Effect of 2’-Fucosyllactose on Beige Adipocyte Formation in 3T3-L1 Adipocytes and C3H10T1/2 Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Cell Culture
2.3. MTT Assay
2.4. Oil Red O Staining
2.5. Triglyceride Content Analysis
2.6. Mitochondrial Content Analysis and UCP1 Immunofluorescence
2.7. Real-Time qPCR Analysis
2.8. Western Blot Analysis
2.9. Statistical Analysis
3. Results
3.1. Effects of 2’-FL on Cell Viability in 3T3-L1 Adipocytes and C3H10T1/2 Cells
3.2. 2’-FL Inhibited Lipid Accumulation in 3T3-L1 Adipocytes and C3H10T1/2 Cells
3.3. 2’-FL Induced Mitochondrial Biogenesis in 3T3-L1 Adipocytes and C3H10T1/2 Cells
3.4. 2’-FL Increased the mRNA and Protein Expression of Key Browning Markers in 3T3-L1 Adipocytes and C3H10T1/2 Cells
3.5. Effect of Compound C on 2’-FL -Induced Thermogenesis in 3T3-L1 and C3H10T1/2 Adipocytes
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Nedergaard, J.; Cannon, B. The browning of white adipose tissue: Some burning issues. Cell Metab. 2014, 20, 396–407. [Google Scholar] [CrossRef] [PubMed]
- Huang, T.T.; Drewnowski, A.; Kumanyika, S.K.; Glass, T.A. A systems-oriented multilevel framework for addressing obesity in the 21st century. Prev. Chronic Dis. 2009, 6, A82. [Google Scholar]
- Geng, J.; Ni, Q.; Sun, W.; Li, L.; Feng, X. The links between gut microbiota and obesity and obesity related diseases. Biomed. Pharmacother. 2022, 147, 112678. [Google Scholar] [CrossRef]
- Lewarne, T. Understanding the role of nutrition in preventing non-communicable diseases and supporting planetary health. Nurs. Stand. 2022, 37, 61–66. [Google Scholar] [CrossRef]
- Losi, M.-A.; Sheikh, N.; Laroche, C.; Charron, P.; Gimeno, J.; Maggioni, A.P.; Tavazzi, L.; Arbustini, E.; Brito, D.; Celutkiene, J.; et al. Association between common cardiovascular risk factors and clinical phenotype in patients with hypertrophic cardiomyopathy from the European Society of Cardiology (ESC) EurObservational Research Programme (EORP) Cardiomyopathy/Myocarditis registry. Eur. Heart J.-Qual. Care Clin. Outcomes 2022, 9, 42–53. [Google Scholar] [CrossRef]
- McCafferty, B.J.; Hill, J.O.; Gunn, A.J. Obesity: Scope, Lifestyle Interventions, and Medical Management. Tech. Vasc. Interv. Radiol. 2020, 23, 100653. [Google Scholar] [CrossRef] [PubMed]
- Blüher, M. Obesity: Global epidemiology and pathogenesis. Nat. Rev. Endocrinol. 2019, 15, 288–298. [Google Scholar] [CrossRef]
- Arias, N.; Picó, C.; Macarulla, M.T.; Oliver, P.; Miranda, J.; Palou, A.; Portillo, M.P. A combination of resveratrol and quercetin induces browning in white adipose tissue of rats fed an obesogenic diet. Obesity 2016, 25, 111–121. [Google Scholar] [CrossRef]
- Park, A.; Kim, W.K.; Bae, K.-H. Distinction of white, beige and brown adipocytes derived from mesenchymal stem cells. World J. Stem Cells 2014, 6, 33–42. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.H.; Park, A.; Oh, K.-J.; Kim, W.K.; Bae, K.-H. The Role of Adipose Tissue Mitochondria: Regulation of Mitochondrial Function for the Treatment of Metabolic Diseases. Int. J. Mol. Sci. 2019, 20, 4924. [Google Scholar] [CrossRef]
- Von Bank, H.; Hurtado-Thiele, M.; Oshimura, N.; Simcox, J. Mitochondrial Lipid Signaling and Adaptive Thermogenesis. Metabolites 2021, 11, 124. [Google Scholar] [CrossRef]
- Ricquier, D. Uncoupling Protein 1 of Brown Adipocytes, the Only Uncoupler: A Historical Perspective. Front. Endocrinol. 2011, 2, 85. [Google Scholar] [CrossRef]
- Li, T.; Du, M.; Wang, H.; Mao, X. Milk fat globule membrane and its component phosphatidylcholine induce adipose browning both in vivo and in vitro. J. Nutr. Biochem. 2020, 81, 108372. [Google Scholar] [CrossRef]
- Lo, K.A.; Sun, L. Turning WAT into BAT: A review on regulators controlling the browning of white adipocytes. Biosci. Rep. 2013, 33, 711–719. [Google Scholar] [CrossRef]
- Herz, C.T.; Kiefer, F.W. Adipose tissue browning in mice and humans. J. Endocrinol. 2019, 241, R97–R109. [Google Scholar] [CrossRef]
- Zong, Y.; Wang, M.; Liu, Y.; Suo, X.; Fan, G.; Yang, X. 5-HEPE reduces obesity and insulin resistance by promoting adipose tissue browning through GPR119/AMPK/PGC1α activation. Life Sci. 2023, 323, 121703. [Google Scholar] [CrossRef] [PubMed]
- Kang, N.H.; Mukherjee, S.; Yun, J.W. Trans-Cinnamic Acid Stimulates White Fat Browning and Activates Brown Adipocytes. Nutrients 2019, 11, 577. [Google Scholar] [CrossRef]
- Wiciński, M.; Sawicka, E.; Gębalski, J.; Kubiak, K.; Malinowski, B. Human Milk Oligosaccharides: Health Benefits, Potential Applications in Infant Formulas, and Pharmacology. Nutrients 2020, 12, 266. [Google Scholar] [CrossRef]
- Hegar, B.; Wibowo, Y.; Basrowi, R.W.; Ranuh, R.G.; Sudarmo, S.M.; Munasir, Z.; Atthiyah, A.F.; Widodo, A.D.; Supriatmo; Kadim, M.; et al. The Role of Two Human Milk Oligosaccharides, 2′-Fucosyllactose and Lacto-N-Neotetraose, in Infant Nutrition. Pediatr. Gastroenterol. Hepatol. Nutr. 2019, 22, 330–340. [Google Scholar] [CrossRef] [PubMed]
- Vandenplas, Y.; Berger, B.; Carnielli, V.P.; Ksiazyk, J.; Lagström, H.; Sanchez Luna, M.; Migacheva, N.; Mosselmans, J.-M.; Picaud, J.-C.; Possner, M.; et al. Human Milk Oligosaccharides: 2′-Fucosyllactose (2′-FL) and Lacto-N-Neotetraose (LNnT) in Infant Formula. Nutrients 2018, 10, 1161. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Goodson, M.; Vang, W.; Kalanetra, K.; Barile, D.; Raybould, H. 2′-Fucosyllactose Supplementation Improves Gut-Brain Signaling and Diet-Induced Obese Phenotype and Changes the Gut Microbiota in High Fat-Fed Mice. Nutrients 2020, 12, 1003. [Google Scholar] [CrossRef]
- Gart, E.; Salic, K.; Morrison, M.C.; Giera, M.; Attema, J.; de Ruiter, C.; Caspers, M.; Schuren, F.; Bobeldijk-Pastorova, I.; Heer, M.; et al. The Human Milk Oligosaccharide 2′-Fucosyllactose Alleviates Liver Steatosis, ER Stress and Insulin Resistance by Reducing Hepatic Diacylglycerols and Improved Gut Permeability in Obese Ldlr-/-.Leiden Mice. Front. Nutr. 2022, 9, 904740. [Google Scholar] [CrossRef] [PubMed]
- Cornelius, P.; MacDougald, O.A.; Lane, M.D. Regulation of adipocyte development. Annu. Rev. Nutr. 1994, 14, 99–129. [Google Scholar] [CrossRef] [PubMed]
- MacDougald, O.A.; Lane, M.D. Transcriptional regulation of gene expression during adipocyte differentiation. Annu. Rev. Biochem. 1995, 64, 345–373. [Google Scholar] [CrossRef]
- Um, J.-H.; Park, S.-J.; Kang, H.; Yang, S.; Foretz, M.; McBurney, M.W.; Kim, M.K.; Viollet, B.; Chung, J.H. AMP-Activated Protein Kinase–Deficient Mice Are Resistant to the Metabolic Effects of Resveratrol. Diabetes 2010, 59, 554–563. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Wu, T.; Lu, Y.-X.; Wang, J.-X.; Yu, F.-H.; Yang, M.-Z.; Huang, Y.-J.; Li, Z.-J.; Wang, S.-L.; Huang, L.; et al. Obesity promotes gastric cancer metastasis via diacylglycerol acyltransferase 2-dependent lipid droplets accumulation and redox homeostasis. Redox Biol. 2020, 36, 101596. [Google Scholar] [CrossRef]
- Bond, L.M.; Ntambi, J.M. UCP1 deficiency increases adipose tissue monounsaturated fatty acid synthesis and trafficking to the liver. J. Lipid Res. 2018, 59, 224–236. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Liao, W.; Yin, X.; Zheng, X.; Li, Q.; Zhang, H.; Zheng, L.; Feng, X. Resveratrol-induced brown fat-like phenotype in 3T3-L1 adipocytes partly via mTOR pathway. Food Nutr. Res. 2020, 64, 3656. [Google Scholar] [CrossRef]
- Kim, K.; Nam, K.H.; Yi, S.A.; Park, J.W.; Han, J.-W.; Lee, J. Ginsenoside Rg3 Induces Browning of 3T3-L1 Adipocytes by Activating AMPK Signaling. Nutrients 2020, 12, 427. [Google Scholar] [CrossRef]
- Zhao, B.; Liu, M.; Liu, H.; Xie, J.; Yan, J.; Hou, X.; Liu, J. Zeaxanthin promotes browning by enhancing mitochondrial biogenesis through the PKA pathway in 3T3-L1 adipocytes. Food Funct. 2021, 12, 6283–6293. [Google Scholar] [CrossRef]
- Muthukumaran, P.; Thiyagarajan, G.; Babu, R.A.; Lakshmi, B.S. Raffinose from Costus speciosus attenuates lipid synthesis through modulation of PPARs/SREBP1c and improves insulin sensitivity through PI3K/AKT. Chem. Interact. 2018, 284, 80–89. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.-Y.; Kim, T.Y.; Kang, H.; Oh, J.; Park, J.W.; Kim, S.-C.; Kim, M.; Apostolidis, E.; Kim, Y.-C.; Kwon, Y.-I. Anti-Obesity and Anti-Adipogenic Effects of Chitosan Oligosaccharide (GO2KA1) in SD Rats and in 3T3-L1 Preadipocytes Models. Molecules 2021, 26, 331. [Google Scholar] [CrossRef]
- Lai, C.-S.; Wu, J.-C.; Ho, C.-T.; Pan, M.-H. Chemoprevention of obesity by dietary natural compounds targeting mitochondrial regulation. Mol. Nutr. Food Res. 2016, 61, 1600721. [Google Scholar] [CrossRef] [PubMed]
- Turner, N.; Heilbronn, L.K. Is mitochondrial dysfunction a cause of insulin resistance? Trends Endocrinol. Metab. 2008, 19, 324–330. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Wang, Y.; Lin, L. Small molecules for fat combustion: Targeting obesity. Acta Pharm. Sin. B 2018, 9, 220–236. [Google Scholar] [CrossRef]
- Uldry, M.; Yang, W.; St-Pierre, J.; Lin, J.; Seale, P.; Spiegelman, B.M. Complementary action of the PGC-1 coactivators in mitochondrial biogenesis and brown fat differentiation. Cell Metab. 2006, 3, 333–341. [Google Scholar] [CrossRef]
- Wang, X.; Jiang, H.; Zhang, N.; Cai, C.; Li, G.; Hao, J.; Yu, G. Anti-diabetic activities of agaropectin-derived oligosaccharides from Gloiopeltis furcata via regulation of mitochondrial function. Carbohydr. Polym. 2019, 229, 115482. [Google Scholar] [CrossRef]
- Feng, W.; Liu, J.; Wang, S.; Hu, Y.; Pan, H.; Hu, T.; Guan, H.; Zhang, D.; Mao, Y. Alginate oligosaccharide alleviates D-galactose-induced cardiac ageing via regulating myocardial mitochondria function and integrity in mice. J. Cell. Mol. Med. 2021, 25, 7157–7168. [Google Scholar] [CrossRef]
- Spadaro, J.A.; Hishida, Y.; Matsunaga, Y.; van Es-Remers, M.; Korthout, H.; Kim, H.K.; Poppelaars, E.; Keizer, H.; Iliopoulou, E.; van Duijn, B.; et al. 3′sialyllactose and 6′sialyllactose enhance performance in endurance-type exercise through metabolic adaptation. Food Sci. Nutr. 2023, 11, 6199–6212. [Google Scholar] [CrossRef]
- Carling, D.; Thornton, C.; Woods, A.; Sanders, M.J. AMP-activated protein kinase: New regulation, new roles? Biochem. J. 2012, 445, 11–27. [Google Scholar] [CrossRef]
- Hardie, D.G.; Ross, F.A.; Hawley, S.A. AMPK: A nutrient and energy sensor that maintains energy homeostasis. Nat. Rev. Mol. Cell Biol. 2012, 13, 251–262. [Google Scholar] [CrossRef] [PubMed]
- Bijland, S.; Mancini, S.J.; Salt, I.P. Role of AMP-activated protein kinase in adipose tissue metabolism and inflammation. Clin. Sci. 2013, 124, 491–507. [Google Scholar] [CrossRef] [PubMed]
- Pollard, A.E.; Martins, L.; Muckett, P.J.; Khadayate, S.; Bornot, A.; Clausen, M.; Admyre, T.; Bjursell, M.; Fiadeiro, R.; Wilson, L.; et al. AMPK activation protects against diet-induced obesity through Ucp1-independent thermogenesis in subcutaneous white adipose tissue. Nat. Metab. 2019, 1, 340–349. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Zhang, T.; Hu, J.; Ma, R.; He, B.; Wang, M.; Wang, Y. Adiponectin/SIRT1 Axis Induces White Adipose Browning After Vertical Sleeve Gastrectomy of Obese Rats with Type 2 Diabetes. Obes. Surg. 2019, 30, 1392–1403. [Google Scholar] [CrossRef]
- Hoang, T.-H.; Yoon, Y.; Park, S.-A.; Lee, H.-Y.; Peng, C.; Kim, J.-H.; Lee, G.-H.; Chae, H.-J. IBF-R, a botanical extract of Rhus verniciflua controls obesity in which AMPK-SIRT1 axis and ROS regulatory mechanism are involved in mice. J. Funct. Foods 2021, 87, 104804. [Google Scholar] [CrossRef]
- Desjardins, E.M.; Steinberg, G.R. Emerging Role of AMPK in Brown and Beige Adipose Tissue (BAT): Implications for Obesity, Insulin Resistance, and Type 2 Diabetes. Curr. Diabetes Rep. 2018, 18, 80. [Google Scholar] [CrossRef] [PubMed]
- Reynés, B.; Palou, M.; Rodríguez, A.M.; Palou, A. Regulation of Adaptive Thermogenesis and Browning by Prebiotics and Postbiotics. Front. Physiol. 2019, 9, 1908. [Google Scholar] [CrossRef]
- Chi, Y.; Wu, Z.; Du, C.; Zhang, M.; Wang, X.; Xie, A.; Wang, P.; Li, R. Regulatory effects mediated by ulvan oligosaccharide and its zinc complex on lipid metabolism in high-fat diet-fed mice. Carbohydr. Polym. 2023, 300, 120249. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Hu, J.-Q.; Song, Y.-J.; Yin, J.; Wang, Y.-Y.; Peng, B.; Zhang, B.-W.; Liu, J.-M.; Dong, L.; Wang, S. 2′-Fucosyllactose Ameliorates Oxidative Stress Damage in d-Galactose-Induced Aging Mice by Regulating Gut Microbiota and AMPK/SIRT1/FOXO1 Pathway. Foods 2022, 11, 151. [Google Scholar] [CrossRef]
- Heo, H.; Cha, B.; Jang, D.; Park, C.; Park, G.; Kwak, B.-M.; Bin, B.-H.; Park, J.-H.; Lee, M.-G. Human milk oligosaccharide 2’-fucosyllactose promotes melanin degradation via the autophagic AMPK–ULK1 signaling axis. Sci. Rep. 2022, 12, 13983. [Google Scholar] [CrossRef]





| Gene | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) |
|---|---|---|
| Ucp1 | ACTGCCACACCTCCAGTCATT | CTTTGCCTCACTCAGGATTGG |
| Pgc1α | CCCTGCCATTGTTAAGACC | TGCTGCTGTTCCTGTTTTC |
| Prdm16 | CAGCACGGTGAAGCCATTC | GCGTGCATCCGCTTGTG |
| Cidea | ATCACAACTGGCCTGGTTACG | TACTACCCGGTGTCCATTTCT |
| Pparα | TGTCGAATATGTGGGGACAA | AATCTTGCAGCTCCGATCAC |
| Elov13 | GATGGTTCTGGGCACCATCTT | CGTTGTTGTGTGGCATCCTT |
| Tmem26 | GAAACCAGTATTGCAGCACCCAAT | AATATTAGCAGGAGTGTTTGGTGGA |
| Cd137 | TACTACCCGGTGTCCATTTCT | CCTCTGGAGTCACAGAAATGGTGGTA |
| Cox7a | TTCGAGAACCGAGTAGCTGAGAA | CTGTTGCACCGCCCTTCA |
| Cyt C | CCAAATCTCCACGGTCTGTTC | ATCAGGGTATCCTCTCCCCAG |
| Tfam | GAGGCCAGTGTGAACCAGTG | GTAGTGCCTGCTGCTCCTGA |
| GAPDH | ACCCTTAAGAGGGATGCTGC | CCCAATACGGCCAAATCCGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, S.; Fu, Y.; Wang, T.; Chen, Z.; Zhao, P.; Huang, X.; Qiao, M.; Li, T.; Song, L. Effect of 2’-Fucosyllactose on Beige Adipocyte Formation in 3T3-L1 Adipocytes and C3H10T1/2 Cells. Foods 2023, 12, 4137. https://doi.org/10.3390/foods12224137
Chen S, Fu Y, Wang T, Chen Z, Zhao P, Huang X, Qiao M, Li T, Song L. Effect of 2’-Fucosyllactose on Beige Adipocyte Formation in 3T3-L1 Adipocytes and C3H10T1/2 Cells. Foods. 2023; 12(22):4137. https://doi.org/10.3390/foods12224137
Chicago/Turabian StyleChen, Siru, Yankun Fu, Tianlin Wang, Zhenglin Chen, Peijun Zhao, Xianqing Huang, Mingwu Qiao, Tiange Li, and Lianjun Song. 2023. "Effect of 2’-Fucosyllactose on Beige Adipocyte Formation in 3T3-L1 Adipocytes and C3H10T1/2 Cells" Foods 12, no. 22: 4137. https://doi.org/10.3390/foods12224137
APA StyleChen, S., Fu, Y., Wang, T., Chen, Z., Zhao, P., Huang, X., Qiao, M., Li, T., & Song, L. (2023). Effect of 2’-Fucosyllactose on Beige Adipocyte Formation in 3T3-L1 Adipocytes and C3H10T1/2 Cells. Foods, 12(22), 4137. https://doi.org/10.3390/foods12224137

