Differences in Biofilm Formation of Listeria monocytogenes and Their Effects on Virulence and Drug Resistance of Different Strains
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Activation
2.2. Detection of the Biofilm-Forming Capacity of L. monocytogenes
2.3. Observation of Biofilm Morphology of L. monocytogenes
2.4. Determination of Surface Hydrophobicity of L. monocytogenes (Microbial Hydrocarbon Adsorption Capacity Method)
2.5. Determination of the Self-Agglutination Rate of L. monocytogenes Strains
2.6. Determination of Protein Content in Biofilms of L. monocytogenes
2.7. Determination of Exopolysaccharide Content in Biofilm of L. monocytogenes (Phenol-Sulfuric Acid Method)
2.8. Determination of Extracellular DNA Content in Biofilms of L. monocytogenes
2.9. Detection of Drug Resistance of L. monocytogenes before and after Film-Forming
2.10. Effects of L. monocytogenes on Cell Adhesion and Invasion before and after Film-Forming
2.11. Detection of Gene Expression Related to Biofilm Formation of L. monocytogenes
2.12. Statistical Analysis
3. Results
3.1. Detection of the Biofilm-Forming Capacity of L. monocytogenes
3.2. Observation of Biofilm Morphology of L. monocytogenes by Fluorescence Microscopy
3.3. Detection of L. monocytogenes Hydrophobicity and Self-Coagulation Capacity
3.4. Detection of Extracellular Polymers in Biofilms of L. monocytogenes
3.5. Effect of L. monocytogenes on Cell Adhesion Invasion before and after Film-Forming
3.6. Detection of Drug Resistance of L. monocytogenes before and after Film-Forming
3.7. Detection of Gene Expression Related to Biofilm Formation of L. monocytogenes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- den Bakker, H.C.; Fortes, E.D.; Wiedmann, M. Multilocus sequence typing of outbreak-associated Listeria monocytogenes isolates to identify epidemic clones. Foodborne Pathog. Dis. 2010, 7, 257–265. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.; Cheng, J.; Zhang, J.; Chen, Y.; Zeng, H.; Xue, L.; Lei, T.; Pang, R.; Wu, S.; Wu, H.; et al. Isolation, Potential Virulence, and Population Diversity of Listeria monocytogenes From Meat and Meat Products in China. Front. Microbiol. 2019, 10, 946. [Google Scholar] [CrossRef] [PubMed]
- Johnson, J.; Jinneman, K.; Stelma, G.; Smith, B.G.; Lye, D.; Messer, J.; Ulaszek, J.; Evsen, L.; Gendel, S.; Bennett, R.W.; et al. Natural atypical Listeria innocua strains with Listeria monocytogenes pathogenicity island 1 genes. Appl. Environ. Microbiol. 2004, 70, 4256–4266. [Google Scholar] [CrossRef] [PubMed]
- Charlier, C.; Perrodeau, É.; Leclercq, A.; Cazenave, B.; Pilmis, B.; Henry, B.; Lopes, A.; Maury, M.M.; Moura, A.; Goffinet, F.; et al. Clinical features and prognostic factors of listeriosis: The MONALISA national prospective cohort study. Lancet Infect. Dis. 2017, 17, 510–519. [Google Scholar] [CrossRef]
- Shoai-Tehrani, M.; Pilmis, B.; Maury, M.M.; Robineau, O.; Disson, O.; Jouvion, G.; Coulpier, G.; Thouvenot, P.; Bracq-Dieye, H.; Valès, G.; et al. Listeria monocytogenes-associated endovascular infections: A study of 71 consecutive cases. J. Infect. 2019, 79, 322–331. [Google Scholar] [CrossRef] [PubMed]
- Doijad, S.P.; Barbuddhe, S.B.; Garg, S.; Poharkar, K.V.; Kalorey, D.R.; Kurkure, N.V.; Rawool, D.B.; Chakraborty, T. Biofilm-Forming Abilities of Listeria monocytogenes Serotypes Isolated from Different Sources. PLoS ONE 2015, 10, e0137046. [Google Scholar] [CrossRef]
- Rodríguez-López, P.; Saá-Ibusquiza, P.; Mosquera-Fernández, M.; López-Cabo, M. Listeria monocytogenes-carrying consortia in food industry. Composition, subtyping and numerical characterisation of mono-species biofilm dynamics on stainless steel. Int. J. Food Microbiol. 2015, 206, 84–95. [Google Scholar] [CrossRef] [PubMed]
- Jiang, X.; Yu, T.; Xu, Y.; Wang, H.; Korkeala, H.; Shi, L. MdrL, a major facilitator superfamily efflux pump of Listeria monocytogenes involved in tolerance to benzalkonium chloride. Appl. Microbiol. Biotechnol. 2019, 103, 1339–1350. [Google Scholar] [CrossRef]
- Sutherland, I. Biofilm exopolysaccharides: A strong and sticky framework. Microbiology 2001, 147, 3–9. [Google Scholar] [CrossRef]
- Xu, Z.; Liu, Z.; Soteyome, T.; Hua, J.; Zhang, L.; Yuan, L.; Ye, Y.; Cai, Z.; Yang, L.; Chen, L.; et al. Impact of pmrA on Cronobacter sakazakii planktonic and biofilm cells: A comprehensive transcriptomic study. Food Microbiol. 2021, 98, 103785. [Google Scholar] [CrossRef]
- Sauer, K.; Camper, A.K.; Ehrlich, G.D.; Costerton, J.W.; Davies, D.G. Pseudomonas aeruginosa displays multiple phenotypes during development as a biofilm. J. Bacteriol. 2002, 184, 1140–1154. [Google Scholar] [CrossRef]
- Borghi, E.; Sciota, R.; Biassoni, C.; Cirasola, D.; Cappelletti, L.; Vizzini, L.; Boracchi, P.; Morace, G. Cell surface hydrophobicity: A predictor of biofilm production in Candida isolates? J. Med. Microbiol. 2011, 60, 689–690. [Google Scholar] [CrossRef]
- Heo, K.; Park, Y.H.; Lee, K.A.; Kim, J.; Ham, H.I.; Kim, B.G.; Lee, W.J.; Seok, Y.J. Sugar-mediated regulation of a c-di-GMP phosphodiesterase in Vibrio cholerae. Nat. Commun. 2019, 10, 5358. [Google Scholar] [CrossRef] [PubMed]
- Sela, S.; Frank, S.; Belausov, E.; Pinto, R. A Mutation in the luxS gene influences Listeria monocytogenes biofilm formation. Appl. Environ. Microbiol. 2006, 72, 5653–5658. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Parvathi, A.; George, J.; Krohne, G.; Karunasagar, I.; Karunasagar, I. A study on the effects of some laboratory-derived genetic mutations on biofilm formation by Listeria monocytogenes. World J. Microbiol. Biotechnol. 2009, 25, 527–531. [Google Scholar] [CrossRef]
- Shi, C.; Zheng, L.; Lu, Z.; Zhang, X.; Bie, X. The global regulator SpoVG regulates Listeria monocytogenes biofilm formation. Microb. Pathog. 2023, 180, 106144. [Google Scholar] [CrossRef] [PubMed]
- Jiang, X.; Ren, S.; Geng, Y.; Jiang, C.; Liu, G.; Wang, H.; Yu, T.; Liang, Y. Role of the VirSR-VirAB system in biofilm formation of Listeria monocytogenes EGD-e. Food Res. Int. 2021, 145, 110394. [Google Scholar] [CrossRef] [PubMed]
- Yao, H.; Kang, M.; Wang, Y.; Feng, Y.; Kong, S.; Cai, X.; Ling, Z.; Chen, S.; Jiao, X.; Yin, Y. An essential role for hfq involved in biofilm formation and virulence in serotype 4b Listeria monocytogenes. Microbiol. Res. 2018, 215, 148–154. [Google Scholar] [CrossRef] [PubMed]
- Beule, A.G.; Hosemann, W. Bacterial biofilms. Laryngorhinootologie 2007, 86, 886–895. [Google Scholar] [CrossRef]
- Wickramasinghe, N.N.; Ravensdale, J.; Coorey, R.; Dykes, G.A.; Chandry, P.S. Transcriptional profiling of biofilms formed on chilled beef by psychrotrophic meat spoilage bacterium, Pseudomonas fragi 1793. Biofilm 2021, 3, 100045. [Google Scholar] [CrossRef]
- Crespo Tapia, N.; den Besten, H.M.W.; Abee, T. Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface. Int. J. Food Microbiol. 2018, 273, 20–27. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Sun, X.; Niu, B.; Jiang, Y.; Yang, J.; Chen, Q. Exopolysaccharide related gene bcsG affects biofilm formation of Cronobacter spp. Int. Dairy J. 2020, 111, 104844. [Google Scholar] [CrossRef]
- Mukherjee, R.M.; Maitra, T.K.; Haldar, D.P.; Jalan, K.N. Adherence of Entamoeba histolytica to hydrophobic matrices: A simple method for measuring cell surface hydrophobicity. Trans. R. Soc. Trop. Med. Hyg. 1993, 87, 492–493. [Google Scholar] [CrossRef]
- Matczak, S.; Bouchez, V.; Leroux, P.; Douché, T.; Collinet, N.; Landier, A.; Gianetto, Q.G.; Guillot, S.; Chamot-Rooke, J.; Hasan, M.; et al. Biological differences between FIM2 and FIM3 fimbriae of Bordetella pertussis: Not just the serotype. Microbes Infect. 2023, 25, 105152. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.Y.; Deng, J.Y.; Gu, J.; Zhang, Z.P.; Maxwell, A.; Bi, L.J.; Chen, Y.Y.; Zhou, Y.F.; Yu, Z.N.; Zhang, X.E. The key DNA-binding residues in the C-terminal domain of Mycobacterium tuberculosis DNA gyrase A subunit (GyrA). Nucleic Acids Res. 2006, 34, 5650–5659. [Google Scholar] [CrossRef] [PubMed]
- Masuko, T.; Minami, A.; Iwasaki, N.; Majima, T.; Nishimura, S.; Lee, Y.C. Carbohydrate analysis by a phenol-sulfuric acid method in microplate format. Anal. Biochem. 2005, 339, 69–72. [Google Scholar] [CrossRef] [PubMed]
- Bao, Y.; Zhang, X.; Jiang, Q.; Xue, T.; Sun, B. Pfs promotes autolysis-dependent release of eDNA and biofilm formation in Staphylococcus aureus. Med. Microbiol. Immunol. 2015, 204, 215–226. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Zhu, W.; Qin, N.; Ren, X.; Xia, X. Propionate and Butyrate Inhibit Biofilm Formation of Salmonella Typhimurium Grown in Laboratory Media and Food Models. Foods 2022, 11, 3493. [Google Scholar] [CrossRef]
- Nie, M.; Dong, Y.; Cao, Q.; Zhao, D.; Ji, S.; Huang, H.; Jiang, M.; Liu, G.; Liu, Y. CRISPR Contributes to Adhesion, Invasion, and Biofilm Formation in Streptococcus agalactiae by Repressing Capsular Polysaccharide Production. Microbiol. Spectr. 2022, 10, e0211321. [Google Scholar] [CrossRef]
- Gallardo-Moreno, A.M.; González-Martín, M.L.; Pérez-Giraldo, C.; Garduño, E.; Bruque, J.M.; Gómez-García, A.C. Thermodynamic analysis of growth temperature dependence in the adhesion of Candida parapsilosis to polystyrene. Appl. Environ. Microbiol. 2002, 68, 2610–2613. [Google Scholar] [CrossRef]
- Lee, K.J.; Kim, J.A.; Hwang, W.; Park, S.J.; Lee, K.H. Role of capsular polysaccharide (CPS) in biofilm formation and regulation of CPS production by quorum-sensing in Vibrio vulnificus. Mol. Microbiol. 2013, 90, 841–857. [Google Scholar] [CrossRef]
- Powell, L.C.; Pritchard, M.F.; Ferguson, E.L.; Powell, K.A.; Patel, S.U.; Rye, P.D.; Sakellakou, S.M.; Buurma, N.J.; Brilliant, C.D.; Copping, J.M.; et al. Targeted disruption of the extracellular polymeric network of Pseudomonas aeruginosa biofilms by alginate oligosaccharides. NPJ Biofilms Microbiomes 2018, 4, 13. [Google Scholar] [CrossRef] [PubMed]
- Sadovskaya, I.; Vinogradov, E.; Flahaut, S.; Kogan, G.; Jabbouri, S. Extracellular carbohydrate-containing polymers of a model biofilm-producing strain, Staphylococcus epidermidis RP62A. Infect. Immun. 2005, 73, 3007–3017. [Google Scholar] [CrossRef] [PubMed]
- Köseoğlu, V.K.; Heiss, C.; Azadi, P.; Topchiy, E.; Güvener, Z.T.; Lehmann, T.E.; Miller, K.W.; Gomelsky, M. Listeria monocytogenes exopolysaccharide: Origin, structure, biosynthetic machinery and c-di-GMP-dependent regulation. Mol. Microbiol. 2015, 96, 728–743. [Google Scholar] [CrossRef]
- Longhi, C.; Scoarughi, G.L.; Poggiali, F.; Cellini, A.; Carpentieri, A.; Seganti, L.; Pucci, P.; Amoresano, A.; Cocconcelli, P.S.; Artini, M.; et al. Protease treatment affects both invasion ability and biofilm formation in Listeria monocytogenes. Microb. Pathog. 2008, 45, 45–52. [Google Scholar] [CrossRef] [PubMed]
- Reichhardt, C.; Jacobs, H.M.; Matwichuk, M.; Wong, C.; Wozniak, D.J.; Parsek, M.R. The Versatile Pseudomonas aeruginosa Biofilm Matrix Protein CdrA Promotes Aggregation through Different Extracellular Exopolysaccharide Interactions. J. Bacteriol. 2020, 202, e00216-20. [Google Scholar] [CrossRef]
- Reichhardt, C.; Wong, C.; Passos da Silva, D.; Wozniak, D.J.; Parsek, M.R. CdrA Interactions within the Pseudomonas aeruginosa Biofilm Matrix Safeguard It from Proteolysis and Promote Cellular Packing. mBio 2018, 9, e01376-18. [Google Scholar] [CrossRef] [PubMed]
- Harmsen, M.; Lappann, M.; Knøchel, S.; Molin, S. Role of extracellular DNA during biofilm formation by Listeria monocytogenes. Appl. Environ. Microbiol. 2010, 76, 2271–2279. [Google Scholar] [CrossRef] [PubMed]
- Vilain, S.; Pretorius, J.M.; Theron, J.; Brözel, V.S. DNA as an adhesin: Bacillus cereus requires extracellular DNA to form biofilms. Appl. Environ. Microbiol. 2009, 75, 2861–2868. [Google Scholar] [CrossRef]
- Wałecka-Zacharska, E.; Kosek-Paszkowska, K.; Bania, J.; Staroniewicz, Z.; Bednarski, M.; Wieliczko, A. Invasiveness of Listeria monocytogenes strains isolated from animals in Poland. Pol. J. Vet. Sci. 2015, 18, 697–702. [Google Scholar] [CrossRef]
- Suárez, M.; González-Zorn, B.; Vega, Y.; Chico-Calero, I.; Vázquez-Boland, J.A. A role for ActA in epithelial cell invasion by Listeria monocytogenes. Cell. Microbiol. 2001, 3, 853–864. [Google Scholar] [CrossRef] [PubMed]
- Kushwaha, K.; Muriana, P.M. Comparison of invasiveness among surface-adherent variants of Listeria monocytogenes in Caco-2 cell culture assays. Int. J. Food Microbiol. 2009, 138, 166–171. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Wang, X.; Xia, X.; Yang, B.; Xi, M.; Meng, J. Isolation and characterization of Listeria monocytogenes isolates from retail foods in Shaanxi Province, China. Foodborne Pathog. Dis. 2013, 10, 867–872. [Google Scholar] [CrossRef] [PubMed]
- Pagliano, P.; Arslan, F.; Ascione, T. Epidemiology and treatment of the commonest form of listeriosis: Meningitis and bacteraemia. Infez. Med. 2017, 25, 210–216. [Google Scholar]
- Temple, M.E.; Nahata, M.C. Treatment of listeriosis. Ann. Pharmacother. 2000, 34, 656–661. [Google Scholar] [CrossRef] [PubMed]
- Saá Ibusquiza, P.; Herrera, J.J.; Cabo, M.L. Resistance to benzalkonium chloride, peracetic acid and nisin during formation of mature biofilms by Listeria monocytogenes. Food Microbiol. 2011, 28, 418–425. [Google Scholar] [CrossRef]
- Aurélie, R.; Stéphanie, W.; Dominique, G.; Pascal, P.; Jean, G. Agr system of Listeria monocytogenes EGD-e: Role in adherence and differential expression pattern. Appl. Environ. Microbiol. 2007, 73, 6125–6133. [Google Scholar]
- Zhang, X.; Lu, Z.; Zheng, L.; Lü, Z.; Zhou, L.; Meng, F.; Bie, X. Effect of Quorum Sensing Systems on Biofilm Formation by Listeria monocytogenes. Food Sci. 2022, 43, 105–112. [Google Scholar]
- Enos-Berlage, J.L.; Guvener, Z.T.; Keenan, C.E.; McCarter, L.L. Genetic determinants of biofilm development of opaque and translucent Vibrio parahaemolyticus. Mol. Microbiol. 2005, 55, 1160–1182. [Google Scholar] [CrossRef]
- Zaloba, P.; Bailey-Elkin, B.A.; Derksen, M.; Mark, B.L. Structural and Biochemical Insights into the Peptidoglycan Hydrolase Domain of FlgJ from Salmonella typhimurium. PLoS ONE 2016, 11, e0149204. [Google Scholar] [CrossRef]
- Franciosa, G.; Maugliani, A.; Scalfaro, C.; Floridi, F.; Aureli, P. Expression of internalin A and biofilm formation among Listeria monocytogenes clinical isolates. Int. J. Immunopathol. Pharmacol. 2009, 22, 183–193. [Google Scholar] [CrossRef] [PubMed]
Drugs | Abbreviation | Drugs | Abbreviation |
---|---|---|---|
Ampicillin | AMP | Sulfamethoxazole/Trimethoprim | T/SUL(SXT) |
Penicillin | PEN | Vancomycin | VAN |
Oxacillin | OXA | Tetracycline | TET |
Erythromycin | ERY | Chloramphenicol | CHL |
Clindamycin | CLI | Gentamicin | GEN |
Ciprofloxacin | CIP | Cefoxitin Mefoxin | FOX(CFX) |
Daptomycin | DAP | Imipenem | IPM |
Primer | Sequence (5′-3′) | Primer | Sequence (5′-3′) |
---|---|---|---|
16sRNA-F | AAAGAGAGTTTGATCCTGGCTC AGGACG | inlA-F | CGGTGGAATTCAGTATTCAAACTAGTTTTAATGG |
16sRNA-R | AAAGGAGGTGATCCAGCCGCAC | inlA-R | CTTTGATTGTTTTGCGGAGAATT AGCGTC |
luxS-F | GGCAGAAAAAATGAATGTAGAAAGTTTTAATTTAGACCAT | manX-F | GGTAGGAATTATCCTCGCAACTCACGG |
luxS-R | CACCAAACACATTTTTCCATT CGCTTCG | manX-R | GATGATATCTTCCATGTTAGCGC TTGAGTCA |
argA-F | GTGAAGATAACAGAATGCAG CGAGAAAGG | celA-F | TCATGTTAGTATGTTCAGCAGGT ATGTCTACC |
argA-R | CAAGCTTTTAATTAATTTCGATGATGCATAACAATTTTCAC | celA-R | CATTAACTCTAATGCTTGTTCTAAAACTTTGTCGCC |
argB-F | GTCCCTTTGTCAGAAAGAATGGCG | ptsH-F | ATGGAACAAGCAAGTTTTGTAGT AATCGATGA |
argB-R | CATAGTTCCGATACCTCCTTTTCAATAGTTTGT | ptsH-R | CAGCCAATCCTTCTTTCTTAAGAACTTCAGTTAG |
flgB-F | GTGGAAAATTACACCACGCATAT TGGC | pdeG-F | ATGAAAAAGCCCTCCGTACGTGA GATTATT |
flgB-R | TTACTTTCCACGGGCTGCTGTGT | pdeG-R | CCTTGCGCATAGGGAATGCCGATTT |
flgE-F | CTATGTATACAGCTATTTCTGGG ATGAATGCG | rpsC-F | GTACATCCAATAGGTATGCGTATCGGTG |
flgE-R | GTTCACAATTTGTTTCATCACGT CATCCGC | rpsC-R | CCTCCTTCCACATTGTTTTTCT TCGTAGG |
fliD-F | GTCAAGAACAAATTGACGCCCTGCT | rplB-F | GTATAAACCTACCACTAACGGGCGCC |
fliD-R | TAGAGCGGCGGCGTAACGTAC | rplB-R | ACGACGACGTACGATAAATTT ATCGGAG |
motB-F | GTGGCCAAGCGTCGCAAGAA | gatA-F | CGTAGTTTGTACAGTCTTCAGTA TCATCGG |
motB-R | CTACTCATCTTCATCAAGCG TATCGCG | gatA-R | CTATTTTGCGATTGTTGCTCATAGGCAT |
prfA-F | ATGAACGCTCAAGCAGAAGAATT CAAAAAAT | ||
prfA-R | CCCCAAGTAGCAGGACATGCTAAAT |
System Components | Volume/(μL) |
---|---|
cDNA template | 1 |
SYBR Premix | 12.5 |
Upstream and downstream primers (10 μM) | 2 |
DEPC | 9.5 |
Antibiotic | Status | MIC (μg/mL)/Sensitivity | ||||||
---|---|---|---|---|---|---|---|---|
ATCC 15313 | ATCC 10890 | ATCC 19111 | ATCC 19115 | CMCC (B) 54012 | ATCC BAA 751 | ATCC 19112 | ||
AMP | S | <0.125/S | 0.125/S | <0.125/S | 0.25/S | 0.25/S | 0.25/S | 1/S |
M | 2/S | 0.5/S | 1/S | 0.5/S | 0.5/S | 0.25/S | 1/S | |
PEN | S | 0.0625/S | 0.125/S | 0.0625/S | 0.5/S | 0.5/S | 0.25/S | 0.5/S |
M | 0.25/S | 0.125/S | 0.25/S | 1/S | 2/S | 0.25/S | 0.5/S | |
OXA | S | <0.25/S | 2/S | 0.5/S | 2/S | 2/S | 2/S | 1/S |
M | 2/S | 2/S | 0.5/S | 2/S | 2/S | 2/S | 2/S | |
ERY | S | 0.5/S | 0.25/S | 0.5/S | 1/I | 2/I | 1/I | 4/I |
M | 1/I | 2/I | 1/I | 2/I | 4/I | 8/R | 8/R | |
CLI | S | 0.25/S | 0.25/S | 1/I | 0.5/S | 2/I | 4/R | 2/I |
M | 1/I | 0.5/S | 2/I | 2/I | 2/I | 4/R | 2/I | |
CIP | S | 0.5/S | 0.5/S | 2/I | 4/R | 1/S | 1/S | 4/R |
M | 2/I | 1/S | 2/I | 4/R | 4/R | 2/I | 4/R | |
DAP | S | 0.125/S | 2/R | 1/S | 1/S | 1/S | 2/R | 1/S |
M | 1/S | 2/R | 1/S | 2/R | 2/R | 4/R | 4/R | |
T/SUL(SXT) | S | (0.25/ 4.75)/S | (0.25/ 4.75)/S | (0.25/ 4.75)/S | (0.25/ 4.75)/S | (0.25/ 4.75)/S | (0.25/ 4.75)/S | (0.25/ 4.75)/S |
M | (0.25/ 4.75)/S | (0.25/ 4.75)/S | (0.25/ 4.75)/S | (0.25/ 4.75)/S | (0.25/ 4.75)/S | (0.25/ 4.75)/S | (0.25 /4.75)/S | |
VAN | S | <0.5/S | 0.5/S | 0.5/S | 0.5/S | 0.5/S | 0.5/S | 0.5/S |
M | 1/S | 0.5/S | 2/S | 1/S | 1/S | 1/S | 2/S | |
TET | S | 8/I | 4/S | 16/R | 8/I | 8/I | 16/R | 8/I |
M | 8/I | 8/I | 16/R | 8/I | 8/I | 16/R | 16/R | |
CHL | S | 16/I | 8/S | 4/S | 4/S | 16/I | 8/S | 16/I |
M | 32/R | 8/S | 4/S | 16/I | 16/I | 16/I | 32/R | |
GEN | S | <1/S | 1/S | <1/S | <1/S | <1/S | <1/S | <1/S |
M | 4/S | 1/S | 2/S | 1/S | 4/S | 1/S | 1/S | |
FOX(CFX) | S | 4/S | >8/R | >8/R | >8/R | >8/R | >8/R | >8/R |
M | >8/R | >8/R | >8/R | >8/R | >8/R | >8/R | >8/R | |
IPM | S | <1/S | <1/S | <1/S | <1/S | <1/S | 2/S | <1/S |
M | 1/S | 1/S | 1/S | 2/S | 1/S | 8/I | 1/S |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, Y.; Kong, X.; Niu, B.; Yang, J.; Chen, Q. Differences in Biofilm Formation of Listeria monocytogenes and Their Effects on Virulence and Drug Resistance of Different Strains. Foods 2024, 13, 1076. https://doi.org/10.3390/foods13071076
Yang Y, Kong X, Niu B, Yang J, Chen Q. Differences in Biofilm Formation of Listeria monocytogenes and Their Effects on Virulence and Drug Resistance of Different Strains. Foods. 2024; 13(7):1076. https://doi.org/10.3390/foods13071076
Chicago/Turabian StyleYang, Yujuan, Xiangxiang Kong, Bing Niu, Jielin Yang, and Qin Chen. 2024. "Differences in Biofilm Formation of Listeria monocytogenes and Their Effects on Virulence and Drug Resistance of Different Strains" Foods 13, no. 7: 1076. https://doi.org/10.3390/foods13071076