Next Article in Journal
Biological and Physiological Responses of Root-knot Disease Development on Five Cucurbits Exposed to Different Concentrations of Sulfur Dioxide
Next Article in Special Issue
Sublethal Effects of Neonicotinoid Insecticides on the Development, Body Weight and Economic Characteristics of Silkworm
Previous Article in Journal
From Cohort to Cohort: A Similar Mixture Approach (SMACH) to Evaluate Exposures to a Mixture Leading to Thyroid-Mediated Neurodevelopmental Effects Using NHANES Data
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Toxics
Volume 11
Issue 4
10.3390/toxics11040332
toxics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Lack of Known Target-Site Mutations in Field Populations of Ostrinia furnacalis in China from 2019 to 2021

by
Youhui Gong
1,
Ting Li
2,
Xiaojian Xiu
1,
Nicolas Desneux
3 and
Maolin Hou
1,*
1
State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing 100193, China
2
Department of Biological Sciences, Alabama State University, Montgomery, AL 36104, USA
3
Université Côte d’Azur, INRAE, CNRS, UMR ISA, 06000 Nice, France
*
Author to whom correspondence should be addressed.
Toxics 2023, 11(4), 332; https://doi.org/10.3390/toxics11040332
Submission received: 1 March 2023 / Revised: 23 March 2023 / Accepted: 27 March 2023 / Published: 31 March 2023
(This article belongs to the Special Issue Effects of Agricultural Chemicals–Pesticides on Insects and Soil Organisms)
Browse Figures
Versions Notes

Abstract

:
The Asian corn borer, Ostrinia furnacalis (Guenée) (Lepidoptera; Pyralidae), is one of the most destructive insect pests of corn, for which chemical insecticides have been the primary method of control, especially during outbreaks. Little information is currently available on the status of insecticide resistance and associated mechanisms in O. furnacalis field populations. Invasions and outbreaks of Spodoptera frugiperda in China in recent years have increased chemical application in corn fields, which adds to the selection pressure on O. furnacalis. This study was conducted to estimate the risk of insecticide resistance by investigating the frequency of insecticide resistant alleles associated with target site insensitivity in field populations of O. furnacalis. Using the individual-PCR genotype sequencing analysis, none of the six target-site insecticide resistant mutations were detected in O. furnacalis field populations collected from 2019 to 2021 in China. These investigated insecticide resistance alleles are common in resistant Lepidoptra pests and are responsible for resistance to pyrethroids, organophosphorus, carbamates, diamide, and Cry1Ab. Our results support the low insecticide resistance status in field O. furnacalis populations and betokens the unlikely development of high resistance mediated by the common target-site resistance alleles. Additionally, the findings would serve as references for further efforts toward the sustainable management of O. furnacalis.

Graphical Abstract

1. Introduction

Corn (Zea mays L.) is a major grain crop in China, and the Asian corn borer Ostrinia furnacalis (Guenée) (Lepidoptera: Pyralidae) is one of the primary agricultural pests, frequently causing huge economic costs to corn production [1]. The corn borer larvae damage the ears and stalks by feeding through boring holes, and the damage consequently causes fungal infections or ear contamination, which dramatically decreases the quantity and quality of the corn [2]. Even minor corn borer damage to a corn crop can result in reductions in its market value [3]. The corn yield losses caused by O. furnacalis amount to approximately six to nine million tons every year in China [2]. Since resistant corn varieties, including Bacillus thuringiensis (Bt) corn hybrids, are not commercially available in China, integrated management measures have been adopted to reduce Asian corn borer infestation levels, including physical control, biological control [4,5], and chemical control. Among them, insecticide application is the primary strategy for O. furnacalis control in most of the corn-growing regions, especially during outbreaks [6]. Several classes of insecticides, including pyrethroids, organophosphorus, carbamates, and diamide insecticides, have been employed to control O. furnacalis or other pests in the corn crop fields [3,7]. However, extensive use of insecticides may result in harm to the environment and side effects on non-target organisms and on human health, as well as causing insecticide resistance in insect pests [8,9,10,11].
Development of insecticide resistance is common among agricultural pests [12,13,14,15,16]. The high-level insecticide resistance in many agricultural pests is largely mediated by the target site insensitivity due to a single base-pair substitution, while the low to medium level of insecticide resistance is largely due to metabolite resistance mechanisms [12]. Insect species of the same order, or even of different orders, may develop insecticide resistance to the same type of insecticides due to target site insensitivity caused by the same mutations [17]. For instance, mutations of A201S and/or F331W in acetylcholinesterase (AChE, EC3.1.1.7) have been reported to lead to resistance to organophosphorus insecticides, such as triazophos and chlorpyrifos, in many Lepidoptera pest insects, such as Chilo suppressalis (pyralidae) [18,19], Plutella xylostella (Plutellidae) [20], and Cydia pomonella (Tortricidae) [21]. Mutations of G4946E and/or I4790M in the ryanodine receptor (RyR) caused resistance to diamide insecticides in Spodoptera frugiperda (Lepidoptera: Noctuidae) [22], P. xylostella [23,24], Tuta absoluta (Lepidoptera: Gelechiidae) [25], and C. suppressalis [26,27]. The knockdown resistance (kdr) mutation L1014F associated with voltage-gated sodium channel (VGSC) insensitivity has been widely reported in several insects, such as Musca domestica (Diptera: Muscidae) [28], Blattella germanica (Blattodea: Blattellidae) [29], Culex quinquefasciatus [30], Anopheles arabiensis (Diptera: Culicidae) [31], Anopheles sinensis (Diptera: Culicidae) [17], P. xylostella [32], and Xenopsylla cheopis (Siphonaptera: Pulicidae) [33], and has caused resistance to pyrethroids.
Although the insecticide resistance status of O. furnacalis is not serious in the field as reported by the Arthropod Pesticide Resistance Database (APRD) [34], the invasion and outbreak of the fall armyworm in China in recent years necessitated extensive application of insecticides for emergency control, which might have exerted selection pressure on O. furnacalis [7,35,36]. The problem of insecticide resistance development cannot be ignored in O. furnacalis. Unfortunately, almost no other information is currently available on the status of insecticide resistance and associated mechanisms in O. furnacalis. Therefore, it is essential to estimate the insecticide susceptibility in field populations of O. furnacalis.
In this study, we investigated the presence and frequencies of mutations associated with target-site resistance that have been reported in many pest insects, including the single-pair substitutions A201S and/or F331W in the AChE 1 (Ace1) gene, G4946E and I4790M mutations in the ryanodine receptor, the kdr mutation of L1014F in sodium channel protein para-like, and a 234Y insertion in the ABC transporter subfamily C2 (ABCC2) gene causing Cry1Ab resistance in Bombyx mori [37]. The results of this study can help estimate the risk of resistance to insecticides, understand the relative insecticide susceptibility status in the corn borer, and further contribute to sustainable management in the field.

2. Materials and Methods

2.1. Collection of Field Populations from 2019 to 2021

From 2019 to 2021, a total of 1024 O. furnacalis larvae were collected from 12 provinces located principally in southeast and northeast China, crossing the Huanghuaihai summer corn region, the southwest corn region, and the northern spring corn region. One of the populations was collected in 2020 from the experimental plots in Liaoning province, planting the transgenic corn expressing the Bt Cry1Ab protein [38], while all other populations were collected from regular corn fields. The borer samples were individually stored in a 1.5 mL tube with 95% methanol immediately after they were collected from the plants and then stored at −20 °C in the laboratory until use. The field collection details are shown in Table 1.

2.2. Individual Crude DNA Extraction

Prior to crude DNA extraction, the collected larvae were taken out from the storage tube and then rinsed individually with distilled water. A small piece of head tissue (no more than 1 cm × 1 cm) was cut from each larva and used in crude DNA extraction.
Crude DNA extraction was performed using a tissue lysate purchased from Mei5 Biotechnology Co., Ltd. (Beijing, China). Tissues were homogenized individually using a stick sharpener in a 1.5 tube containing 20–30 μL tissue lysate. The homogenate was incubated at 95 °C for 5 min in a heater and then centrifuged at 12,000× g for 5 min. The supernatant was transferred to a 0.2 mL PCR tube individually and stored at −20 °C until use. The crude genomic DNA extract obtained was used as a template for PCR amplification of a region containing key SNPs that are diagnostic for insecticide mutations as described below.

2.3. Examination of Insecticide Resistance Mutations

In this study, six target-site mutations that have been reported to be associated with insecticide resistance in Lepidoptera insects were investigated. The resistance-related alleles with mutations are listed in Table 2. To precisely design the primers for target alleles, we initially compared the amino acid sequences of target genes between O. furnacalis and other species (Figure 1) to locate the amino acid site of mutations. The comparison of amino acid sequences was done at https://www.ebi.ac.uk/Tools/psa/emboss_needle/ (accessed on 15 March 2019). Amino acid site 317 of the Ace1 gene in O. furnacalis corresponds to site 314 in C. suppressalis and is equivalent to site 201 in Torpedo californica. Amino acid site 446 in the Ace1 gene in O. furnacalis corresponds to site 440 in Tetranychus evansi (Acari: Tetranychidae) [39] and is equivalent to site 331 in T. californica. Amino acid sites 4733 and 4890 in RyR O. furnacalis correspond to sites 4790 and 4946, respectively, in P. xylostella, in which G4946E and I4790M mutations associated with diamide resistance were first reported. Amino acid site 1025 in the voltage-gated sodium channel (VGSC) in O. furnacalis is equivalent to the 1014-site in M. domestica. Amino acid site 229 in ABCC2 in O. furnacalis corresponds to the 234-site in Bombyx mori (Lepidoptera: Bombicidae), in which the 234-site insertion associated with Cry1Ab resistance was first reported. We also examined this insertion mutation in O. furnacalis individuals collected from transgenic corn expressing the Cry1Ab protein in the experimental plots in Liaoning [38] beside field populations collected from 12 sites in China. Based on the amino acid sequences containing the examined mutations, the genomic DNA sequences were addressed to design the primer pairs to amplify the PCR fragments of alleles. The primer pairs for the allele amplification are listed in Table 3. Primer pairs were designed using the Primer-Blast tool on the NCBI database available at https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi (accessed on 20 March 2019).

2.4. PCR Amplification and Sequencing

H5 Hiper mix purchased from Mei5 Biotechnology Co., Ltd. (Beijing, China) was used to amplify the DNA fragments of target genes containing the examined resistance mutations using the primers listed in Table 3. The reactions were performed in a final volume of 30 μL with 10 μL H5 Hiper mix buffer, 1.5 μL primer (final concentration was 0.5 μM), 16.5–17.5 μL sterile water, and 1–2 μL of crude DNA homogenate, according to the manufacturer’s instructions. The amplification consisted of 35 cycles (98 °C for 5 s, 60 °C for 20 s, and 72 °C for 15 s), preceded by an initial phase at 98 °C for 30 s and followed by a termination phase at 72 °C for 5 min. PCR fragments were purified and evaluated by DNA gel electrophoresis and then sequenced by Sanger sequencing performed by Sangon Biotech (Beijing, China) Co., Ltd. to get DNA sequences of PCR products. The sequencing primers are also listed in Table 3. The correction of desired sequences was evaluated by using the Basic Local Alignment Search Tool (BLASTn for nucleotide comparisons) available at http://blast.ncbi.nlm.nih.gov/) (accessed on 10 August 2019; 12 October 2019; 1 December 2019), and then the chromatograms of sequences containing mutations were analyzed using ChromasPro software (version 1.62).

3. Results

3.1. PCR Product Evaluation and Chromatograms of the Insecticide Resistance Mutations

The DNA fragments of the examined alleles encoding the corresponding desired mutations were amplified in all tested individual samples from 2019 to 2021. Only a single DNA band was amplified in each PCR reaction, and the size of all the amplified DNA fragments was expected to include two DNA fragment lengths of 292 bp and 246 bp responsible for two mutations, F331Y/W and A201S in Ace1, respectively; a fragment length of 191 bp responsible for sodium channel mutation L1014F; two fragment lengths of 181 bp and 124 bp responsible for mutations G4946E and I4790M in RyR, respectively; and a fragment length of 188 bp responsible for 234Y-insertion in ABCC2 (Figure 2). The representative chromatograms for each mutation are shown in Figure 3. In all the tested individuals, GCA or GCT encoding alanine was found at 317-site corresponding to the 201-site in AchE of T. californica, in which the A201S mutation was caused by a single-pair substitution change from GCA/GCT to TCT/TCA (Figure 3A). The expected nucleotide substitution for the Ace1-F331Y/W mutation would be TTT to TAT, but only TTT encoding amino acid phenylalanine was examined in all samples (Figure 3B). A nucleotide substitution from GGG/GGA/GGC to GAG can cause the RyR-G4946E mutation in P. xylostella; however, only nucleotide polymorphisms (GGG/GGA/GGC) were found in O. furnacalis, which encode amino acid glycine alone (Figure 3C). For the RyR-I4790M mutation, the expected nucleotide substitution is ATA to ATG, but ATA encoding amino acid isoleucine was examined in all tested insects (Figure 3D). For the typical Kdr mutation L1014F based on a nucleotide substitution changing CTT to TTT, only CTT encoding amino acid leucine in the 1025-site in O. furnacalis was identified (Figure 3E). The 234Y insertion was examined in all tested samples of O. furnacalis, including individuals collected from Bt-corn; however, no insertion of nucleotides encoding tyrosine was found in any tested sample. At the 234-site, the nucleotide codon ACA encoding amino acid threonine was identified in all tested samples (Figure 3F).

3.2. Individual Genotype Sequencing Results from 2019 to 2021

A total of 1024 larvae were tested in 2019 and 2021 using PCR genotype sequencing. Based on the chromatogram analysis of each sequence, there was no desired mutation found in any sample. The frequencies of susceptibility of these six resistance mutations were 100% in O. furnacalis collected in 2019–2021 from 12 provinces in China, including a population collected from Bt-corn. The genotype of all examined alleles was sensitive homozygote (SS).

4. Discussion

Pyrethroids, organophosphorus, carbamates, and diamide insecticides are widely used to control pest insects, including O. furnacalis [3,7]. However, the frequent use of insecticides has caused insect pests to develop insecticide resistance worldwide. One of the most important resistance mechanisms is the reduced sensitivity of insecticide target sites, which is caused by the adoption of mutation(s) in the amino acid sequences of target genes [12]. Cases in which insect species of the same order, or even of different orders, developed insecticide resistance to the same type of insecticides due to the target site insensitivity caused by the same mutation(s) have been demonstrated in many studies [17,19,20,21,22,28,30,40]. Although the insecticide resistance status of O. furnacalis is not serious in the field, as reported by the Arthropod Pesticide Resistance Database (APRD) [34], little information is currently available on the status of insecticide resistance and associated mechanisms in O. furnacalis. Investigating the target-site-insensitivity-associated mutations in this pest could help predict a potential resistance status of field populations. In this study, we, for the first time, tested the insecticide target-site-insensitivity-associated mutations in field populations of O. furnacalis from 12 provinces in China using diagnostic PCRs with the sequencing of key genes encoding the desired mutations.
Acetylcholinesterase (AchE) plays a key role in neurotransmission and is the specific target of organophosphate and carbamate insecticides. The mutations adopted in AchE caused a conversion of AchE to an insecticide-insensitive form in several insect species, such as Drosophila melanogaster (Diptera: Drosophiladae), M. domestica, Bactrocera oleae (Diptera:Tephritidae), Anopheles gambiae (Diptera: Culicidae), Culex pipiens (Diptera: Culicidae), Myzus persicae (Homoptera: Aphididae), Leptinotarsa decemlineata (Coleoptera: Chrysomelidae), Cydia pomonella (Lepidoptera: Tortricidae), C. suppressalis, and P. xylostella [18,20,40]. Point mutations that confer insensitivity to Ops and carbamates were reported both in ace1 and ace2. This study investigated two typical mutations of A201S and F331Y/W in the ace1 gene which are found in many pest insects, including C. suppressalis [18,19], P. xylostella [20], Apolygus lucorum (Heteroptera: Miridae) [40], Bemisia tabaci (Hemiptera: Aleyrodidae) [41,42], C. pomonella [21], B. oleae [43], and Tetranychus evansi (Acari Tetranychidae) [39]. However, no mutations in ace1 were detected from any of the tested samples in this study. This result might be associated with the wide use of the novel diamide insecticides and the gradually decreased use of traditional organophosphate and carbamate insecticides for the control of corn crop pests in China in recent years [5,27]. A reduction in insecticide use may reduce insecticide selection pressure on the pest, consequently reducing the frequency of these mutations in field populations of O. furnacalis.
Pyrethroid insecticides have been widely used to control pest insects. Unfortunately, many of the pests have developed resistance to pyrethroids due to mutations associated with VGSC insensitivity. The knockdown resistance (kdr) mutation L1014F (house fly) has been widely reported in several insects, such as Musca domestica [28], Blattella germanica (Blattaria, Blattellidae) [29], C. quinquefasciatus [30], Anopheles arabiensis (Diptera: Culicidae) [31], P. xylostella [32], and Xenopsylla cheopis (Siphonaptera: Pulicidae) [33], among the others. Pyrethroid insecticides are commonly used to control cotton bollworms Helicoverpa armigera (Lepidoptera: Noctuidae) and Agrotis ypsilon (Lepidoptera: Noctuidae) in cornfields. Interestingly, L1014F was not detected in the field populations of O. furnacalis in this study. Additionally, the L1014F mutation is rarely reported in H. armigera and A.ypsilon [44,45]. This information might indicate low selection pression on this resistant mutation in pests in cornfields.
Diamide insecticides such as flubendiamide and chlorantraniliprole target insect ryanodine receptors (RyR). Diamide insecticides have been widely used in the control of lepidopterans pests, such as O. furnacalis and S. frugiperda, due to their broad-spectrum high efficacy on numerous pests and excellent safety profile. Diamide insecticide resistance in lepidopteran pests was first reported in P. xylostella [23], followed by T. absoluta [46] and C. suppressalis [26], and very recently found in S. exigua [22,47]. The amino acid mutations, G4946E and I4790M, present in the RyR transmembrane domain and causing diamide resistance were first detected in P. xylostella [23,48], then in T. absoluta [25], C. suppressalis [49], and S. frugiperda [22]. In our tests of such mutations in RyR in O. furnacalis, the frequencies of glutamine in amino acid position 4946 and of isoleucine in position 4790 were 100%, indicating that the insecticide resistance mechanism of G4946E and I4790M mutations in RyR has not evolved in O. furnacalis. This result suggests that the development of diamide insecticide resistance caused by G4946E and I4790M mutations have not yet happened in field populations of O. furnacalis, and O. furnacalis is relatively susceptible to diamide insecticides regardless of metabolic resistance. In another study, Lv et al. [50] reported that the frequency of such mutations in relation to diamide insecticides was very low in 13 populations of S. frugiperda in China. In combination, these studies suggest that diamide insecticides are still effective in controlling pests including S. frugiperda and O. furnacalis in the corn crop fields in China. However, diamide insecticides have been extensively used in recent years to control the populations of the fall armyworm in China [7,36]; the frequencies of G4946E and I4790M mutations need to be further investigated in either O. furnacalis or S. frugiperda.
Transgenic corn expressing the Bt insecticidal protein has been commercially planted to control the European corn borer Ostrinia nubilalis (Hübner) in many countries, and farmers have benefitted from the rapid application of this transgenic technology in the form of reduced insect damage [51]. Although Bt corn hybrids have not been commercially planted in China, many transgenic Bt corn varieties targeting lepidopterans are undergoing regulatory trials, and two varieties of Bt corn were recently issued safety certificates by the Ministry of Agriculture and Rural Affairs of the People’s Republic of China (http://www.moa.gov.cn/ztzl/zjyqwgz/spxx/201912/t20191230_6334015.htm) (accessed on 5 September 2022), which implies that the commercialization of Bt corn may come soon [51]. Li et al. ([51]) investigated the susceptibility and resistance allele frequency of fifteen populations of O. furnacalis collected in the Huanghuaihai summer corn region of China to Cry1Ab, Cry1Ac, and Cry1F toxins, and they found that all populations were susceptible to these three Cry toxins and estimated that resistance allele frequency was rare in this region. Liu et al. [52] used the F2 screening method for estimating the expected frequency of resistance alleles in the 13 ACB populations to Bt corn (Bt11 × GA21) expressing the Cry1Ab toxin, and pointed out that the sensitivity of ACB to Cry1Ab was still at a high level, and there were no viable resistant individuals in the field at present. In this study, by directly genotyping the Cry1Ab resistance-associated mutation, we also conclude that a tyrosine (Y) insertion at 234-position in the ABC transporter subfamily C2 (ABCC2) gene was not found in either the non-Bt corn populations (collected from 12 regions in China) or a Bt corn population of O. furnacalis that had been subjected to Cry1Ab toxins [38]. This 234-Y insertion in the ABCC2 gene was first reported in Bombyx mori, which led to Cry1Ab resistance [37]. Using the CRISPR/Cas9 technique, ABCC2 was also proven to be the functional receptor to Cry1Fa in O. furnacali [53]. The findings by Li et al. [51], Liu et al. [52], and this study provide essential knowledge for making the suggestions to commercialize Bt corn, monitor resistance development, and evaluate resistance management strategies in the future in China.
In addition to the use of insecticides to control O. furnacalis in cornfields, trichogramma-based biological control has been suggested to be an effective approach for controlling O. furnacalis since its use was initiated in the 1970s in China and worldwide [54]. For example, a large-scale release of the parasitoid wasp Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) from 2000 to 2015 in the Jilin province, supported by public finances in China, proved to be effective for the control of this pest, as well as led to a decrease in insecticide use across the province [4]. Therefore, with the wide application of Trichogramma-based biological control for the control of the corn borer in China in recent years, it is not surprising that due to the reduction of pesticide selection pressure, no examined insecticide-resistance-associated mutations were identified from the 12 provinces in China sampled in this study.
In total, using the PCR genotype sequencing analysis, we investigated the frequency of six well-known insecticide-resistance-associated mutations corresponding to a range of insecticides, including pyrethroids, organophosphorus, carbamates, diamide insecticides, and Cry1Ab, in field populations of O. furnacalis from 12 regions in China. The results show that no targe-site resistance-related alleles were detected. Our results support the low insecticide resistance status of field O. furnacalis populations and betoken the unlikely development of high resistance mediated by the common target-site resistance alleles in this pest currently. They also reveal that most insecticides mentioned in this study that correspond to the examined target genes can effectively control O. furnacalis in the field. However, other pests in cornfields, such as S. frugiperda, should also be taken into account when using insecticides to control O. furnacalis. It has been shown that the frequency of G4946E/I4790M mutations in the RyR gene in S. fru-giperda is also extremely low [50], suggesting that amide insecticides, whether used to control O. furnacalis or S. frugiperda, are currently among the most effective ones. However, it should also be used in rotation with other insecticides, taking into account both biological controls to reduce the usage of amide insecticides. In addition, as with similar results observed in other studies [51,52], we did not detect the mutation associated with Bt protein toxins in O. furnacalis field populations. This result also lays a foundation for resistance detection of transgenic corn in the near future, once the widespread planting in China has occurred [52]. The metabolic enzymes, such as P450 and carboxylesterase, have been widely studied in insecticide resistance to organophosphate, pyrethroids, and diamide and in the adaptation to contaminants in pest insects [55,56,57,58,59,60,61,62,63,64]. In the future, significant attention should be paid to the metabolic resistance mechanisms of O. furnacalis to insecticides, and it remains to be further investigated whether O. furnacalis in the field has developed low- to moderate-level resistance to amide insecticides due to metabolic resistance mechanisms.

Author Contributions

Conceptualization, Y.G. and M.H.; methodology, Y.G.; software, Y.G.; validation, Y.G., M.H. and N.D.; formal analysis, Y.G. and X.X.; investigation, Y.G. and X.X.; resources, M.H. and Y.G.; data curation, Y.G.; writing—original draft preparation, Y.G.; writing—review and editing, Y.G.; T.L., M.H. and N.D.; visualization, Y.G. and T.L.; supervision, Y.G. and M.H.; project administration, Y.G. and M.H.; funding acquisition, Y.G. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Science & Technology Fundamental Resources Investigation Program of China (2018FY10100).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data generated or analyzed during this study are included in this published article.

Acknowledgments

We thank Zhenying Wang (Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing, China) for his valuable advice on the collection of insect sources, Xiwu Gao (China Agricultural University) for his valuable advice on the implementation of the project, Xuegui Wang (Sichuan Agricultural University), Xingchuan Jiang (Anhui Agricultural University), and other colleagues, whose names are not shown, for their help in collecting field populations. We also thank Xueqing Yang (Shenyang Agricultural University) for providing the Asian corn borer collected in Liaoning province in 2020 from the experimental plots planting the transgenic corn expressing the Bt Cry1Ab protein.

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

  1. Nafus, D.; Schreiner, I. Review of the biology and control of the Asian corn borer, Ostrinia furnacalis (Lep: Pyralidae). Trop. Pest. Manag. 1991, 37, 41–56. [Google Scholar] [CrossRef]
  2. Chang, X.; Liu, G.; He, K.; Shen, Z.; Peng, Y.; Ye, G. Efficacy evaluation of two transgenic maize events expressing fused proteins to Cry1Ab-susceptible and-resistant Ostrinia furnacalis (Lepidoptera: Crambidae). J. Econ. Entomol. 2013, 106, 2548–2556. [Google Scholar] [CrossRef] [PubMed]
  3. Xu, C.; Ding, J.; Zhao, Y.; Luo, J.; Mu, W.; Zhang, Z. Cyantraniliprole at sublethal dosages negatively affects the development, reproduction, and nutrient utilization of Ostrinia furnacalis (Lepidoptera: Crambidae). J. Econ. Entomol. 2017, 110, 230–238. [Google Scholar]
  4. Huang, J.M.; Rao, C.; Wang, S.; He, L.F.; Zhao, S.Q.; Zhou, L.Q.; Zhao, Y.X.; Yang, F.X.; Gao, C.F.; Wu, S.F. Multiple target-site mutations occurring in lepidopterans confer resistance to diamide insecticides. Insect Biochem. Molec. 2020, 121, 103367. [Google Scholar] [CrossRef]
  5. Zhang, X.; Wang, H.C.; Du, W.M.; Zang, L.S.; Ruan, C.C.; Zhang, J.J.; Zou, Z.; Monticelli, L.S.; Harwood, J.D.; Desneux, N. Multiparasitism: A promising approach to simultaneously produce Trichogramma chilonis and T. dendrolimi on eggs of Antheraea pernyi. Entomol. Gen. 2021, 41, 627–636. [Google Scholar] [CrossRef]
  6. Wang, Z.Y.; Lu, X.; He, K.L.; Zhou, D.R. Review of history, present situation and prospect of the Asian Borer research in China. J. Shenyang Agric. Univ. 2000, 31, 404–412. [Google Scholar]
  7. Zhao, Y.X.; Huang, J.M.; Ni, H.; Guo, D.; Yang, F.X.; Wang, X.; Wu, S.F.; Gao, C.F. Susceptibility of fall armyworm, Spodoptera frugiperda (JE Smith), to eight insecticides in China, with special reference to lambda-cyhalothrin. Pestic. Biochem. Physiol. 2020, 168, 104623. [Google Scholar] [CrossRef]
  8. Desneux, N.; Decourtye, A.; Delpuech, J.M. The sublethal effects of pesticides on beneficial arthropods. Annu. Rev. Entomol. 2007, 52, 81–106. [Google Scholar] [CrossRef]
  9. Hernández, M.; Margalida, A. Pesticide abuse in Europe: Effects on the Cinereous vulture (Aegypius monachus) population in Spain. Ecotoxicology 2008, 17, 264–272. [Google Scholar] [CrossRef]
  10. Aktar, W.; Sengupta, D.; Chowdhury, A. Impact of pesticides use in agriculture: Their benefits and hazards. Interdiscip. Toxicol. 2009, 2, 1–12. [Google Scholar] [CrossRef] [Green Version]
  11. Liu, S.; Xu, Y.; Gao, Y.; Zhao, Y.; Zhang, A.; Zang, L.; Wu, C.; Zhang, L. Panaxadiol saponins treatment caused the subtle variations in the global transcriptional state of Asiatic corn borer, Ostrinia furnacalis. J. Ginseng Res. 2020, 44, 123–134. [Google Scholar] [CrossRef] [PubMed]
  12. Liu, N. Insecticide resistance in mosquitoes: Impact, mechanisms, and research directions. Annu. Rev. Entomol. 2015, 60, 537–559. [Google Scholar] [CrossRef]
  13. Chen, C.; Shi, X.; Desneux, N.; Han, P.; Gao, X. Detection of insecticide resistance in Bradysia odoriphaga Yang et Zhang (Diptera: Sciaridae) in China. Ecotoxicology 2017, 26, 868–875. [Google Scholar] [CrossRef]
  14. Jiang, D.; Qian, C.; Wang, D.; Wang, F.; Zhao, S.; Yang, Y.; Baxter, S.W.; Wang, X.; Wu, Y. Varying contributions of three ryanodine receptor point mutations to diamide insecticide resistance in Plutella xylostella. Pest. Manag. Sci. 2021, 77, 4874–4883. [Google Scholar] [CrossRef] [PubMed]
  15. Paula, D.P.; Lozano, R.E.; Menger, J.P.; Andow, D.A.; Koch, R.L. Identification of point mutations related to pyrethroid resistance in voltage-gated sodium channel genes in Aphis glycines. Entomol. Gen. 2021, 41, 243–255. [Google Scholar] [CrossRef]
  16. Wang, X.; Xu, X.; Ullah, F.; Ding, Q.; Gao, X.; Desneux, N.; Song, D. Comparison of full-length transcriptomes of different imidacloprid-resistant strains of Rhopalosiphum padi (L.). Entomol. Gen. 2021, 41, 289–304. [Google Scholar] [CrossRef]
  17. Qian, W.; Liu, N.; Yang, Y.; Liu, J.; He, J.; Chen, Z.; Li, M.; Qiu, X. A survey of insecticide resistance-conferring mutations in multiple targets in Anopheles sinensis populations across Sichuan, China. Parasites Vectors 2021, 14, 169. [Google Scholar] [CrossRef]
  18. Jiang, X.; Qu, M.; Denholm, I.; Fang, J.; Jiang, W.; Han, Z. Mutation in acetylcholinesterase1 associated with triazophos resistance in rice stem borer, Chilo suppressalis (Lepidoptera: Pyralidae). Biochem. Biophys. Res. Commun. 2009, 378, 269–272. [Google Scholar] [CrossRef]
  19. Chang, C.; Cheng, X.; Huang, X.Y.; Dai, S.M. Amino acid substitutions of acetylcholinesterase associated with carbofuran resistance in Chilo suppressalis. Pest. Manag. Sci. 2014, 70, 1930–1935. [Google Scholar] [CrossRef]
  20. Lee, D.W.; Choi, J.Y.; Kim, W.T.; Je, Y.H.; Song, J.T.; Chung, B.K.; Boo, K.S.; Koh, Y.H. Mutations of acetylcholinesterase1 contribute to prothiofos-resistance in Plutella xylostella (L.). Biochem. Biophys. Res. Commun. 2007, 353, 591–597. [Google Scholar] [CrossRef]
  21. Cassanelli, S.; Reyes, M.; Rault, M.; Manicardi, G.C.; Sauphanor, B. Acetylcholinesterase mutation in an insecticide-resistant population of the codling moth Cydia pomonella (L.). Insect Biochem. Mol. Biol. 2006, 36, 642–653. [Google Scholar] [CrossRef] [PubMed]
  22. Boaventura, D.; Bolzan, A.; Padovez, F.E.; Okuma, D.M.; Omoto, C.; Nauen, R. Detection of a ryanodine receptor target-site mutation in diamide insecticide resistant fall armyworm, Spodoptera frugiperda. Pest. Manag. Sci. 2020, 76, 47–54. [Google Scholar] [CrossRef] [PubMed]
  23. Troczka, B.; Zimmer, C.T.; Elias, J.; Schorn, C.; Bass, C.; Davies, T.E.; Field, L.M.; Williamson, M.S.; Slater, R.; Nauen, R. Resistance to diamide insecticides in diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) is associated with a mutation in the membrane-spanning domain of the ryanodine receptor. Insect Biochem. Mol. Biol. 2012, 42, 873–880. [Google Scholar] [CrossRef]
  24. Guo, L.; Liang, P.; Zhou, X.; Gao, X. Novel mutations and mutation combinations of ryanodine receptor in a chlorantraniliprole resistant population of Plutella xylostella (L.). Sci. Rep. 2014, 4, 6924. [Google Scholar] [CrossRef] [Green Version]
  25. Roditakis, E.; Steinbach, D.; Moritz, G.; Vasakis, E.; Stavrakaki, M.; Ilias, A.; García-Vidal, L.; del Rosario Martinez-Aguirre, M.; Bielza, P.; Morou, E. Ryanodine receptor point mutations confer diamide insecticide resistance in tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae). Insect Biochem. Mol. Biol. 2017, 80, 11–20. [Google Scholar] [CrossRef]
  26. Yao, R.; Zhao, D.D.; Zhang, S.; Zhou, L.Q.; Wang, X.; Gao, C.F.; Wu, S.F. Monitoring and mechanisms of insecticide resistance in Chilo suppressalis (Lepidoptera: Crambidae), with special reference to diamides. Pest. Manag. Sci. 2017, 73, 1169–1178. [Google Scholar] [CrossRef]
  27. Huang, N.-X.; Jaworski, C.; Desneux, N.; Zhang, F.; Yang, P.-Y.; Wang, S. Long-term, large-scale releases of Trichogramma promote pesticide decrease in maize in northeastern China. Entomol. Gen. 2020, 40, 1. [Google Scholar] [CrossRef]
  28. Smith, T.J.; Lee, S.H.; Ingles, P.J.; Knipple, D.C.; Soderlund, D.M. The L1014F point mutation in the house fly Vssc1 sodium channel confers knockdown resistance to pyrethroids. Insect Biochem. Mol. Biol. 1997, 27, 807–812. [Google Scholar] [CrossRef]
  29. Gholizadeh, S.; Nouroozi, B.; Ladonni, H. Molecular detection of knockdown resistance (kdr) in Blattella germanica (Blattodea: Blattellidae) from northwestern Iran. J. Med. Entomol. 2014, 51, 976–979. [Google Scholar] [CrossRef]
  30. Ponce, G.; Sanchez, I.P.; García, S.M.; Torrado, J.M.; Lozano-Fuentes, S.; Lopez-Monroy, B.; Flores, A.E. First report of L1014F kdr mutation in Culex quinquefasciatus in Mexico. Insect Sci. 2016, 23, 829–834. [Google Scholar] [CrossRef]
  31. Da Cruz, D.L.; Paiva, M.H.S.; Guedes, D.R.D.; de Souza Gomes, E.C.; Pires, S.G.; Gomez, L.F.; Ayres, C.F.J. First report of the L1014F kdr mutation in wild populations of Anopheles arabiensis in Cabo Verde, West Africa. Parasites Vectors 2021, 14, 582. [Google Scholar] [CrossRef] [PubMed]
  32. Endersby, N.; Viduka, K.; Baxter, S.; Saw, J.; Heckel, D.G.; McKechnie, S. Widespread pyrethroid resistance in Australian diamondback moth, Plutella xylostella (L.), is related to multiple mutations in the para sodium channel gene. Bull. Entomol. Res. 2011, 101, 393–405. [Google Scholar] [CrossRef]
  33. Liu, N.; Feng, X.; Li, M.; Qiu, X. First detection of the kdr mutation (L1014F) in the plague vector Xenopsylla cheopis (Siphonaptera: Pulicidae). Parasites Vectors 2019, 12, 526. [Google Scholar] [CrossRef]
  34. Mota-Sanchez, D.; Wise, J. Arthropod Pesticide Resistance Database (APRD). Michigan State University. 2021. Available online: https://www.pesticideresistance.org/ (accessed on 1 June 2021).
  35. Jing, D.P.; Guo, J.F.; Jiang, Y.Y.; Zhao, J.Z.; Sethi, A.; He, K.L.; Wang, Z.Y. Initial detections and spread of invasive Spodoptera frugiperda in China and comparisons with other noctuid larvae in cornfields using molecular techniques. Insect Sci. 2020, 27, 780–790. [Google Scholar] [CrossRef] [PubMed]
  36. Jin, W.; Zhai, Y.; Yang, Y.; Wu, Y.; Wang, X. Cadherin protein is involved in the action of Bacillus thuringiensis Cry1Ac toxin in Ostrinia furnacalis. Toxins 2021, 13, 658. [Google Scholar] [CrossRef] [PubMed]
  37. Atsumi, S.; Miyamoto, K.; Yamamoto, K.; Narukawa, J.; Kawai, S.; Sezutsu, H.; Kobayashi, I.; Uchino, K.; Tamura, T.; Mita, K. Single amino acid mutation in an ATP-binding cassette transporter gene causes resistance to Bt toxin Cry1Ab in the silkworm, Bombyx mori. Proc. Natl. Acad. Sci. USA 2012, 109, E1591–E1598. [Google Scholar] [CrossRef] [Green Version]
  38. Liang, J.G.; Zhang, D.D.; Li, D.Y.; Zhao, S.Y.; Wang, C.Y.; Xiao, Y.T.; Dong, X.; Yang, Y.Z.; Li, G.P.; Wang, L.L. Expression profiles of Cry1Ab protein and its insecticidal efficacy against the invasive fall armyworm for Chinese domestic GM maize DBN9936. J. Integr. Agr. 2021, 20, 792–803. [Google Scholar] [CrossRef]
  39. Carvalho, R.; Yang, Y.; Field, L.M.; Gorman, K.; Moores, G.; Williamson, M.S.; Bass, C. Chlorpyrifos resistance is associated with mutation and amplification of the acetylcholinesterase-1 gene in the tomato red spider mite, tetranychus evansi. Pestic. Biochem. Physiol. 2012, 104, 143–149. [Google Scholar] [CrossRef]
  40. Wu, S.; Zuo, K.; Kang, Z.; Yang, Y.; Oakeshott, J.G.; Wu, Y. A point mutation in the acetylcholinesterase-1 gene is associated with chlorpyrifos resistance in the plant bug Apolygus lucorum. Insect Biochem. Mol. Biol. 2015, 65, 75–82. [Google Scholar] [CrossRef]
  41. Alon, M.; Alon, F.; Nauen, R.; Morin, S. Organophosphates’ resistance in the B-biotype of Bemisia tabaci (Hemiptera: Aleyrodidae) is associated with a point mutation in an ace1-type acetylcholinesterase and overexpression of carboxylesterase. Insect Biochem. Mol. Biol. 2008, 38, 940–949. [Google Scholar] [CrossRef]
  42. Zhang, N.N.; Liu, C.F.; Yang, F.; Dong, S.I.; Han, Z.J.; Liu, N. Resistance mechanisms to chlorpyrifos and F392W mutation frequencies in the acetylcholine esterase ace1 allele of field populations of the tobacco whitefly, Bemisia tabaci in China. J. Insect Sci. 2012, 12, 41. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Vontas, J.G.; Hejazi, M.; Hawkes, N.J.; Cosmidis, N.; Loukas, M.; Hemingway, J. Resistance-associated point mutations of organophosphate insensitive acetylcholinesterase, in the olive fruit fly Bactrocera oleae. Insect Mol. Biol. 2002, 11, 329–336. [Google Scholar] [CrossRef] [PubMed]
  44. Yang, Y.; Wu, Y.; Chen, S.; Devine, G.; Denholm, I.; Jewess, P.; Moores, G. The involvement of microsomal oxidases in pyrethroid resistance in Helicoverpa armigera from Asia. Insect Biochem. Mol. Biol. 2004, 34, 763–773. [Google Scholar] [CrossRef]
  45. Wu, G.; Li, Q.; Liu, X.; Li-Byarlay, H.; He, B. Differential state-dependent effects of deltamethrin and tefluthrin on sodium channels in central neurons of Helicoverpa armigera. Pestic. Biochem. Physiol. 2021, 175, 104836. [Google Scholar] [CrossRef] [PubMed]
  46. Roditakis, E.; Vasakis, E.; Grispou, M.; Stavrakaki, M.; Nauen, R.; Gravouil, M.; Bassi, A. First report of Tuta absoluta resistance to diamide insecticides. J. Pest. Sci. 2015, 88, 9–16. [Google Scholar] [CrossRef]
  47. Cho, S.R.; Kyung, Y.; Shin, S.; Kang, W.J.; Jung, D.H.; Lee, S.J.; Park, G.H.; Kim, S.I.; Cho, S.W.; Kim, H.K. Susceptibility of field populations of Plutella xylostella and Spodoptera exigua to four diamide insecticides. Korean J. Appl. Entomol. 2018, 57, 43–50. [Google Scholar]
  48. Troczka, B.J.; Williamson, M.S.; Field, L.M.; Davies, T.E. Rapid selection for resistance to diamide insecticides in Plutella xylostella via specific amino acid polymorphisms in the ryanodine receptor. Neurotoxicology 2017, 60, 224–233. [Google Scholar] [CrossRef] [Green Version]
  49. Wei, Y.; Yan, R.; Zhou, Q.; Qiao, L.; Zhu, G.; Chen, M. Monitoring and mechanisms of chlorantraniliprole resistance in Chilo suppressalis (Lepidoptera: Crambidae) in China. J. Econ. Entomol. 2019, 112, 1348–1353. [Google Scholar] [CrossRef]
  50. Lv, S.L.; Shi, Y.; Zhang, J.C.; Liang, P.; Zhang, L.; Gao, X.W. Detection of ryanodine receptor target-site mutations in diamide insecticide-resistant Spodoptera frugiperda in China. Insect Sci. 2021, 28, 639–648. [Google Scholar] [CrossRef]
  51. Li, G.; Huang, J.; Ji, T.; Tian, C.; Zhao, X.; Feng, H. Baseline susceptibility and resistance allele frequency in Ostrinia furnacalis related to Cry1 toxins in the Huanghuaihai summer corn region of China. Pest. Manag. Sci. 2020, 76, 4311–4317. [Google Scholar] [CrossRef]
  52. Liu, X.; Liu, S.; Long, Y.; Wang, Y.; Zhao, W.; Shwe, S.M.; Wang, Z.; He, K.; Bai, S. Baseline Susceptibility and Resistance Allele Frequency in Ostrinia furnacalis in Relation to Cry1Ab Toxins in China. Toxins 2022, 14, 255. [Google Scholar] [CrossRef] [PubMed]
  53. Wang, X.; Xu, Y.; Huang, J.; Jin, W.; Yang, Y.; Wu, Y. CRISPR-mediated knockout of the ABCC2 gene in Ostrinia furnacalis confers high-level resistance to the Bacillus thuringiensis Cry1Fa toxin. Toxins 2020, 12, 246. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Zang, L.S.; Wang, S.; Zhang, F.; Desneux, N. Biological control with Trichogramma in China: History, present status, and perspectives. Annu. Rev. Entomol. 2021, 66, 463–484. [Google Scholar] [CrossRef]
  55. Gong, Y.; Li, M.; Li, T.; Liu, N. Molecular and functional characterization of three novel carboxylesterases in the detoxification of permethrin in the mosquito, Culex quinquefasciatus. Insect Sci. 2022, 29, 199–214. [Google Scholar] [CrossRef]
  56. Gong, Y.H.; Ai, G.M.; Li, M.; Shi, X.Y.; Diao, Q.Y.; Gao, X.W. Functional characterization of carboxylesterase gene mutations involved in Aphis gossypii resistance to organophosphate insecticides. Insect Mol. Biol. 2017, 26, 702–714. [Google Scholar] [CrossRef]
  57. Li, R.; Zhu, B.; Liang, P.; Gao, X. Identification of carboxylesterase genes contributing to multi-insecticide resistance in Plutella xylostella (L.). Entomol. Gen. 2022, 42, 967–976. [Google Scholar] [CrossRef]
  58. Li, X.; Li, R.; Zhu, B.; Gao, X.; Liang, P. Overexpression of cytochrome P450 CYP6BG1 may contribute to chlorantraniliprole resistance in Plutella xylostella (L.). Pest. Manag. Sci. 2018, 74, 1386–1393. [Google Scholar] [CrossRef]
  59. Tian, K.; Feng, J.; Zhu, J.; Cheng, J.; Li, M.; Qiu, X. Pyrethrin-resembling pyrethroids are metabolized more readily than heavily modified ones by CYP9As from Helicoverpa armigera. Pestic. Biochem. Physiol. 2021, 176, 104871. [Google Scholar] [CrossRef]
  60. Wang, X.; Chen, Y.; Gong, C.; Yao, X.; Jiang, C.; Yang, Q. Molecular identification of four novel cytochrome P450 genes related to the development of resistance of Spodoptera exigua (Lepidoptera: Noctuidae) to chlorantraniliprole. Pest. Manag. Sci. 2018, 74, 1938–1952. [Google Scholar] [CrossRef]
  61. Wei, Z.-H.; Wang, X.-Q.; Li, P.-R.; Tan, X.-L.; Yang, X.-Q. Diet-mediated effects of cadmium on the fitness-related traits and detoxification and antioxidative enzymes in the oriental armyworm, Mythimna separata. Entomol. Gen. 2020, 40, 407–419. [Google Scholar] [CrossRef]
  62. Xu, D.; Liao, H.; Li, L.; Wu, M.; Xie, W.; Wu, Q.; Zhang, Y.; Zhou, X.; Wang, S. The CYP392D8 gene is not directly associated with abamectin resistance, a case study in two highly resistant Tetranychus urticae strains. Entomol. Gen. 2022. [Google Scholar] [CrossRef]
  63. Zeng, X.; Pan, Y.; Song, J.; Li, J.; Lv, Y.; Gao, X.; Tian, F.; Peng, T.; Xu, H.; Shang, Q. Resistance risk assessment of the ryanoid anthranilic diamide insecticide cyantraniliprole in Aphis gossypii Glover. J. Agric. Food Chem. 2021, 69, 5849–5857. [Google Scholar] [CrossRef] [PubMed]
  64. Zhang, Z.; Wen, Z.; Li, K.; Xu, W.; Liang, N.; Yu, X.; Li, C.; Chu, D.; Guo, L. Cytochrome P450 Gene, CYP6CX3, Is Involved in the Resistance to Cyantraniliprole in Bemisia tabaci. J. Agric. Food Chem. 2022, 70, 12398–12407. [Google Scholar] [CrossRef] [PubMed]
Toxics 11 00332 g001 550
Figure 1. Comparison of the amino acid sequences of target genes between Ostrinia furnacalis and other species to locate the amino acid site of resistance mutation. (A) For A201S mutation, Ace1 gene amino acid sequence of O. furnacalis was compared with Chilo suppressalis [18]; (B) for F331Y/W mutation in Acetylcholinesterase 1 gene, amino acid sequence of O. furnacalis was compared with Tetranychus evansi [39]; (C) for I4790M mutation in Ryanodine receptors gene (RyR), amino acid sequence of O. furnacalis was compared with Plutella xylostella [24]; (D) for G4946E mutation in RyR gene, amino acid sequence of O. furnacalis was compared with Plutella xylostella [23]; (E) for L1014F mutation in voltage-gated sodium channel (VGSC) gene, amino acid sequence of O. furnacalis was compared with Musca domestica [28]; (F) for 234-site Y insert in ABC transporter (ABCC2) gene, amino acid sequence of O. furnacalis was compared with Bombyx mori [37].
Figure 1. Comparison of the amino acid sequences of target genes between Ostrinia furnacalis and other species to locate the amino acid site of resistance mutation. (A) For A201S mutation, Ace1 gene amino acid sequence of O. furnacalis was compared with Chilo suppressalis [18]; (B) for F331Y/W mutation in Acetylcholinesterase 1 gene, amino acid sequence of O. furnacalis was compared with Tetranychus evansi [39]; (C) for I4790M mutation in Ryanodine receptors gene (RyR), amino acid sequence of O. furnacalis was compared with Plutella xylostella [24]; (D) for G4946E mutation in RyR gene, amino acid sequence of O. furnacalis was compared with Plutella xylostella [23]; (E) for L1014F mutation in voltage-gated sodium channel (VGSC) gene, amino acid sequence of O. furnacalis was compared with Musca domestica [28]; (F) for 234-site Y insert in ABC transporter (ABCC2) gene, amino acid sequence of O. furnacalis was compared with Bombyx mori [37].
Toxics 11 00332 g001
Toxics 11 00332 g002 550
Figure 2. PCR amplification of DNA containing the resistance mutations. We display one figure per mutation with amplification size, which indicates that the DNA fragments containing the corresponding desired mutations were amplified as expected: (A) A201S and F331Y/W in Acetylcholinesterase Ace1; (B) L1014F in voltage-gated sodium channel (VGSC); (C) G4946E in ryanodine receptors (RyR); (D) I4790M in RyR; and (E) 234Y insertion in ABC transporter (ABCC2).
Figure 2. PCR amplification of DNA containing the resistance mutations. We display one figure per mutation with amplification size, which indicates that the DNA fragments containing the corresponding desired mutations were amplified as expected: (A) A201S and F331Y/W in Acetylcholinesterase Ace1; (B) L1014F in voltage-gated sodium channel (VGSC); (C) G4946E in ryanodine receptors (RyR); (D) I4790M in RyR; and (E) 234Y insertion in ABC transporter (ABCC2).
Toxics 11 00332 g002
Toxics 11 00332 g003 550
Figure 3. Representative chromatograms of the insecticide resistance mutations examined in Asian corn borer collected in 2019–2021 from China. Black wireframe indicates the site of the examined mutation in the DNA sequence and the nucleotide codon (amino acid) of the examined mutation in all tested samples: (A) for the A201S mutation; (B) for F331Y/W; (C) for the G4946E mutation; (D) for the I4790M mutation; (E) for the L1014F mutation; and (F) for the 234Y insertion.
Figure 3. Representative chromatograms of the insecticide resistance mutations examined in Asian corn borer collected in 2019–2021 from China. Black wireframe indicates the site of the examined mutation in the DNA sequence and the nucleotide codon (amino acid) of the examined mutation in all tested samples: (A) for the A201S mutation; (B) for F331Y/W; (C) for the G4946E mutation; (D) for the I4790M mutation; (E) for the L1014F mutation; and (F) for the 234Y insertion.
Toxics 11 00332 g003
Table
Table 1. Location and number of Ostrinia furnacalis samples collected in 2019–2021 in China.
Table 1. Location and number of Ostrinia furnacalis samples collected in 2019–2021 in China.
Year Province
and Municipality		LocationLongitude,
Latitude		Number
Tested
2019GuizhouBijie 105.92° E, 26.84° N50
SichuanChongzhou103.67° E, 30.63° N50
AnhuiBengbu116.8° E, 33.02° N60
HebeiHengshui115.28° E, 37.32° N45
TianjingWuqing117.03° E, 39.22° N50
LiaoningShenyang123.56° E, 41.82° N30
2020YunnanPuer101.38° E, 22.33° N25
GuizhouBijie 105.92° E, 26.84° N49
ChongqingWushan109.86° E, 31.1° N30
SichuanChongzhou103.67° E, 30.63° N45
JiangxiYongxiu115.81° E, 29.02° N50
AnhuiBengbu116.8° E, 33.02° N50
JiangsuBinghai119.95° E, 34.1° N45
HenanNanyang112.8° E, 32.68° N30
Shandong Changqing116.75° E, 36.55° N50
HebeiHengshui115.28° E, 37.32° N30
TianjinWuqing117.03° E, 39.22° N50
LiaoningShenyang123.56° E, 41.82° N35
Liaoning aShenyang123.56° E, 41.82° N35
2021JiangxiYongxiu115.81° E, 29.02° N40
AnhuiBengbu116.8° E, 33.02° N50
ShandongChangqing116.8° E, 33.02° N40
HebeiHengshui115.28° E, 37.32° N50
TianjinWuqing117.03° E, 39.22° N35
a: the population was collected in Liaoning province in 2020 from the experimental plots planting the transgenic corn expressing the Bt Cry1Ab protein, kindly provided by Dr. Xueqing Yang (Shenyang Agricultural University).
Table
Table 2. The basic information of mutations examined in the present study.
Table 2. The basic information of mutations examined in the present study.
Insecticide ClassTarget GeneMutationsReferences
Organophosphorus/CarbamateAcetylcholinesterase (AchEs)A201S, F331Y/W[18,19,20]
diamide insecticidesryanodine receptors (RyR)G4946E, I4790M[22,23,24]
Pyrethroidsvoltage-gated sodium channel (VGSC)Kdr L1014F[28,30,31]
Bt toxin (Cry Ab)ABC transporter (ABCC2)234 site Y insert[37]
Table
Table 3. The primer pairs used for amplification of a region containing key SNPs and the primers used in sequencing.
Table 3. The primer pairs used for amplification of a region containing key SNPs and the primers used in sequencing.
MutationsPrimer PairsSize of PCR Products (bp) Sequencing Primer
Ace1-A201SForward: ATCGTGTTGCATCACTTGGA
Reverse: CTGTTGCCGTTCCAGATTGC		246Forward primer
Ace1-F331Y/WForward: CAACAACGAGTGGGGTACCTT
Reverse: CTCGAACACTATCGCCTGCC		292Reverse primer
RyR-G4946EForward: GACTGGCGCTACCAAGTGT
Reverse: ATGCGTGACAGACTGCAAGA		181Forward primer
RyR-I4790MForward: GAAGTGGTGCACATAGACGAAGA
Reverse: GTGATCTCACCTTAAGATGGTAGTACC		124Forward primer
Kdr-L1014FForward: GGAACTTTACAGATTTCATGCACA
Reverse: TCTTAACGTTTTTGGTAATCAAG		191Forward primer
234Y-insertionForward: CGGCAAGCTCGTGAATCTTTTG
Reverse: CGGCCTGTATTGGCGTTATCAA		188Forward primer
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Gong, Y.; Li, T.; Xiu, X.; Desneux, N.; Hou, M. Lack of Known Target-Site Mutations in Field Populations of Ostrinia furnacalis in China from 2019 to 2021. Toxics 2023, 11, 332. https://doi.org/10.3390/toxics11040332

AMA Style

Gong Y, Li T, Xiu X, Desneux N, Hou M. Lack of Known Target-Site Mutations in Field Populations of Ostrinia furnacalis in China from 2019 to 2021. Toxics. 2023; 11(4):332. https://doi.org/10.3390/toxics11040332

Chicago/Turabian Style

Gong, Youhui, Ting Li, Xiaojian Xiu, Nicolas Desneux, and Maolin Hou. 2023. "Lack of Known Target-Site Mutations in Field Populations of Ostrinia furnacalis in China from 2019 to 2021" Toxics 11, no. 4: 332. https://doi.org/10.3390/toxics11040332

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop