Visual Loop-Mediated Isothermal Amplification (LAMP) Assay for Rapid On-Site Detection of Escherichia coli O157: H7 in Milk Products
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents and Materials
2.2. Strain Culture and DNA Extraction
2.3. LAMP Primer Design
2.4. LAMP System Optimization
2.5. Feasibility Detection
2.6. Optimization of Dye Concentration
2.7. Selection of Gold Nanoparticle Size
2.8. Optimization of LAMP-ICTs Assay
2.9. Specificity and Sensitivity Detection in the Bacterial Solution
2.10. Detection of E. coli O157: H7 in Milk Samples
3. Results and Discussion
3.1. Primer Screening
3.2. Optimization of LAMP Reaction
3.3. Visual Detection Principle
3.4. Feasibility Detection
3.5. Selection of AuNPs with Different Particle Sizes
3.6. Optimization of ICTs Conditions
3.7. Analysis Performance for E. coli O157:H7
3.8. Analysis Performance in Milk Samples
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bolten, S.; Belias, A.; Weigand, K.A.; Pajor, M.; Qian, C.; Ivanek, R.; Wiedmann, M. Population dynamics of Listeria spp., Salmonella spp., and Escherichia coli on fresh produce: A scoping review. Compr. Rev. Food. Sci. Food Saf. 2023, 22, 4537–4572. [Google Scholar] [CrossRef]
- Xedzro, C.; Kimura, T.; Shimamoto, T.; Ahmed, A.M.; Shimamoto, T. Comparative molecular profiling of antimicrobial resistance and phylogenetic characterization of multidrug-resistant Escherichia coli isolated from meat sources in 2009 and 2021 in Japan. Int. J. Food Microbiol. 2023, 391–393, 110146. [Google Scholar] [CrossRef] [PubMed]
- Coulombe, G.; Catford, A.; Martinez-Perez, A.; Buenaventura, E. Outbreaks of Escherichia coli O157:H7 Infections Linked to Romaine Lettuce in Canada from 2008 to 2018: An Analysis of Food Safety Context. J. Food Prot. 2020, 83, 1444–1462. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Qi, Y.; Feng, J.; Han, F.; Zhang, P.; Luo, L.; Zheng, Z.; Zhang, W.; Li, Z.; Tang, W. On-site monitoring of Escherichia coli O157:H7 in drinking water based on rapid detection of the rfbE gene at the single copy level. Sens. Actuat. B-Chem. 2024, 401, 135069. [Google Scholar] [CrossRef]
- Batra, A.R.; Dike, C.C.; Mantri, N.; Ball, A.S. Recombinase polymerase amplification-lateral flow assay (RPA-LFA) as a rapid and sensitive test for Escherichia coli O157:H7 detection in food and beverage: A comparative study. Food Control 2024, 155, 110076. [Google Scholar] [CrossRef]
- Li, T.; Ou, G.; Chen, X.; Li, Z.; Hu, R.; Li, Y.; Yang, Y.; Liu, M. Naked-eye based point-of-care detection of E. coli O157: H7 by a signal-amplified microfluidic aptasensor. Anal. Chim. Acta 2020, 1130, 20–28. [Google Scholar] [CrossRef]
- Costa-Ribeiro, A.; Azinheiro, S.; Fernandes, S.P.S.; Lamas, A.; Prado, M.; Salonen, L.M.; Garrido-Maestu, A. Evaluation of Covalent Organic Frameworks for the low-cost, rapid detection of Shiga Toxin-producing Escherichia coli in ready-to-eat salads. Anal. Chim. Acta 2023, 1267, 341357. [Google Scholar] [CrossRef]
- Jaroni, D.A.; Saha, J.; Rumbaugh, K.; Marshall, R.W. Identification of Contamination Sources and Assessment of Risk Factors Associated with the Occurrence of Escherichia coli O157:H7 on Small-scale Cow-calf Operations in Oklahoma and Louisiana. J. Food Prot. 2023, 86, 100156. [Google Scholar] [CrossRef]
- Li, Y.; Chen, H.; Shu, M.; Zhong, C.; Bi, Y.; Yang, H.; Wu, G. Isolation, characterization and application of an alkaline resistant virulent bacteriophage JN01 against Escherichia coli O157:H7 in milk and beef. LWT 2021, 144, 111266. [Google Scholar] [CrossRef]
- Fang, T.; Shen, J.; Xue, J.; Jiang, Y.; Guo, D.; Yang, J.; Kong, X.; Xu, X.; Wang, X. Sensitive and Rapid Detection of Escherichia coli O157:H7 From Beef Samples Based on Recombinase Aided Amplification Assisted CRISPR/Cas12a System. J. AOAC Int. 2022, 106, 156–164. [Google Scholar] [CrossRef]
- Xia, J.; Bu, T.; Jia, P.; He, K.; Wang, X.; Sun, X.; Wang, L. Polydopamine nanospheres-assisted direct PCR for rapid detection of Escherichia coli O157:H7. Anal. Biochem. 2022, 654, 114797. [Google Scholar] [CrossRef]
- Chen, B.; Tao, Q.; OuYang, S.; Wang, M.; Liu, Y.; Xiong, X.; Liu, S. Biocathodes reducing oxygen in BPE-ECL system for rapid screening of E. coli O157:H7. Biosens. Bioelectron. 2023, 221, 114940. [Google Scholar] [CrossRef]
- Jing, X.; Shan, S.; Xing, K.; Cao, W.; Xiao, X.; Liu, D.; Lai, W. Sensitive fluorescence ELISA with streptavidin scaffolded DNA tetrads for the detection of Escherichia coli O157:H7. J. Dairy Sci. 2023, 106, 5930–5939. [Google Scholar] [CrossRef] [PubMed]
- Yinur, D.; Moges, B.; Hassen, A.; Tessema, T.S. Loop mediated isothermal amplification as a molecular diagnostic assay: Application and evaluation for detection of Enterohaemorrhagic Escherichia coli (O157:H7). Pract. Lab. Med. 2023, 37, e333. [Google Scholar] [CrossRef]
- Notomi, T.H.O.H. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 12, 63e. [Google Scholar] [CrossRef] [PubMed]
- Garg, N.; Ahmad, F.J.; Kar, S. Recent advances in loop-mediated isothermal amplification (LAMP) for rapid and efficient detection of pathogens. Curr. Res. Microb. Sci. 2022, 3, 100120. [Google Scholar] [CrossRef] [PubMed]
- ISO 16654; Microbiology of Food and Animal Feeding Stuffs—Horizontal Method for the Detection of Escherichia coli O157. International Organization for Standardization: Geneva, Switzerland, 2003.
- Incili, G.K.; Koluman, A.; Aktüre, A.; Ataşalan, A. Validation and verification of LAMP, ISO, and VIDAS UP methods for detection of Escherichia coli O157:H7 in different food matrices. J. Microbiol. Methods 2019, 165, 105697. [Google Scholar] [CrossRef]
- Zhang, X.; Lowe, S.B.; Gooding, J.J. Brief review of monitoring methods for loop-mediated isothermal amplification (LAMP). Biosens. Bioelectron. 2014, 61, 491–499. [Google Scholar] [CrossRef] [PubMed]
- Tripathi, P.; Upadhyay, N.; Nara, S. Recent advancements in lateral flow immunoassays: A journey for toxin detection in food. Crit. Rev. Food Sci. Nutr. 2018, 58, 1715–1734. [Google Scholar] [CrossRef]
- Sohrabi, H.; Majidi, M.R.; Fakhraei, M.; Jahanban-Esfahlan, A.; Hejazi, M.; Oroojalian, F.; Baradaran, B.; Tohidast, M.; Guardia, M.D.L.; Mokhtarzadeh, A. Lateral flow assays (LFA) for detection of pathogenic bacteria: A small point-of-care platform for diagnosis of human infectious diseases. Talanta 2022, 243, 123330. [Google Scholar] [CrossRef]
- Zheng, C.; Wang, K.; Zheng, W.; Cheng, Y.; Li, T.; Cao, B.; Jin, Q.; Cui, D. Rapid developments in lateral flow immunoassay for nucleic acid detection. Analyst 2021, 146, 1514–1528. [Google Scholar] [CrossRef] [PubMed]
- Wen, Y.; Tan, Y.; Zhao, L.; Lv, X.; Lin, L.; Liang, D.; Wang, L. Rapid on-site detection of viable Escherichia coli O157: H7 in lettuce using immunomagnetic separation combined with PMAxx-LAMP and nucleic acid lateral flow strip. Microchem. J. 2022, 178, 107348. [Google Scholar] [CrossRef]
- Zhao, X.; Li, Y.; Wang, L.; You, L.; Xu, Z.; Li, L.; He, X.; Liu, Y.; Wang, J.; Yang, L. Development and application of a loop-mediated isothermal amplification method on rapid detection Escherichia coli O157 strains from food samples. Mol. Biol. Rep. 2010, 37, 2183–2188. [Google Scholar] [CrossRef] [PubMed]
- GB4789.6-2016; National Standard for Food Safety-Food Microbiology Test-Test for Diarrhea-Causing Escherichia coli. Ministry of Health of the People’s Republic of China, China Standard Press: Beijing, China, 2016.
- Ali, S.A.; Kaur, G.; Boby, N.; Sabarinath, T.; Solanki, K.; Pal, D.; Chaudhuri, P. Rapid and visual detection of Leptospira in urine by LigB-LAMP assay with pre-addition of dye. Mol. Cell. Probes 2017, 36, 29–35. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Zhao, Y.; Ma, C.; Wu, W.; Dong, M.; You, J.; Liu, J.; Yun, S. An optimized visual loop mediated isothermal amplification assay for efficient detection of minute virus of mice with hydroxynaphthol blue dye. J. Virol. Methods 2022, 308, 114575. [Google Scholar] [CrossRef]
- Zhou, B.; Liang, T.; Zhan, Z.; Liu, R.; Li, F.; Xu, H. Rapid and simultaneous quantification of viable Escherichia coli O157:H7 and Salmonella spp. in milk through multiplex real-time PCR. J. Dairy Sci. 2017, 100, 8804–8813. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.; Oh, S. A colorimetric lateral flow assay based on multiplex PCR for the rapid detection of viable Escherichia coli O157:H7 and Salmonella Typhimurium without enrichment. LWT 2021, 152, 112242. [Google Scholar] [CrossRef]
- Lv, X.; Wang, L.; Zhang, J.; Zeng, H.; Chen, X.; Shi, L.; Cui, H.; He, X.; Zhao, L. Rapid and sensitive detection of VBNC Escherichia coli O157: H7 in beef by PMAxx and real-time LAMP. Food Control 2020, 115, 107292. [Google Scholar] [CrossRef]
- Lee, S.; Oh, S. Filtration-based LAMP-CRISPR/Cas12a system for the rapid, sensitive and visualized detection of Escherichia coli O157:H7. Talanta 2022, 241, 123186. [Google Scholar] [CrossRef]
- Pang, L.; Wang, L.; Liang, Y.; Wang, Z.; Zhang, W.; Zhao, Q.; Yang, X.; Jiang, Y. G-triplex/hemin DNAzyme mediated colorimetric aptasensor for Escherichia coli O157:H7 detection based on exonuclease III-assisted amplification and aptamers-functionalized magnetic beads. Talanta 2024, 269, 125457. [Google Scholar] [CrossRef]
- Moon, Y.; Bae, J.; Kim, S.; Oh, S. Simultaneous detection using a portable multiplex PCR-dual lateral flow immunoassay for P. carotovorum subsp. brasiliense and E. coli O157:H7. Microchem. J. 2023, 195, 109396. [Google Scholar] [CrossRef]
- Dhital, R.; Mustapha, A. DNA concentration by solid phase reversible immobilization improves its yield and purity, and detection time of E. coli O157:H7 in foods by high resolution melt curve qPCR. Food Control 2023, 145, 109456. [Google Scholar] [CrossRef]
- Hu, S.; Liu, Y.; Liu, L.; Yu, Z.; Gan, N. Femtomolar endogenous adenosine triphosphate-responded photoelectrochemical biosensor based on Au@Cu2O core-shell nanocubes for the ultrasensitive determination of Escherichia coli O157:H7 in foods. Anal. Chim. Acta 2023, 1280, 341868. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Q.; Pan, J.; Mo, L.; Luo, Z.; Qin, Z.; Dai, Z.; Yi, C. Fluorescent on-site detection of multiple pathogens using smartphone-based portable device with paper-based isothermal amplification chip. Microchim. Acta 2022, 189, 333. [Google Scholar] [CrossRef]
- Xie, M.; Chen, T.; Xin, X.; Cai, Z.; Dong, C.; Lei, B. Multiplex detection of foodborne pathogens by real-time loop-mediated isothermal amplification on a digital microfluidic chip. Food Control 2022, 136, 108824. [Google Scholar] [CrossRef]
Gene | Primer Name | Sequence (5′-3′) | 5′-Labeled | Reference | |
---|---|---|---|---|---|
rfbE | E1 | F3 | CCACAAGGAAAGTAAAGATGTT | [23] | |
B3 | CCAACCAAGATCCTCAGC | ||||
FIP | CAAGGTGATTCCTTAATTCCTCTCTACACTTATTGGATGGTCTCA | digoxin | |||
BIP | AACTCATCGAAACAAGGCCAGGTGCTTTTGATATTTTTCCGAGTA | biotin | |||
E2 | F3 | TGGAATGGTTGTCACGAA | This study | ||
B3 | GCGATTTCACGTTTTCGT | ||||
FIP | TTGCCTATGTACAGCTAATCCTTGTTTTTGACAAAACACTTTATGACCG | digoxin | |||
BIP | ATTGGCATGACGTTATAGGCTACTTTTGCTTGTTCTAACTGGGCTAA | biotin | |||
stx2 | 21 | F3 | TCGGTGTCTGTTATTAACCA | [24] | |
B3 | TGGAAACCGTTGTCACA | ||||
FIP | AGACGAAGATGGTCAAAACGCGCAGTTATTTTGCTGTGGA | digoxin | |||
BIP | CCGGGTTCGTTAATACGGCACGGGCACTGATATATGTGT | biotin | |||
22 | F3 | CTGCTGTGACAGTGACAA | This study | ||
B3 | ACAACGGTTTCCATGACAA | ||||
FIP | TCATCATATCTGGCGTTAATGGAGTTTTCTGCTCTGGATGCATCTC | digoxin | |||
BIP | AACCAGTGAGTGACGACTGATTTTCGGACAGCAGTTATACCA | biotin | |||
LB | TTCCGGAACGTTCCAGCG |
Salmonella | E. coli O157: H7 | Listeria monocytosis | Staphylococcus aureus | Campylobacter jejuni | |
---|---|---|---|---|---|
1 | + | + | − | − | − |
2 | + | − | + | − | − |
3 | + | − | − | + | − |
4 | + | − | − | − | + |
5 | − | + | + | − | − |
6 | − | + | − | + | − |
7 | − | + | − | − | + |
8 | − | − | + | + | − |
9 | − | − | + | − | + |
10 | − | − | − | + | + |
Technique | Sample Type | Time | Limit of Detection | Reference |
---|---|---|---|---|
Fluorescence ELISA | Milk | ~5 h | 3.75 × 103 CFU mL−1 | [13] |
Colorimetric aptasensor | Milk | 250 min | 2.3 × 103 CFU mL−1 | [32] |
PCR+LFS | Carrot | 60 min | 102 CFU g−1 | [33] |
qPCR | Ground beef | ~4 h | 101 CFU mL−1 | [34] |
Photoelectrochemical biosensor | Milk, beef, fish | ~40 min | 5 CFU mL−1 | [35] |
Smartphone-based LAMP | Milk | 4 h | 101 CFU mL−1 | [36] |
LAMP+DMF | Spiked milk | 50 min | 103 CFU mL−1 | [37] |
LAMP-LFD | Lettuce | ~2 h | 101 CFU mL−1 | [23] |
Colorimetric LAMP | Milk | 40 min | 5.7 × 102 CFU mL−1 | This study |
LAMP-ICTs | Milk | 50 min | 5.7 × 102 CFU mL−1 | This study |
Group | Before (CFU mL−1) | Add (CFU mL−1) | After (CFU mL−1) | Recovery a (%) | RSD a (%) |
---|---|---|---|---|---|
1 | 0 | 0 | ND | - | - |
2 | 0 | 5.7 × 102 | 519 ± 36 | 91.1 | 6.94 |
3 | 0 | 5.7 × 103 | 5670 ± 475 | 99.5 | 8.38 |
4 | 0 | 5.7 × 104 | 58,979 ± 3359 | 103.5 | 5.70 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cui, S.; Wei, Y.; Li, C.; Zhang, J.; Zhao, Y.; Peng, X.; Sun, F. Visual Loop-Mediated Isothermal Amplification (LAMP) Assay for Rapid On-Site Detection of Escherichia coli O157: H7 in Milk Products. Foods 2024, 13, 2143. https://doi.org/10.3390/foods13132143
Cui S, Wei Y, Li C, Zhang J, Zhao Y, Peng X, Sun F. Visual Loop-Mediated Isothermal Amplification (LAMP) Assay for Rapid On-Site Detection of Escherichia coli O157: H7 in Milk Products. Foods. 2024; 13(13):2143. https://doi.org/10.3390/foods13132143
Chicago/Turabian StyleCui, Shuangshuang, Yong Wei, Can Li, Jian Zhang, Yunfeng Zhao, Xiayu Peng, and Fengxia Sun. 2024. "Visual Loop-Mediated Isothermal Amplification (LAMP) Assay for Rapid On-Site Detection of Escherichia coli O157: H7 in Milk Products" Foods 13, no. 13: 2143. https://doi.org/10.3390/foods13132143
APA StyleCui, S., Wei, Y., Li, C., Zhang, J., Zhao, Y., Peng, X., & Sun, F. (2024). Visual Loop-Mediated Isothermal Amplification (LAMP) Assay for Rapid On-Site Detection of Escherichia coli O157: H7 in Milk Products. Foods, 13(13), 2143. https://doi.org/10.3390/foods13132143