroxidase, and promoted the degradation of organic carbon, as well as the loss of nitrogen. A high addition of urea stimulated the growth and reproduction of Sinibacillus, Pseudogracilibacillus, Sporosarcina, and Oceanobacillus. The random forest model indicated that the top six independent determinants of CH4 emissions were Methanobacterium, temperature, organic matter (OM), Methanospirillum, and NH4+-N. Furthermore, structural equation modeling displayed that NH4+-N, O2, and pH were the main physicochemical properties affecting CH4 emissions. Methanobacterium, Methanosarcina, and Methanosphaera were the main archaea, and Bacillaceae were the main bacteria affecting CH4 emissions. This study provides new insights and a theoretical basis for optimizing urea addition strategies during composting.

Graphical Abstract

1. Introduction

Globally, more than 1.37 million tons of sewage sludge (SS) are produced annually [1]. This sludge is laden with pollutants, such as heavy metals, pathogenic microorganisms, and exogenous compounds, posing significant risks to public health by contaminating soil, air, and water resources. Composting is an effective method of decomposing OM (e.g., animal manure, food waste, etc.) from sewage sludge into stable end products [2]. However, this process is not without its drawbacks. The composting process generates greenhouse gases (GHGs), notably CH4 and CO2, through aerobic and anaerobic reactions linked to carbon metabolism [3], resulting in secondary pollution and diminishing the environmental advantages of composting [4]. Since the 1850s, the global average surface temperature has risen by 1.09 °C, primarily due to the escalating concentration of GHGs, particularly CO2, CH4, and N2O (Intergovernmental Panel on Climate Change (IPCC), 2021) [5]. Although CH4 accounts for approximately 20% of global warming, it possesses a higher warming potential and exerts a more potent short-time warming effect than CO₂ [6]. During composting, CH4 emission is second only to CO2, with the total carbon (TC) content of the emitted CH4 potentially reaching 2–3% of the TC content in the composted material [7]. Consequently, it is crucial to mitigate the production of CH4 in the composting process to minimize its environmental impact.
Urea is a prevalent additive to modulate the carbon to nitrogen ratio in composting technology [8] by affecting the composting system’s temperature, pH, and other physicochemical properties. The production of CH4 during composting is closely related to the activities of microorganisms, and the addition of urea as a nitrogen source can potentially alter these activities, including those of methanogenic bacteria, subsequently affecting CH4 production. While urea may stimulate CH4 emissions under certain conditions, some studies have indicated that a high concentration of nitrogen fertilizer could suppress the formation and release of CH4 in the soil. This inhibition may be attributed to the fact that, in a nitrogen-rich environment, certain methanogenic competitors, such as Methanosphaera, Bacillaceae and Methanogens, consume hydrogen and OM in the soil, thereby inhibiting the growth and activity of methanogens and reducing CH4 emissions [9]. However, the mechanism of urea on CH4 emissions during compositing is not yet clear.
It has been shown that a variety of physicochemical factors, including temperature, pH, water content, oxygen concentration, and the OM decomposition rate, play a pivotal role in CH4 production and emission during the composting process [10]. Urea, as a nitrogen-rich additive, effectively modulates the carbon to nitrogen balance within the compost, thereby facilitating the breakdown of organic compounds and elevating the compost temperature [11]. Furthermore, the decomposition of urea enriches ammonia-nitrogen into the compost, which in turn alters the pH levels, rendering the environment more alkaline [12]. These shifts can significantly influence the metabolic functions of microorganisms, especially by disrupting the equilibrium between methanogenic and CH4 oxidizing bacteria [13]. Consequently, a comprehensive examination of the impact of urea on the physicochemical properties of compost is crucial for understanding its role in the dynamics of CH4 emission.
Incorporating urea into compost not only refines its physical and chemical attributes but also significantly influences on the enzymatic activities within the compost matrix [14]. The ammonia released from urea decomposition can activate hydrolytic enzymes, which are essential for the breakdown of OM. These enzymes include cellulases and proteases, both playing pivotal roles in this process [15]. This enhancement in enzyme activity accelerates the degradation of organic materials. Moreover, the introduction of urea may modulate the activities of enzymes involved in redox reactions, such as dehydrogenase [16]. This modulation can regulate the compost’s redox environment, subsequently impacting the processes of methanogenesis and CH4 oxidation. Therefore, a detailed examination of how urea modulates enzyme activities is essential for unraveling the underlying mechanisms that govern its influence on CH4 emissions.
CH4 is generated through the anaerobic metabolic activities of archaeal community during the composting process [17]. CH4-producing archaea, known as methanogens, play a pivotal role in achieving efficient and balanced waste decomposition [7]. Both bacteria and the archaeal community are integral functional communities within composting [18]. However, the majority of previous research has concentrated on the dynamics of bacterial communities, often overlooking the archaeal communities. Tracking the shifts in both bacterial and archaeal community structures can yield a wealth of information on microbial succession throughout the composting process. The composition of the microbiota during composting is influenced by the combination of raw materials used, yet our understanding of how these materials impact the diversity and ecosystem functioning of various bacterial populations remains limited.
Environmental factors, including the C/N ratio, OM content, and temperature, are essential for successful composting [19]. However, the impact of different urea ratios on CH4 production and archaeal community dynamics during sewage sludge (SS) composting has not been systematically studied. In the present study, we conducted composting of SS and sawdust (m/m) with varying amounts of urea, ensuring that microorganisms had access to a consistent carbon source but varying nitrogen sources. The aims of this study were (1) to investigate the effect of different levels of urea addition on CH4 emissions during SS composting, (2) to examine how these additions affect the bacterial and archaeal communities during composting, and (3) to elucidate the mechanism by which urea reduces CH4 production during sewage sludge composting. This study provides novel insights into strategies for mitigating CH4 emissions.

2. Materials and Methods

2.1. Compost Materials and Environmental Design

Dewatered sewage sludge was collected from the Wulongkou municipal wastewater treatment plant (WWTP) (Zhengzhou, China). The sawdust was composed of pine wood particles (1–2 mm). The sewage sludge and sawdust were homogenized to obtain a ratio of 3:1 (w/w, fresh weight). Piles A, B, and C were supplemented with urea at dosages of 0.18, 0.9, and 1.8 kg, respectively. The total weight of each pile was approximately 130 kg. The initial physicochemical properties of the raw materials and each pile are shown in Table 1.

2.2. Composting System and Sampling

Composting was conducted in three separate but identical piles for 30 days. Each pile had a height of 120 cm, an inner diameter of 60 cm, and an effective volume of 280 L. The piles were made from polyethylene and covered with a 3 cm thick rubber board for thermal insulation. A removable lid with a small hole (2 cm in diameter) was placed on the top and uniformly distributed holes (1 cm in diameter) were installed at the bottom of each pile. The open space at the bottom of each pile was 40%, and leachates were not generated. A ventilator was installed at the bottom of each pile and aeration was provided at 0.5 L·min−1·kg−1 (0–2 d) and 1.87 L·min−1·kg−1 (on a dry weight basis, 3–10 d). During the composting process, aeration and aeration intervals can control microbial activity, promote decomposition of OM, avoid accumulation of harmful substances, improve composting efficiency and quality, and reduce energy consumption [20]. The ventilator was run for 3 min and then stopped for the next 17 min. Temperature sensors were incorporated into a metal bar, which was positioned at vertical intervals of 20 cm, 40 cm, and 60 cm along its length. Moreover, a suction pump was fitted in each pile at a height of 50 cm and connected to a shunt device to divide the air into two portions: one portion was directed to an oxygen sensor [21] and the other portion was directed to a storage gas bag. Using a pump, about 1 L of the air collected in the storage gas bag, after having repeatedly been reversed and mixed thoroughly, was transferred to an aluminum foil gas bag for the determination of CH4 concentrations [22]. O2 and CH4 were measured for 20 min, which was the period of one ventilation cycle.
Compost was sampled on 1, 3, 10, 20, and 30 days after installation. Three samples of approximately 500 g were collected from each pile at a depth of 50 cm on each sampling day and divided into two subsamples. One set of subsamples was used to determine physicochemical properties and enzymatic activities, the other set was homogenized and refrigerated at −80 °C for subsequent DNA analysis.

2.3. Measuring of Samples

The moisture content of the raw materials and composting mixtures was ascertained by subjecting the samples to a drying regimen at 105 °C for a period of 24 h within an oven [23]. The OM content was determined by assessing the mass loss of each airdried sample upon combustion in a muffle furnace at 550 °C for 24 h [24]. A 1:5 (w/v) mixture of the wet sample and water was shaken for 30 min to allow for equilibration, after which the pH was determined using an E-201-C combination pH meter (Lei-ci, Shanghai, China). The NH4+-N content was colorimetrically determined using the KCl extraction indigo phenol blue method. The CH4 concentration within the air enclosed in the aluminum foil bag was measured using gas chromatography (TianMei 7900, Shanghai, China) [25]. The total organic carbon (TOC) was oxidized by 0.8 (1/6) mol L−1 potassium dichromate (K2Cr2O7) with external heating [26]. The total nitrogen(TN) in the compost samples were detected by a Vario EL elemental analyzer (Elemental Vario MICRO, Hanau, Germany). Brassica chinensis was used for the germination index (GI), and the procedures and calculation method have been provided in a previous study [26].

2.4. Enzymatic Activity Assays

The activities of five extracellular enzymes (cellulase, urease, protease, arylsulphatase, and peroxidase) were determined at each sampling time. Cellulase, urease and protease enzyme activities were determined using the methods described by Tabatabai et al. [27]. Cellulase activity was determined colorimetrically using 3,5-dinitrosalicylic acid, while the activity of urease was determined using colorimetry of indophenol blue. Protease activity was activity was measured colorimetrically using ninhydrin. The activities of arylsulphatase (ARS) and peroxidase (POD) were monitored by a Thermo Scientific Multiskan (FC, Thermo Fisher Scientific, Waltham, MA, USA) according to methods detailed by Galgani [28].

2.5. DNA Analysis

To identify the bacterial and archaeal diversity during the composting process, the microbial DNA of each pile on days 1, 3, 10, 20, and 30 were extracted using a FastDNA® SPIN Kit for soil (MP Bio, Santa Ana, CA, USA) according to the manufacturer’s protocol. DNA concentration and purity were determined with a nanodrop 2000 ultraviolet-visible spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The V3-V4 hypervariable regions of the bacterial 16S rRNA gene were amplified with the primers 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT). The V4–V5 hypervariable regions of the archaeal gene were amplified with the primers 524F10extF (5′-TGYCAGCCGCCGCGGTAA-3′) and Arch958RmodR (5′-YCCGGCGTTGAVTCCAATT-3′) [29], using the thermocycler PCR system (GeneAmp 9700, ABI, Los Angeles, CA, USA). The PCR reactions were conducted as follows: denaturation for 3 min at 95 °C, 27 cycles of 30 s at 95 °C, annealing for 30 s at 55 °C, elongation for 45 s at 72 °C, and extension for 10 min at 72 °C. PCR reactions were performed in triplicate using a 20 μL mixture of 4 μL 5 × FastPfu Buffer, 2 μL of 2.5 mM dNTPs, 0.8 μL of each primer (5 μM), 0.4 μL of FastPfu Polymerase, and 10 ng template DNA. The PCR amplicons were isolated from a 2% agarose gel and subsequently subjected to purification utilizing the AxyPrep DNA Gel Extraction Kit from Axygen Biosciences, Union City, CA, USA, and their concentrations were determined employing QuantiFluor™-ST (Promega, Madison, WI, USA), strictly adhering to the manufacturer’s prescribed protocol.

2.6. Statistical Analysis

The data are presented as mean values with standard deviations. Figures were generated using OriginPro (Version 9.4). The least significant differences among the mean values during composting were calculated at a probability level of p < 0.05 using the SPSS software (Version 24.0). Spearman correlation analysis via R (pheatmap package) software was used to analyze enzymatic activity and bacterial genera. The random forest model (RF) and structural variance model (SEM) were analyzed by the R package lavaan to verify the direct and indirect effects of the studied variables on the rate of CH4 production. We used a non-significant chi-square test (p > 0.05) a high goodness-of-fit index (GFI > 0.90), and low root mean square errors of approximation (RMSEA < 0.05) to show a good fit for SEMs.

3. Results and Discussion

3.1. Changes in Physicochemical Properties During Composting

3.1.1. Temperature

Temperature is an important indicator during the composting process, reflecting the degradation of organic material and the efficiency of composting [23,30]. The three piles underwent the three classic temperature-defined composting phases, mesophilic, thermophilic, and cooling phases, as depicted in Figure 1a. The peak temperature occurred on day 3 for pile A and on day 5 for piles B and C. Piles A and B maintained a high-temperature period of at least 55 °C for six days, whereas pile C only sustained this temperature for five days. It can be inferred that, compared to pile A, the addition of 0.9 kg (pile B) and 1.8 kg (pile C) of urea seemed to suppress the compost’s heating rate, with pile C also exhibiting a shorter duration of the thermophilic phase relative to piles A and B. These observations align with the findings of Sun et al. [31], which suggests that urea addition can suppress the average temperature increase rates and the maximum temperature achieved. Furthermore, the extended periods of high temperature in piles A and B are likely sufficient to ensure the complete destruction of pathogens, thereby meeting the requirement for harmlessness [32].

3.1.2. Change in pH, OM, O2 and CH4

The pH is a critical factor influencing microbial activity during the composting processes [33]. The pH values for all piles exhibited a consistent trend (Figure 1b), with a slight decrease from 8.3–8.95 to 8.11–8.85 over the first ten days. This initial decline is mainly attributed to the production of alkaline ammonia, which subsequently caused the pH to rise to 9–9.12, maintaining alkaline levels by day 30 [34]. Notably, the pH of pile C was significantly higher than that of pile B, and pile B’s pH was considerably higher than pile A (p < 0.05). The low pH of pile A is possibly due to the lower concentration of urea compared to the other piles. The degradation of urea likely produced NH4+ ions [35], resulting in a more alkaline environment.
OM is an important energy source for microbes [36]. The OM content of the three piles changed similarly (Figure 1c) and decreased throughout the composting process, which is in line with the findings of Zhao et al. [34]. The initial OM content of the three piles (80%) was significantly higher than the final OM content (72%). By the end of the composting period, OM decreased by 8.80%, 9.10%, and 9.82% for each treatment, respectively. This uniform degradation of OM suggests that the three piles, containing equal amounts of SS and sawdust, were not significantly affected by the addition on OM content. The OM degradation rate was highest during the first three days, possibly because microorganisms initially targeted easily degradable OM, followed by more recalcitrant components like cellulose and lignin [37]. These observations indicate that the addition of urea promoted the degradation of OM in the compost, with the most significant degradation occurring at the 1.8 kg urea addition level (pile C).
Oxygen concentration(OC) is a limiting factor on microbial metabolism during SS composting [38] because parts of the compost matrix are anaerobic, specifically in the large compost particles [4]. The change of OC across the three treatments was similar (Figure 1d). On day 1, pile C exhibited a significantly higher OC than piles B and A (p < 0.05), with piles A and B reaching their lowest OC levels of 4.0% and 4.5%, respectively. This is likely due to the substantial O2 consumption by microorganisms during the initial stages of OM degradation [21]. On day 3, pile C’s OC dropped to its lowest point of 5.0%, remaining significantly higher than that of piles B and A (p < 0.05) from day 5 onwards. After the fourth day, the O2 concentration of the three piles began to rise, reaching peak levels of 16.0%, 17.0%, and 17.0% day 10, respectively. The decrease in microbial activity due to lower temperatures and reduced OM led to a natural slowdown in decomposition, marking the transition to the compost maturation phase [39], indicating a significant improvement in anaerobic conditions and the predominance of aerobic conditions.
CH4 is primarily produced under anaerobic conditions [40]. The rapid decomposition of easily degradable OM in the early stages of composting leads to a swift decline in pile O2 concentration (Figure 1e) [41], causing a sharp initial increase in CH4 emissions from all treatments, followed by a gradual decrease (Figure 1e). The CH4 emissions from each pile were mainly produced during the mesophilic phase and the early stage of the thermophilic phase [42]. Between day 1 and day 3, the CH4 emissions of all treatments were in the order of pile A > pile B > pile C. This could be attributed to pile A having a higher temperature (Figure 1a) and microbial activity, leading to an insufficiency of O2 (Figure 1e). The low CH4 emissions in pile C could be due to the inhibition effect of high ammonia levels, generated by the hydrolysis of urea, which can inhibit the growth of methanogenic bacteria [43]. The CH4 emissions from each pile increased with rising composting temperature and decreasing in O2 content in the compost, peaking between days 3 and 4. As composting continued, the size of anaerobic zones within the pile gradually decreased, resulting in reduced CH4 production [21]. Our results indicate that the addition of 1.8 kg of urea suppressed CH4 emissions during the composting process compared to 0.18 kg and 0.9 kg, which is consistent with previous research [6].

3.1.3. Changes in TN, NH4+-N, TOC Contents and C/N

In the sludge composting process, nitrogen loss in the form of ammonia constitutes a significant proportion of the TN of the raw material [30]. The TN content in piles A and B first decreased and then increased, but the TN content in pile C showed a gradual decline, consistently remaining higher than that in piles A and B (Figure 2a). During the mesophilic phase, the decomposition of urea led to the production and release of substantial amounts of NH3, resulting in a decrease in the TN content [30]. Throughout the composting process, the difference in TN content among the three piles gradually diminished, persisting until the end of composting. Denitrification may be the main cause of nitrogen loss during the composting process [31]. After the twentieth day, there was no significant difference in TN content among the three piles.
NH4+-N is the main source of inorganic nitrogen for microbial utilization during composting [44]. The NH4+-N contents of all three piles continually increased throughout the composting process (Figure 2b), starting at the lowest (0.3, 0.37, and 0.41 mg/g, respectively) on day 1 and peaking (1.68, 1.70, and 1.69 mg/g, respectively) on day 30. During the first 20 days, piles B and C had significantly higher NH4+-N contents than pile A (p < 0.05), but at later stages of composting, the NH4+-N contents of the three piles did not differ significantly. This may be due to the substantial addition of urea in pile B and pile C [44]. The degradation of urea, uric acid, and proteins during composting likely caused the increased NH4+-N contents. These results differ from those of previous studies, in which the NH4+-N content decreased during composting [18], possibly due to the urea addition in this experiment, which led to an increase in NH4+-N content. These results are similar to those of Ren et al. [45], who observed an increase in NH4+-N content during composting, reaching a maximum at the end of the process. This could be attributed to increased ammonification and inhibited nitrification at higher temperatures [44].
TOC and TN are the main chemical parameters used to evaluate the potential of a successful composting process [46]. Mature compost usually has a low and stable C/N ratio, typically between 10 and 20. The TOC in the three piles generally declined during the whole composting process, with no significant difference among the three piles on day 3 (Figure 2c). From the tenth day onwards, the difference in TOC content among the three piles gradually increased. From the tenth day to the end of composting, the TOC content in pile A was significantly higher than that in piles B and C. This indicates that the degradation of OM mainly occurs in the thermophilic phase (Figure 1c) and that a relatively high amount of urea added (0.9 kg and 1.8 kg) is more conducive to the microbial degradation of organic carbon [46]. This relationship may be due to the relative insufficiency of nitrogen sources when urea is added at low levels (0.18 kg), which limits microbial activity.
The C/N ratio, a result of changes in TC and TN during composting, is one of the most important parameters in composting. During the composting process, the C/N ratio in piles A and B showed a decreasing trend (Figure 2d), this is agreement with the results of Zhang et al. [44]. In contrast, the C/N ratio of pile C showed a trend of increasing first and then decreasing. The C/N ratio in pile A was always higher than the C/N ratio in pile B, and the C/N ratio in pile B was always higher than the C/N ratio in pile C. At the end of composting, C/N ratio in pile C was lower than that in pile A and pile B, indicating that highly spiked urea supply may be beneficial for changes in organic components [44].

3.1.4. Changes in GI

The seed GI is a crucial parameters for assessing the toxicity of compost products to plants and for evaluating the quality of the compost [26]. A higher GI value indicates lower toxicity to plants and superior product quality [26]. Prior to composting, the GI values for piles A, B, and C were 32.15%, 28.46%, and 17.32%, respectively (Figure 1f). After composting, these values increased to 74.63%, 78.35%, and 76.42% for piles A, B, and C, respectively. The GI indexes after composting were significantly higher than the GI indexes before composting. The increase in GI during composting process is likely due to the reduction in concentrations of NH4+-N, volatile fatty acids (VFAs), and other phytotoxic substance in the compost samples, thereby reducing their toxic effect [31]. Consequently, the addition of urea had no significant effect on the maturity of the final compost product.

3.2. Changes in Enzymatic Activities

3.2.1. Cellulase Activity

Cellulase activity, which gradually increased with composting time, had a similar trend among the piles (Figure 3a). The highest cellulase activity, at 33.33, 27.78, and 36.52 (mg glucose g−1·72 h−1) for piles A, B, and C, respectively, was observed on day 30. Similar trends were also observed by Tiquia [23]. Cellulase activities are pivotal bioindicators of cellulose degradation, typically augmenting during the maturation phase of composting as the more readily degradable organic matter has been predominantly metabolized by microbes in the initial stages of the composting process [10]. In pile C, the cellulase activities were significantly higher than those in piles A and B, except on day 10 (p < 0.05). The possible reason for this is that a higher urea addition is beneficial to the growth of cellulolytic microorganisms, which may stimulate the release of cellulase for the degradation of cellulose to glucose, which serves as a carbon source for other microorganisms [47]. Therefore, higher urea addition (1.8 kg) conditions stimulate cellulase production, and are more conducive to cellulose degradation.

3.2.2. Protease Activity

Protease activity exhibited a general downward trend during the whole composting process, and there was no significant difference among the three piles (Figure 3b). The highest protease activity, at 1.28, 1.21, and 1.29 (mg tyrosine g−1·24 h−1), in piles A, B, and C, respectively, was observed on day 3. On day 30, the protease activity decreased to a minimum of 0.47, 0.57, and 0.589 (mg tyrosine g−1·24 h−1) in piles A, B, and C, respectively. The gradual decline in protease activity during composting might be related to the bioavailability of proteins in the initial composting materials. Specifically, easily degradable OM, such as carbohydrates and proteins, is metabolized by microorganisms in the early stage of composting. Thus, microorganisms secrete more protease at this time. Then, protease activity wanes as proteins are increasingly consumed, culminating in the lowest levels at the conclusion of the composting period. However, the increased addition of urea did not exert a significant influence on the dynamics of protease activity during the sewage sludge composting process.

3.2.3. Urease Activity

Urease is involved in the hydrolysis of urea to ammonium and carbon dioxide [46]. The urease activity in piles gradually increased with composting time, reaching its highest levels, 1.9581, 2.4507, and 3.1956 (mg NH4+-N g−1·24 h−1) in piles A, B, and C, respectively, on day 30 (Figure 3c). The urease activity in pile C was significantly higher than that in piles A and B during the whole composting process (p < 0.05). This suggests that a high addition of urea (1.8 kg) fostered an increase in microbial metabolism that was resilient to elevated temperatures, accelerated the mineralization and decomposition rate of nitrogen-containing OM, and consequently heightened urease activity [10]. It has been suggested that higher urea addition leads to higher ammonia production [43], which was confirmed by the production of urease in the present study. The results indicated that higher urea addition (1.8 kg) could not only enhance composting efficiency, but also increase urease activity, which might promote the production of ammonia gas during the thermophilic phase of composting [45]. As a result, balancing compositing efficiency and odor production is challenging, and needs further study in terms of regulating the urea addition to achieve high compost quality [43].

3.2.4. Arylsulphatase Activity

Arylsulfatase (ARS) catalyzes the detachment of sulfate groups from organic compounds, and its enzymatic activity is correlated with the formation of humus [48]. ARS activity had similar trends among the piles (Figure 3d); it gradually increased from day 3 to 20 and then began to decrease. The urea addition had no significant effect on the activity of ARS. The activity of ARS in pile C was relatively higher than those in piles A and B from days 10 to 20, and the activity of ARS in pile A was relatively lower than those in piles B and C on day 10. The results indicated that a higher urea addition (1.8 kg) stimulated ARS activity, which in turn increased H2S production during the anaerobic mesophilic phase of the composting process [49]. Therefore, it is necessary to supply oxygen in the initial stage of composting [49], especially under higher urea addition (1.8 kg) conditions.

3.2.5. Peroxidase Activity

Peroxidase (POD) is the most extensively researched extracellular enzyme associated with white-rot fungi and can oxidize lignin polymers [30]. The change trend of POD activity was similar among the three treatments during the whole composting process (Figure 3e), with two peaks on days 5 and 20, but the POD activity under a high urea addition was generally higher than that under a low urea addition, especially on days 20 to 30, when the differences among the piles were significant (p < 0.05). The variation in POD activity indicated that a higher urea addition was more conducive to POD secretion, and promoted the degradation of OM in compost because POD for lignin degradation is usually produced by fungi and is active during the cooling and maturing period of compost [23].

3.3. Evolution of Bacterial and Archaeal Communities

Effects of Different Initial Urea Additions on the Bacterial and Archaeal Community Structure

The coverage index (>0.99) of the three piles indicated that most of the microorganisms had been detected in the samples [50]. Variations in initial urea additions resulted in distinct physicochemical conditions and bacterial growth environments [19], which in turn affected the diversity of bacteria and archaea within the different treatments. As shown in Figure 4a, Candidatus_Competibacter and norank_1–2others dominated the compost mixture on day 1. During the thermophilic phase, Bacillus showed a continuous increasing trend, from 2.2%, 8.6%, and 1.8% on day 3 to 27.7%, 37.2%, and 30.9% on day 20 in piles A, B, and C, respectively. On day 30, the proportion of Bacillus in piles A and C decreased to 16.3% and 8.2%, respectively, while it continued to rise to the maximum level of 59.7% in pile B. Bacillus was the dominant bacteria in the thermophilic phase and in the cooling phase for all three piles, especially pile B. Ureibacillus reached a maximum level of 46.4% on day 3 in pile A and then gradually decreased to 7.1% on day 30. This result indicated that Ureibacillus dominated the bacterial community during the thermophilic phase in pile A, suggesting that the conditions in pile A were conducive to the proliferation of Ureibacillus. In pile C, the proportion of Sinibacillus increased from 4.9% on day 3 to 14.6% on day 10, and then decreased to 3.9% on day 30. Sinibacillus was one of the dominant genera in the thermophilic phase of pile C, suggesting that high urea addition (pile C) was beneficial to the growth and reproduction of Sinibacillus. Similarly, high urea addition (pile C) was also beneficial to the growth of Pseudogracilibacillus, Sporosarcina, and Oceanobacillus. As thermotolerant members of the Bacillaceae family, Sinibacillus species have demonstrated a robust resistance to radiation, chemicals, heat, and drought, endowing them with the versatility required to thrive in a range of harsh environmental conditions [10].
As shown in Figure 4b, throughout the composting process, the archaeal communities in the three piles were dominated by (in decreasing order) Methanobrevibacter (20.3–58% of archaea), Methanosaeta (4–54.5%), Methanobacterium (7–26%), and unclassified_k_norank (1.3–14%). The Methanobacterium and Methanobrevibacter populations increased during composting, while the Methanosaeta population decreased. The trends for Methanobrevibacter and Methanosaeta populations were similar in all three piles. Methanobrevibacter was the dominant archaea on the first composting day (contributing 30, 33, and 48% of the archaea in piles A, B, and C, respectively). The contributions of Methanobrevibacter decreased up to day 3 of the composting process (to 20, 25.7, and 41.5% in piles A, B, and C, respectively), and then increased and reached a maximum on day 30 (55.8, 52.9, and 58% in piles A, B, and C, respectively). Methanobrevibacter, which is intricately associated with CH4 production, was consequently the predominant archaea throughout the composting process, while the higher urea addition had increased relative abundance of Methanobrevibacter.
The contributions of Methanosaeta to the archaeal community first increased and then decreased in all three piles, and were 44.7, 43.8, and 13.8% in piles A, B, and C on the first day, respectively; 54.4, 45.7, and 30% on day 3, and reached a minimum of 4, 4.7, and 12.5% on day 30. Methanosaeta was the dominant archaea during the thermophilic phase and likely the main source of CH4 because emissions mainly occurred during this phase (Yuan et al., 2016). This was also the case during the mesophilic phase. However, a high urea addition decreased the proportion of Methanosaeta. The Methanobacterium population in all three piles followed a similar trend to that of the Methanobrevibacter population. The contributions of Methanobacterium to the archaea in piles A, B, and C were 7.3, 8, and 11.4%, respectively, on day one; 7, 7.4, and 10.5% on day 3; and 14.6, 26.2, and 14.3% on day 30. This contribution increased markedly during the late thermophilic phase and the cooling phase, indicating that Methanobacterium was the dominant archaea in the late composting period and was not strongly affected by the initial urea additions. The contribution of unclassified_k_norank was markedly higher for pile A than for piles B and C during the intermediate and later phases of the thermophilic phase and the cooling phase, indicating that a low urea addition increased the proportion of unclassified_k_norank.
The impact of varying initial urea additions on CH4 production during sludge composting was investigated. Cellulase and arylsulfatase were the main enzymes affecting the composting process, and both were negatively correlated with CH4. The inhibition of CH4 emission by high urea addition was mainly achieved by changing the relative abundance of dominant bacteria and dominant archaea, which altered the activities of the main functional enzymes. NH4+-N, O2, pH was the main physicochemical property affecting CH4 emission, Methanobacterium, Methanosarcina, and Methanosphaera were the main archaea affecting CH4 emissions, and Bacillaceae were the main archaebacteria affecting CH4 emissions. We conclude that urea supplementation at a dose of 1.8 kg (pile C) is effective in reducing CH4 emissions.

3.4. Effects of Physicochemical Properties, Enzymes, and Microbial on CH4

From Figure 5, the random forest (RF) model quantified the combined effects of physicochemical properties, enzymes, and microorganisms on CH4 emissions. The top six independent determinants of CH4 emissions were Methanobacterium, temperature, OM, Methanospirillum, and NH4+-N. Among the explanatory variables, the main physicochemical property determinants of CH4 emissions were temperature, OM, NH4+-N, and O2, and the main enzymes determining CH4 emissions were cellulase and arylsulphatase. The main archaea determining CH4 emissions were Methanobacterium, Methanosarcina, and Methanosphaera, and the main bacteria determining CH4 emissions were Bacillaceae.
It can be seen from Figure 6 that cellulase is the main enzyme that affects the composting process [51]. Figure 6 shows that cellulase is positively correlated with O2, OM, and NH4+-N, but negatively correlated with CH4, temperature, and Bacillaceae. Cellulase breaks down carbohydrate polymers to release nutrients from organic compounds and is an enzyme that plays an important role in the carbon conversion cycle, with hydrolyzed products including glucose [7]. Given that the concentration of NH4+-N exhibits a strong positive correlation with the presence of cellulose (p > 0.05), the relationship between cellulase and dominant bacteria was changed by the high level of EPI (pile C: 1.8 kg).
From Figure 6, it can be seen that temperature, O2, and NH4+-N were significantly negatively correlated with Methanosphaera (p < 0.05), while Methanosphaera was significantly negatively correlated with CH4 (p < 0.05) and temperature was significantly positively correlated with Methanosarcina (p < 0.05). These correlations indicated that temperature, O2 and NH4+-N had a negative effect on Methanosphaera, temperature had a negative effect on Methanosarcina, and Methanosphaera had a negative effect on CH4 production. The archaeal community structure was similar in pile A and pile B during the neutrophilic (day 1), thermophilic (day 3), and maturation (day 30) phases of composting, and significantly different from pile C. NH4+-N, O2 and CH4 were the main physicochemical properties affecting the community structure of compost bacteria and archaea. Yang et al. [16] found that adding urea to compost materials resulted in lower CH4 emissions and significant N2O losses. Szanto et al. [4] suggested that composting reduces CH4 production by altering the physicochemical properties of compost.

4. Conclusions

The effect of different initial urea additions on CH4 production during sludge composting was investigated. Cellulase and arylsulfatase were the main enzymes affecting the composting process, and both were negatively correlated with CH4. The inhibition of CH4 emission by a high urea addition was mainly achieved by changing the relative abundance of dominant bacteria and dominant archaea, which altered the activities of the main functional enzymes. NH4+-N, O2 and temperature were the main physicochemical properties affecting CH4 emission; Methanobacterium, Methanosarcina, and Methanosphaera were the main archaea affecting CH4 emissions; and Bacillaceae were the main archaebacteria affecting CH4 emissions. We conclude that urea supplementation at a dose of 1.8 kg (pile C) is effective in reducing CH4 emissions. The findings of this study evaluated the potential effectiveness of urea in suppressing CH4 emissions throughout the composting process. This research presents a pioneering strategy for mitigating CH4 emissions during composting, and sheds new light on the influence of urea on microbial activities and the composting process as a whole.

Author Contributions

Conceptualization, C.M.; data curation, K.Z. and H.G.; formal analysis, H.G. and Y.L.; funding acquisition, K.Z. and C.M.; methodology, K.Z., H.G., A.G. and N.L.; software, H.G., Y.L. and F.L.; supervision, C.M.; validation, G.Z. and J.Z.; writing—original draft, H.G.; writing—review and editing, K.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (42277413), the Henan Province Science and Technology Key Project (242102320115; 242102320118), the Key Research Programs of Universities in Henan Province (25A610010), and the Postgraduate Education Reform and Quality Improvement Project of Henan Province (YJS2025XQLH13).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors upon request.

Conflicts of Interest

The authors declare no conflicts of interest. Author Aihua Gao was employed by the company Zhongyuan Ecological Environment Technology Innovation Center (Henan) Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Meng, F.; Zhao, Q.; Zheng, Z.; Wei, L.; Wang, K.; Jiang, J.; Ding, J.; Na, X. Simultaneous sludge degradation, desalination and bioelectricity generation in two-phase microbial desalination cells. Chem. Eng. J. 2019, 361, 180–188. [Google Scholar] [CrossRef]
  2. Jara-Samaniego, J.; Pérez-Murcia, M.; Bustamante, M.; Pérez-Espinosa, A.; Paredes, C.; López, M.; López-Lluch, D.; Gavilanes-Terán, I.; Moral, R. Composting as sustainable strategy for municipal solid waste management in the Chimborazo Region, Ecuador: Suitability of the obtained composts for seedling production. J. Clean. Prod. 2017, 141, 1349–1358. [Google Scholar] [CrossRef]
  3. He, X.; Yin, H.; Han, L.; Cui, R.; Fang, C.; Huang, G. Effects of biochar size and type on gaseous emissions during pig manure/wheat straw aerobic composting: Insights into multivariate-microscale characterization and microbial mechanism. Bioresour. Technol. 2019, 271, 375–382. [Google Scholar] [CrossRef] [PubMed]
  4. Szanto, G.; Hamelers, H.; Rulkens, W.; Veeken, A. NH3, N2O and CH4 emissions during passively aerated composting of straw-rich pig manure. Bioresour. Technol. 2007, 98, 2659–2670. [Google Scholar] [CrossRef] [PubMed]
  5. Masson-Delmotte, V.; Zhai, P.; Pirani, A.; Connors, S.L.; Péan, C.; Berger, S.; Caud, N.; Chen, Y.; Goldfarb, L.; Gomis, M. Climate Change 2021: The Physical Science Basis. Contribution of Working Group I to the Sixth Assessment Report of the Intergovernmental Panel on Climate Change; IPCC Sixth Assessment Report; IPCC: Geneva, Switzerland, 2021; Volume 2, p. 2391. [Google Scholar]
  6. Solomon, S. Climate Change 2007—The Physical Science Basis: Working Group I Contribution to the Fourth Assessment Report of the IPCC; Cambridge University Press: Cambridge, UK, 2007; Volume 4. [Google Scholar]
  7. Ge, J.; Huang, G.; Huang, J.; Zeng, J.; Han, L. Particle-scale modeling of methane emission during pig manure/wheat straw aerobic composting. Environ. Sci. Technol. 2016, 50, 4374–4383. [Google Scholar] [CrossRef]
  8. Trinh, M.V.; Tesfai, M.; Borrell, A.; Nagothu, U.S.; Bui, T.P.L.; Quynh, V.D.; Thanh, L.Q. Effect of organic, inorganic and slow-release urea fertilisers on CH4 and N2O emissions from rice paddy fields. Paddy Water Environ. 2017, 15, 317–330. [Google Scholar] [CrossRef]
  9. Zuo, Z.; Xing, Y.; Liu, T.; Zheng, M.; Lu, X.; Chen, Y.; Jiang, G.; Liang, P.; Huang, X.; Liu, Y. Methane mitigation via the nitrite-DAMO process induced by nitrate dosing in sewers. Water Res. 2024, 257, 121701. [Google Scholar] [CrossRef]
  10. Li, C.; Li, H.; Yao, T.; Su, M.; Li, J.; Liu, Z.; Xin, Y.; Wang, L.; Chen, J.; Gun, S. Effects of microbial inoculation on enzyme activity, available nitrogen content, and bacterial succession during pig manure composting. Bioresour. Technol. 2020, 306, 123167. [Google Scholar] [CrossRef]
  11. Zhao, B.; Wang, Y.; Ma, L.; Li, Y.; Deng, Y.; Chen, X.; Xu, Z. Adding an appropriate proportion of phosphogypsum ensured rice husk and urea composting to promote the compost as substrate utilization. Bioresour. Technol. 2022, 344, 126301. [Google Scholar] [CrossRef]
  12. Van Fan, Y.; Lee, C.T.; Klemeš, J.J.; Chua, L.S.; Sarmidi, M.R.; Leow, C.W. Evaluation of Effective Microorganisms on home scale organic waste composting. J. Environ. Manag. 2018, 216, 41–48. [Google Scholar] [CrossRef]
  13. Nelson, V.; Crowe, T.; Shah, M.; Watson, L. Temperature and turning energy of composting feedlot manure at different moisture contents in southern Alberta. Can. Biosyst. Eng. 2006, 48, 6. [Google Scholar]
  14. Bao, J.; Li, S.; Qv, M.; Wang, W.; Wu, Q.; Nugroho, Y.K.; Huang, L.; Zhu, L. Urea addition as an enhanced strategy for degradation of petroleum contaminants during co-composting of straw and pig manure: Evidences from microbial community and enzyme activity evaluation. Bioresour. Technol. 2024, 393, 130135. [Google Scholar] [CrossRef] [PubMed]
  15. Aweke, Y.K.; Tasisa, B.Y.; Garoma, W.D.; Denbi, W.B. Extraction and characterization of cellulase from forest and compost soil fungal isolates for the application of straw degradation. Int. J. Health Sci. 2022, 6, 7146–7162. [Google Scholar] [CrossRef]
  16. Yang, C.; Feng, M.; Song, L.; Jing, B.; Xie, Y.; Wang, C.; Qin, M.; Yang, W.; Xiao, L.; Sun, J. Hyperspectral monitoring of soil urease activity under different water regulation. Plant Soil 2022, 477, 779–792. [Google Scholar] [CrossRef]
  17. Benckiser, G.; Schartel, T.; Weiske, A. Control of NO3− and N2O emissions in agroecosystems: A review. Agron. Sustain. Dev. 2015, 35, 1059–1074. [Google Scholar] [CrossRef]
  18. Huang, Y.; Li, D.; Wang, L.; Yong, C.; Sun, E.; Jin, H.; Huang, H. Decreased enzyme activities, ammonification rate and ammonifiers contribute to higher nitrogen retention in hyperthermophilic pretreatment composting. Bioresour. Technol. 2019, 272, 521–528. [Google Scholar] [CrossRef]
  19. Şevik, F.; Tosun, İ.; Ekinci, K. The effect of FAS and C/N ratios on co-composting of sewage sludge, dairy manure and tomato stalks. Waste Manag. 2018, 80, 450–456. [Google Scholar] [CrossRef]
  20. Xie, T.; Zhang, Z.; Yu, Y.; Tian, Y.; Wang, F.; Li, D.; Nan, J.; Feng, Y. Aeration intensity drives dissolved organic matter transformation and humification during composting by regulating the organics metabolic functions of microbiome. Chem. Eng. J. 2023, 476, 146645. [Google Scholar] [CrossRef]
  21. Zhou, H.-B.; Ma, C.; Gao, D.; Chen, T.-B.; Zheng, G.-D.; Chen, J.; Pan, T.-H. Application of a recyclable plastic bulking agent for sewage sludge composting. Bioresour. Technol. 2014, 152, 329–336. [Google Scholar] [CrossRef]
  22. Wang, J.; Du, X.; Zhang, Y.; Li, T.; Liao, X. Effect of substrate on identification of microbial communities in poultry carcass composting and microorganisms associated with poultry carcass decomposition. J. Agric. Food Chem. 2016, 64, 6838–6847. [Google Scholar] [CrossRef]
  23. Tiquia, S.; Tam, N. Composting of spent pig litter in turned and forced-aerated piles. Environ. Pollut. 1998, 99, 329–337. [Google Scholar] [CrossRef] [PubMed]
  24. Awasthi, M.K.; Pandey, A.K.; Bundela, P.S.; Khan, J. Co-composting of organic fraction of municipal solid waste mixed with different bulking waste: Characterization of physicochemical parameters and microbial enzymatic dynamic. Bioresour. Technol. 2015, 182, 200–207. [Google Scholar] [CrossRef] [PubMed]
  25. Huang, R.; Tian, D.; Liu, J.; Lv, S.; He, X.; Gao, M. Responses of soil carbon pool and soil aggregates associated organic carbon to straw and straw-derived biochar addition in a dryland cropping mesocosm system. Agric. Ecosyst. Environ. 2018, 265, 576–586. [Google Scholar] [CrossRef]
  26. Ouyang, J.-X.; Shi, Z.; Zhong, H.; Liu, W.; Chai, Q.; Yuan, X.-Z. Static aerobic composting of municipal sewage sludge with forced ventilation: Using matured compost as bulking conditioner. J. Cent. South Univ. 2014, 21, 303–309. [Google Scholar] [CrossRef]
  27. Tabatabai, M. Soil Enzymes. Methods of Soil Analysis: Part 2 Microbiological and Biochemical Properties; John Wiley & Sons: Hoboken, NJ, USA, 1994; Volume 5, pp. 775–833. [Google Scholar]
  28. Galgani, F.; Bocquene, G. Semi-automated colorimetric and enzymatic assays for aquatic organisms using microplate readers. Water Res. 1991, 25, 147–150. [Google Scholar] [CrossRef]
  29. Liu, C.; Li, H.; Zhang, Y.; Si, D.; Chen, Q. Evolution of microbial community along with increasing solid concentration during high-solids anaerobic digestion of sewage sludge. Bioresour. Technol. 2016, 216, 87–94. [Google Scholar] [CrossRef]
  30. Wu, J.; He, S.; Liang, Y.; Li, G.; Li, S.; Chen, S.; Nadeem, F.; Hu, J. Effect of phosphate additive on the nitrogen transformation during pig manure composting. Environ. Sci. Pollut. Res. 2017, 24, 17760–17768. [Google Scholar] [CrossRef]
  31. Sun, Z.-Y.; Li, X.-X.; Shuai, W.-L.; Wang, S.-P.; Tang, Y.-Q. Improving the efficiency of rice straw composting by addition of a protein hydrolysate as a nitrogen source. Environ. Eng. Sci. 2021, 38, 703–713. [Google Scholar] [CrossRef]
  32. Wang, S.; Meng, Q.; Zhu, Q.; Niu, Q.; Yan, H.; Li, K.; Li, G.; Li, X.; Liu, H.; Liu, Y. Efficient decomposition of lignocellulose and improved composting performances driven by thermally activated persulfate based on metagenomics analysis. Sci. Total Environ. 2021, 794, 148530. [Google Scholar] [CrossRef]
  33. Ge, M.; Zhou, H.; Shen, Y.; Meng, H.; Li, R.; Zhou, J.; Cheng, H.; Zhang, X.; Ding, J.; Wang, J. Effect of aeration rates on enzymatic activity and bacterial community succession during cattle manure composting. Bioresour. Technol. 2020, 304, 122928. [Google Scholar] [CrossRef]
  34. Zhao, X.; Wei, Y.; Fan, Y.; Zhang, F.; Tan, W.; He, X.; Xi, B. Roles of bacterial community in the transformation of dissolved organic matter for the stability and safety of material during sludge composting. Bioresour. Technol. 2018, 267, 378–385. [Google Scholar] [CrossRef] [PubMed]
  35. Hansen, R.; Keener, H.; Dick, W.; Marugg, C.; Hoitink, H. Poultry Manure Composting. Ammonia Capture and Aeration Control; ASAE: St. Joseph, MI, USA, 1990. [Google Scholar]
  36. Jain, S.; Jain, S.; Wolf, I.T.; Lee, J.; Tong, Y.W. A comprehensive review on operating parameters and different pretreatment methodologies for anaerobic digestion of municipal solid waste. Renew. Sustain. Energy Rev. 2015, 52, 142–154. [Google Scholar] [CrossRef]
  37. Rihani, M.; Malamis, D.; Bihaoui, B.; Etahiri, S.; Loizidou, M.; Assobhei, O. In-vessel treatment of urban primary sludge by aerobic composting. Bioresour. Technol. 2010, 101, 5988–5995. [Google Scholar] [CrossRef] [PubMed]
  38. Amlinger, F.; Peyr, S.; Cuhls, C. Green house gas emissions from composting and mechanical biological treatment. Waste Manag. Res. 2008, 26, 47–60. [Google Scholar] [CrossRef]
  39. Jiang, T.; Schuchardt, F.; Li, G.; Guo, R.; Zhao, Y. Effect of C/N ratio, aeration rate and moisture content on ammonia and greenhouse gas emission during the composting. J. Environ. Sci. 2011, 23, 1754–1760. [Google Scholar] [CrossRef]
  40. Li, Y.; Li, L.; Sun, Y.; Yuan, Z. Bioaugmentation strategy for enhancing anaerobic digestion of high C/N ratio feedstock with methanogenic enrichment culture. Bioresour. Technol. 2018, 261, 188–195. [Google Scholar] [CrossRef]
  41. Peng, S.; Li, H.; Xu, Q.; Lin, X.; Wang, Y. Addition of zeolite and superphosphate to windrow composting of chicken manure improves fertilizer efficiency and reduces greenhouse gas emission. Environ. Sci. Pollut. Res. 2019, 26, 36845–36856. [Google Scholar] [CrossRef]
  42. Ermolaev, E.; Sundberg, C.; Pell, M.; Smårs, S.; Jönsson, H. Effects of moisture on emissions of methane, nitrous oxide and carbon dioxide from food and garden waste composting. J. Clean. Prod. 2019, 240, 118165. [Google Scholar] [CrossRef]
  43. Kebreab, E.; Clark, K.; Wagner-Riddle, C.; France, J. Methane and nitrous oxide emissions from Canadian animal agriculture: A review. Can. J. Anim. Sci. 2006, 86, 135–157. [Google Scholar] [CrossRef]
  44. Zhang, Z.; Wei, Z.; Guo, W.; Wei, Y.; Luo, J.; Song, C.; Lu, Q.; Zhao, Y. Two types nitrogen source supply adjusted interaction patterns of bacterial community to affect humifaction process of rice straw composting. Bioresour. Technol. 2021, 332, 125129. [Google Scholar] [CrossRef]
  45. Ren, L.; Schuchardt, F.; Shen, Y.; Li, G.; Li, C. Impact of struvite crystallization on nitrogen losses during composting of pig manure and cornstalk. Waste Manag. 2010, 30, 885–892. [Google Scholar] [CrossRef] [PubMed]
  46. Sisouane, M.; Cascant, M.; Tahiri, S.; Garrigues, S.; Krati, M.E.; Boutchich, G.E.K.; Cervera, M.; de La Guardia, M. Prediction of organic carbon and total nitrogen contents in organic wastes and their composts by infrared spectroscopy and partial least square regression. Talanta 2017, 167, 352–358. [Google Scholar] [CrossRef] [PubMed]
  47. Castaldi, P.; Garau, G.; Melis, P. Maturity assessment of compost from municipal solid waste through the study of enzyme activities and water-soluble fractions. Waste Manag. 2008, 28, 534–540. [Google Scholar] [CrossRef] [PubMed]
  48. Mondini, C.; Fornasier, F.; Sinicco, T. Enzymatic activity as a parameter for the characterization of the composting process. Soil Biol. Biochem. 2004, 36, 1587–1594. [Google Scholar] [CrossRef]
  49. Han, Z.; Qi, F.; Wang, H.; Liu, B.; Shen, X.; Song, C.; Bao, Z.; Zhao, X.; Xu, Y.; Sun, D. Emission characteristics of volatile sulfur compounds (VSCs) from a municipal sewage sludge aerobic composting plant. Waste Manag. 2018, 77, 593–602. [Google Scholar] [CrossRef]
  50. Huang, K.; Li, F.; Wei, Y.; Chen, X.; Fu, X. Changes of bacterial and fungal community compositions during vermicomposting of vegetable wastes by Eisenia foetida. Bioresour. Technol. 2013, 150, 235–241. [Google Scholar] [CrossRef]
  51. Li, T.; Kong, Z.; Zhang, X.; Wang, X.; Chai, L.; Liu, D.; Shen, Q. Deciphering the effect of exogenous lignocellulases addition on the composting efficiency and microbial communities. Bioresour. Technol. 2022, 361, 127751. [Google Scholar] [CrossRef]
Toxics 12 00895 g001
Figure 1. Changes in (a) Temperature, (b) pH, (c) OM, (d) O2, (e) CH4 and (f) GI during composting.
Figure 1. Changes in (a) Temperature, (b) pH, (c) OM, (d) O2, (e) CH4 and (f) GI during composting.
Toxics 12 00895 g001
Toxics 12 00895 g002
Figure 2. Changes in (a) Temperature, (b) pH, (c) OM and (d) O2 during composting.
Figure 2. Changes in (a) Temperature, (b) pH, (c) OM and (d) O2 during composting.
Toxics 12 00895 g002
Toxics 12 00895 g003
Figure 3. Evolution of enzyme activities of different piles during the composting process. Enzyme legends: (a) cellulase, (b) protease, (c) urease, (d) arylsulfatase, (e) peroxidase. Note: significance is considered at p < 0.05.
Figure 3. Evolution of enzyme activities of different piles during the composting process. Enzyme legends: (a) cellulase, (b) protease, (c) urease, (d) arylsulfatase, (e) peroxidase. Note: significance is considered at p < 0.05.
Toxics 12 00895 g003
Toxics 12 00895 g004
Figure 4. Changes in bacterial (a) and archaeal (b) community composition in different piles at the genus level during the composting process.
Figure 4. Changes in bacterial (a) and archaeal (b) community composition in different piles at the genus level during the composting process.
Toxics 12 00895 g004
Toxics 12 00895 g005
Figure 5. Random forest models (RF) quantifying the contribution of urea coupled with exogenous factors to microbial community structure, networks, and environmental genes. * p < 0.05, ** p < 0.01.
Figure 5. Random forest models (RF) quantifying the contribution of urea coupled with exogenous factors to microbial community structure, networks, and environmental genes. * p < 0.05, ** p < 0.01.
Toxics 12 00895 g005
Toxics 12 00895 g006
Figure 6. The structural equation model showed the direct and indirect effects of association of CH4 with cellulases, physicochemical properties, Methanobacterium, and Methanosarcina. The continuous arrow and the dotted arrow indicate positive and negative relationships, respectively. Asterisks denote significant effect (*, p < 0.05; **, p < 0.01; ***, p < 0.001).
Figure 6. The structural equation model showed the direct and indirect effects of association of CH4 with cellulases, physicochemical properties, Methanobacterium, and Methanosarcina. The continuous arrow and the dotted arrow indicate positive and negative relationships, respectively. Asterisks denote significant effect (*, p < 0.05; **, p < 0.01; ***, p < 0.001).
Toxics 12 00895 g006
Table 1. Physicochemical properties of raw materials used in this study.
Table 1. Physicochemical properties of raw materials used in this study.
ParametersSewage SludgeSawdustPile APile BPile C
pH8.125.558.308.838.95
Moisture content80.52%8.23%51.34%51.11%51.09%
Organic matter43.39%97.66%84.42%84.04%84.84%
Total organic carbon28.11%57.82%36.06%36.57%35.96%
Total nitrogen2.05%0.41%1.03%1.41%2.34%
C/N ratio13.32140.3035.5125.3415.42
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, K.; Guo, H.; Liang, Y.; Liu, F.; Zheng, G.; Zhang, J.; Gao, A.; Liu, N.; Ma, C. A Mechanism of Reducing Methane Production During Sewage Sludge Composting by Adding Urea. Toxics 2024, 12, 895. https://doi.org/10.3390/toxics12120895

AMA Style

Zhang K, Guo H, Liang Y, Liu F, Zheng G, Zhang J, Gao A, Liu N, Ma C. A Mechanism of Reducing Methane Production During Sewage Sludge Composting by Adding Urea. Toxics. 2024; 12(12):895. https://doi.org/10.3390/toxics12120895

Chicago/Turabian Style

Zhang, Ke, Haopeng Guo, Yujing Liang, Fuyong Liu, Guodi Zheng, Jun Zhang, Aihua Gao, Nan Liu, and Chuang Ma. 2024. "A Mechanism of Reducing Methane Production During Sewage Sludge Composting by Adding Urea" Toxics 12, no. 12: 895. https://doi.org/10.3390/toxics12120895

APA Style

Zhang, K., Guo, H., Liang, Y., Liu, F., Zheng, G., Zhang, J., Gao, A., Liu, N., & Ma, C. (2024). A Mechanism of Reducing Methane Production During Sewage Sludge Composting by Adding Urea. Toxics, 12(12), 895. https://doi.org/10.3390/toxics12120895

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop