Screening of Mycotoxigenic Fungi in Barley and Barley Malt (Hordeum vulgare L.) Using Real-Time PCR—A Comparison between Molecular Diagnostic and Culture Technique
Abstract
:1. Introduction
2. Materials and Methods
2.1. Grain Material
2.2. Malting Procedure
2.3. Fungal Strains
2.4. Fungal DNA Extraction
2.5. DNA Extraction from the Barley Samples
2.6. Agar-Plating Method
2.7. qPCR Primers
2.8. Quantitative Real-Time PCR Amplification
3. Results and Discussion
3.1. Mycological Status—Agar Plate Method
3.2. qPCR Assay Adaption
3.3. Mycological Status—Quantification of Fungal DNA
3.4. Mycological Status—Comparison between the Agar Plate Method and qPCR
3.5. Mycological Status—Before and after the Malt House
3.6. Relationship between Kernel Discoloration and Fungal Biomass
4. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Braugersten-Gemeinschaft e.V. Deutschland. Endgültiger Erntebericht für die Sommergerstenernte in Deutschland—Dezember 2020. Available online: https://www.braugerstengemeinschaft.de/press-report/endgueltiger-erntebericht-fuer-die-sommergerstenernte-in-deutschland-dezember-2020/ (accessed on 29 July 2021).
- Laitila, A.; Kotaviita, E.; Peltola, P.; Home, S.; Wilhelmson, A. Indigenous Microbial Community of Barley Greatly Influences Grain Germination and Malt Quality. J. Inst. Brew. 2007, 113, 9–20. [Google Scholar] [CrossRef]
- Disalov, J.N.; Bodroža-Solarov, M.I.; Krulj, J.A.; Pezo, L.L.; Curcic, N.Ž.; Kojic, J.S.; Ugrenovic, V.M. Impact of Alternaria spp. and Alternaria Toxins on Quality of Spelt Wheat. JAS 2018, 10, 89–97. [Google Scholar] [CrossRef] [Green Version]
- Oliveira, P.M.; Mauch, A.; Jacob, F.; Waters, D.M.; Arendt, E.K. Fundamental study on the influence of Fusarium infection on quality and ultrastructure of barley malt. Int. J. Food Microbiol. 2012, 156, 32–43. [Google Scholar] [CrossRef] [PubMed]
- Noots, I.; Delcour, J.A.; Michiels, C.W. From Field Barley to Malt: Detection and Specification of Microbial Activity for Quality Aspects. Crit. Rev. Microbiol. 1998, 25, 121–153. [Google Scholar] [CrossRef] [PubMed]
- Scheibenzuber, S.; Dick, F.; Asam, S.; Rychlik, M. Analysis of 13 Alternaria mycotoxins including modified forms in beer. Mycotoxin Res. 2021, 37, 149–159. [Google Scholar] [CrossRef]
- Hajnal, E.J.; Orcic, D.; Mastilovic, J. The Fate of Alternaria Toxins in the Wheat-Processing Chain. Flour and Breads and their Fortification in Health and Disease Prevention; Elsevier: London, UK, 2019; pp. 37–51. [Google Scholar]
- Schwarz, P.B.; Casper, H.H.; Beattie, S. Fate and Development of Naturally Occurring Fusarium Mycotoxins During Malting and Brewing. J. Am. Soc. Brew. Chem. 1995, 53, 121–127. [Google Scholar] [CrossRef]
- Wolf-Hall, C.E. Mold and mycotoxin problems encountered during malting and brewing. Int. J. Food Microbiol. 2007, 119, 89–94. [Google Scholar] [CrossRef]
- Habler, K.; Geissinger, C.; Hofer, K.; Schüler, J.; Moghari, S.; Hess, M.; Gastl, M.; Rychlik, M. Fate of Fusarium Toxins during Brewing. J. Agric. Food Chem. 2017, 65, 190–198. [Google Scholar] [CrossRef] [Green Version]
- Habler, K.; Hofer, K.; Geißinger, C.; Schüler, J.; Hückelhoven, R.; Hess, M.; Gastl, M.; Rychlik, M. Fate of Fusarium Toxins during the Malting Process. J. Agric. Food Chem. 2016, 64, 1377–1384. [Google Scholar] [CrossRef]
- Mastanjević, K.; Lukinac, J.; Jukić, M.; Šarkanj, B.; Krstanović, V.; Mastanjević, K. Multi-(myco)toxins in Malting and Brewing By-Products. Toxins 2019, 11, 30. [Google Scholar] [CrossRef] [Green Version]
- Perrone, G.; Ferrara, M.; Medina, A.; Pascale, M.; Magan, N. Toxigenic Fungi and Mycotoxins in a Climate Change Scenario: Ecology, Genomics, Distribution, Prediction and Prevention of the Risk. Microorganisms 2020, 8, 1496. [Google Scholar] [CrossRef] [PubMed]
- Paterson, R.R.M.; Lima, N. How will climate change affect mycotoxins in food? Food Res. Int. 2010, 43, 1902–1914. [Google Scholar] [CrossRef] [Green Version]
- Narziß, L.; Back, W.; Gastl, M.; Zarnkow, M. Die Technologie der Malzbereitung Abriss der Bierbrauerei; Wiley-VCH: Weinheim, Germany, 2017; Volume 8, ISBN 978-3-527-34036-1. [Google Scholar]
- Geißinger, C.; Hofer, K.; Habler, K.; Heß, M.; Hückelhoven, R.; Rychlik, M.; Becker, T.; Gastl, M. Fusarium Species on Barley Malt: Is Visual Assessment an Appropriate Tool for Detection? Cereal Chem. J. 2017, 94, 659–669. [Google Scholar] [CrossRef]
- Gonzalez Pereyra, M.L.; Rosa, C.A.R.; Dalcero, A.M.; Cavaglieri, L.R. Mycobiota and mycotoxins in malted barley and brewer’s spent grain from Argentinean breweries. Lett. Appl. Microbiol. 2011, 53, 649–655. [Google Scholar] [CrossRef]
- Krasauskas, A. Fungi in malting barley grain and malt production. BIOLOGIJA 2017, 63, 283–288. [Google Scholar] [CrossRef] [Green Version]
- Palumbo, R.; Crisci, A.; Venâncio, A.; Cortiñas Abrahantes, J.; Dorne, J.-L.; Battilani, P.; Toscano, P. Occurrence and Co-Occurrence of Mycotoxins in Cereal-Based Feed and Food. Microorganisms 2020, 8, 74. [Google Scholar] [CrossRef] [Green Version]
- Bolechová, M.; Benešová, K.; Běláková, S.; Čáslavský, J.; Pospíchalová, M.; Mikulíková, R. Determination of seventeen mycotoxins in barley and malt in the Czech Republic. Food Control 2015, 47, 108–113. [Google Scholar] [CrossRef]
- Drakopoulos, D.; Sulyok, M.; Krska, R.; Logrieco, A.F.; Vogelgsang, S. Raised concerns about the safety of barley grains and straw: A Swiss survey reveals a high diversity of mycotoxins and other fungal metabolites. Food Control 2021, 125, 107919. [Google Scholar] [CrossRef]
- Alexander, J.; Benford, D.; Boobis, A.; Ceccatelli, S.; Cottrill, B.; Cravedi, J.-P.; Domenico, A.D.; Doerge, D.; Dogliotti, E.; Edler, J.; et al. Scientific Opinion on the risks for animal and public health related to the presence of Alternaria toxins in feed and food. EFSA J. 2011, 9, 2407–2504. [Google Scholar] [CrossRef]
- Tralamazza, S.M.; Piacentini, K.C.; Iwase, C.H.T.; de Oliveira Rocha, L. Toxigenic Alternaria species: Impact in cereals worldwide. Curr. Opin. Food Sci. 2018, 23, 57–63. [Google Scholar] [CrossRef]
- Salvatore, M.M.; Andolfi, A.; Nicoletti, R. The Genus Cladosporium: A Rich Source of Diverse and Bioactive Natural Compounds. Molecules 2021, 26, 3959. [Google Scholar] [CrossRef] [PubMed]
- Adorisio, S.; Fierabracci, A.; Muscari, I.; Liberati, A.M.; Cannarile, L.; Thuy, T.T.; van Sung, T.; Sohrab, H.; Hasan, C.M.; Ayroldi, E.; et al. Fusarubin and Anhydrofusarubin Isolated from A Cladosporium Species Inhibit Cell Growth in Human Cancer Cell Lines. Toxins 2019, 11, 503. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Taguiam, J.D.; Evallo, E.; Balendres, M.A. Epicoccum species: Ubiquitous plant pathogens and effective biological control agents. Eur. J. Plant Pathol. 2021, 159, 713–725. [Google Scholar] [CrossRef]
- Wawrzyniak, J. Prediction of fungal infestation in stored barley ecosystems using artificial neural networks. LWT 2021, 137, 110367. [Google Scholar] [CrossRef]
- Wawrzyniak, J. Model of Fungal Development in Stored Barley Ecosystems as a Prognostic Auxiliary Tool for Postharvest Preservation Systems. Food Bioprocess Technol. 2021, 14, 298–309. [Google Scholar] [CrossRef]
- Kurowski, T.P.; Damszel, M.; Wysocka, U. Fungi Colonizing the Grain of Spring Wheat Grown in the Conventional and Organic Systems. Phytopathologia 2012, 63, 39–50. [Google Scholar]
- Kosiak, B.; Torp, M.; Skjerve, E.; Andersen, B. Alternaria and Fusarium in Norwegian grains of reduced quality—A matched pair sample study. Int. J. Food Microbiol. 2004, 93, 51–62. [Google Scholar] [CrossRef]
- Pitt, J.I.; Hocking, A.D. Methods for Isolation, Enumeration and Identification. In Fungi and Food Spoilage; Springer: Boston, MA, USA, 2009; ISBN 978-0-387-92207-2. [Google Scholar]
- Manole, M.-S.; Cristea, S. Identification and Quantification of Fungi Associated With Seeds of Barley, in Terms of 2014. Sci. Papers. Ser. A Agron. 2015, 58, 246–249. [Google Scholar]
- Al Husnain, L.; AlKahtani, M. Molecular heterogeneity in the 18s DNA gene of Alternaria sp. and Fusarium sp. producing mycotoxins in rice and maize grains. Saudi J. Biol. Sci. 2017, 26, 368–372. [Google Scholar] [CrossRef]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and Direct Sequenzing of Fungal Ribosomal RNA Genes for Phylogenetics. PCR Protoc. A Guide Methods Appl. 1990, 18, 315–322. [Google Scholar]
- Comte, A.; Gräfenhan, T.; Links, M.G.; Hemmingsen, S.M.; Dumonceaux, T.J. Quantitative molecular diagnostic assays of grain washes for Claviceps purpurea are correlated with visual determinations of ergot contamination. PLoS ONE 2017, 12, e0173495. [Google Scholar] [CrossRef] [PubMed]
- Jurado, M.; Vázquez, C.; Patiño, B.; González-Jaén, M.T. PCR detection assays for the trichothecene-producing species Fusarium graminearum, Fusarium culmorum, Fusarium poae, Fusarium equiseti and Fusarium sporotrichioides. Syst. Appl. Microbiol. 2005, 28, 562–568. [Google Scholar] [CrossRef] [PubMed]
- Kulik, T. Detection of Fusarium tricinctum from cereal grain using PCR assay. J. Appl. Genet. 2008, 49, 305–311. [Google Scholar] [CrossRef]
- Kulik, T.; Bilska, K.; Zelechowski, M. Promising Perspectives for Detection, Identification, and Quantification of Plant Pathogenic Fungi and Oomycetes through Targeting Mitochondrial DNA. Int. J. Mol. Sci. 2020, 21, 2645. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nicolaisen, M.; Suproniene, S.; Nielsen, L.K.; Lazzaro, I.; Spliid, N.H.; Justesen, A.F. Real-time PCR for quantification of eleven individual Fusarium species in cereals. J. Microbiol. Methods 2009, 76, 234–240. [Google Scholar] [CrossRef] [PubMed]
- Elbelt, S.; Siou, D.; Gelisse, S.; Cruaud, C.; Lannou, C.; Lebrun, M.H.; Laval, V. Optimized Real Time QPCR Assays for Detection and Quantification of Fusarium and Microdochium species Involved in Wheat Head Blight as Defined by MIQE Guidelines. bioRxiv 2018, art.272534. [Google Scholar] [CrossRef]
- Kulik, T.; Treder, K.; Załuski, D. Quantification of Alternaria, Cladosporium, Fusarium and Penicillium verrucosum in Conventional and Organic Grains by qPCR. J. Phytopathol. 2015, 163, 522–528. [Google Scholar] [CrossRef]
- Okorski, A.; Polak-Śliwińska, M.; Karpiesiuk, K.; Pszczółkowska, A.; Kozera, W. Real time PCR: A good tool to estimate mycotoxin contamination in pig diets. World Mycotoxin J. 2017, 10, 219–228. [Google Scholar] [CrossRef]
- Guillemette, T.; Iacomi-Vasilescu, B.; Simoneau, P. Conventional and Real-Time PCR-Based Assay for Detecting Pathogenic Alternaria brassicae in Cruciferous Seed. Plant Dis. 2004, 88, 490–496. [Google Scholar] [CrossRef] [Green Version]
- Vegi, A.; Wolf-Hall, C.E. Multiplex real-time PCR method for detection and quantification of mycotoxigenic fungi belonging to three different genera. J. Food Sci. 2013, 78, M70–M76. [Google Scholar] [CrossRef]
- Berliner Programm. Available online: https://www.braugerstengemeinschaft.de/berliner-programm/ (accessed on 17 January 2022).
- Tomita, E.Y.; Ramos, C.; Nascimento, A.; Ho, P.L. Isolation of genomic DNA from Pichia pastoris without hydrolases. Biotecnol. Apl. 2002, 19, 167–168. [Google Scholar]
- Joint Research Centre. Maize Seed Sampling and DNA Extraction. Document CRLV04/05XP. 2007. Available online: https://gmo-crl.jrc.ec.europa.eu/summaries/MIR604_DNAExtr.pdf (accessed on 23 February 2022).
- Linkmeyer, A.; Götz, M.; Hu, L.; Asam, S.; Rychlik, M.; Hausladen, H.; Hess, M.; Hückelhoven, R. Assessment and Introduction of Quantitative Resistance to Fusarium Head Blight in Elite Spring Barley. Phytopathology 2013, 103, 1252–1259. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kordalewska, M.; Brillowska-Dąbrowska, A.; Jagielski, T.; Dworecka-Kaszak, B. PCR and real-time PCR assays to detect fungi of Alternaria alternata species. Acta Biochim. Pol. 2015, 62, 707–712. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Q.-Y.; Westermark, S.-O.; Rasmuson-Lestander, A.; Wang, X.-R. Detection and quantification of Cladosporium in aerosols by real-time PCR. J. Environ. Monit. 2006, 8, 153–160. [Google Scholar] [CrossRef]
- Martini, M.; Musetti, R.; Grisan, S.; Polizzotto, R.; Borselli, S.; Pavan, F.; Osler, R. DNA-dependent detection of the grapevine fungal endophytes Aureobasidium pullulans and Epicoccum nigrum. Plant Dis. 2009, 93, 993–998. [Google Scholar] [CrossRef] [Green Version]
- Schmidt-Heydt, M.; Richter, W.; Michulec, M.; Buttinger, G.; Geisen, R. Comprehensive molecular system to study the presence, growth and ochratoxin A biosynthesis of Penicillium verrucosum in wheat. Food Addit. Contam. Part A 2008, 25, 989–996. [Google Scholar] [CrossRef]
- Von Hertwig, A.M.; Sant’Ana, A.S.; Sartori, D.; da Silva, J.J.; Nascimento, M.S.; Iamanaka, B.T.; Pelegrinelli Fungaro, M.H.; Taniwaki, M.H. Real-time PCR-based method for rapid detection of Aspergillus niger and Aspergillus welwitschiae isolated from coffee. J. Microbiol. Methods 2018, 148, 87–92. [Google Scholar] [CrossRef]
- Jakovac-Strajn, B.; Vengušt, A.; Ujčič-Vrhovnik, I.; Pavšič-Vrtač, K.; Tavčar-Kalcher, G. The natural occurrence of toxigenic moulds and mycotoxins in Slovenian primary grain production. Acta Agric. Slov. 2010, 95, 121–128. [Google Scholar] [CrossRef]
- Castañares, E.; Da Cruz Cabral, L.; Dinolfo, M.I.; Andersen, B.; Stenglein, S.A.; Patriarca, A. Alternaria in malting barley: Characterization and distribution in relation with climatic conditions and barley cultivars. Int. J. Food Microbiol. 2021, 357, 109367. [Google Scholar] [CrossRef]
- Medina, A.; Valle-Algarra, F.M.; Mateo, R.; Gimeno-Adelantado, J.V.; Mateo, F.; Jiménez, M. Survey of the mycobiota of Spanish malting barley and evaluation of the mycotoxin producing potential of species of Alternaria, Aspergillus and Fusarium. Int. J. Food Microbiol. 2006, 108, 196–203. [Google Scholar] [CrossRef]
- Roháčik, T.; Hudec, K. Fungal infection of malt barley kernels in Slovak Republic. Plant Protect. Sci. 2008, 43, 86–95. [Google Scholar] [CrossRef] [Green Version]
- Šafránková, I.; Marková, J.; Kmoch, M. Seed mycoflora of malting varieties and lines of spring barley in localities Kroměříž and Žabčice. Kvasný Průmysl 2010, 56, 138–144. [Google Scholar] [CrossRef]
- Ackermann, A. Mycoflora of South African Barley and Malt. J. Am. Soc. Brew. Chem. 1998, 56, 169–176. [Google Scholar] [CrossRef]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic Local Alignment Search Tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [Green Version]
- Endgültiger Erntebericht für Sommergerste in Deutschland 2018. Available online: https://www.braugerstengemeinschaft.de/press-report/endgueltiger-erntebericht-fuer-sommergerste-in-deutschland-november-2018/ (accessed on 20 December 2021).
- Endgültiger Erntebericht über die Braugerstenernte 2019 in Deutschland. Available online: https://www.braugerstengemeinschaft.de/press-report/endgueltiger-erntebericht-ueber-die-braugerstenernte-2019-in-deutschland/ (accessed on 20 December 2021).
- Erntebericht für die Sommergerstenernte in Deutschland 8.10.2020. Available online: https://www.braugerstengemeinschaft.de/press-report/1-erntebericht-fuer-die-sommergerstenernte-in-deutschland-8-10-2020/ (accessed on 20 December 2021).
- Erntebericht über die Braugerstenernte 2021 in Deutschland. Available online: https://www.braugerstengemeinschaft.de/press-report/1-erntebericht-ueber-die-braugerstenernte-2021-in-deutschland/ (accessed on 20 December 2021).
- Krstanović, V.; Klapec, T.; Velić, N.; Milaković, Z. Contamination of malt barley and wheat by Fusarium graminearum and Fusarium culmorum from the crop years 2001–2003 in eastern Croatia. Microbiol. Res. 2005, 160, 353–359. [Google Scholar] [CrossRef]
- Fernandez, M.R.; Clarke, J.M.; DePauw, R.M.; Irvine, R.B.; Knox, R.E. Black Point Reaction of Durum and Common Wheat Cultivars Grown Under Irrigation in Southern Saskatchewan. Plant Dis. 2000, 84, 892–894. [Google Scholar] [CrossRef] [Green Version]
- Moschini, R.C.; Sisterna, M.N.; Carmona, M.A. Modelling of wheat black point incidence based on meteorological variables in the southern Argentinean Pampas region. Aust. J. Agric. Res. 2006, 57, 1151. [Google Scholar] [CrossRef]
- Pavón, M.Á.; Luna, A.; La Cruz, S.d.; González, I.; Martín, R.; García, T. PCR-based assay for the detection of Alternaria species and correlation with HPLC determination of altenuene, alternariol and alternariol monomethyl ether production in tomato products. Food Control 2012, 25, 45–52. [Google Scholar] [CrossRef]
- Orina, A.S.; Gavrilova, O.P.; Gogina, N.N.; Gannibal, P.B.; Gagkaeva, T.Y. Natural Occurrence of Alternaria Fungi and Associated Mycotoxins in Small-Grain Cereals from The Urals and West Siberia Regions of Russia. Toxins 2021, 13, 681. [Google Scholar] [CrossRef]
- Narziss, L.; Back, W.; Gastl, M.; Zarnkow, M. Abriss der Bierbrauerei, 8th ed.; Wiley-VCH: Weinheim, Germany, 2017; ISBN 9783527696727. [Google Scholar]
- Laitila, A.; Wilhelmson, A.; Mikkola, H.; Kauppila, R.; Kotaviia, E.; Olkku, J.; Haikara, A.; Home, S. Importance of Drying and sound Storage Conditions on the Microbiological Safety and Viability of Malting Barley; Fachverlag Hans Karl: Nürnberg, Germany, 2003; ISBN 9070143224. [Google Scholar]
- Juste, A.; Malfliet, S.; Lenaerts, M.; Cooman, L.D.; Aerts, G.; Willems, K.A.; Lievens, B. Microfl ora during Malting of Barley: Overview and Impact on Malt Quality. Brew. Sci. 2011, 64, 22–31. [Google Scholar]
- Sarlin, T.; Laitila, A.; Pekkarinen, A.; Haikara, A. Effects of Three Fusarium Species on the Quality of Barley and Malt. J. Am. Soc. Brew. Chem. 2005, 63, 43–49. [Google Scholar] [CrossRef] [Green Version]
- Follstad, M.N.; Christensen, C.M. Microflora of Barley Kernels. Appl. Environ. Microbiol. 1996, 10, 331–336. [Google Scholar] [CrossRef] [PubMed]
- Douglas, P.E.; Flannigan, B. A microbiological evaluation of barley malt production. J. Inst. Brew. 1988, 94, 85–88. [Google Scholar] [CrossRef]
- Kocić-Tanackov, S.D.; Škrinjar, M.M.; Grujić, O.S.; Pejin, J.D. Fungal Growth during malting of barley. Acta Period. Technol. 2005, 36, 51–60. [Google Scholar] [CrossRef]
- Draz, I.S.; El-Gremi, S.M.; Youssef, W.A. Pathogens associated with wheat black-point disease and responsibility in pathogenesis. J. Envir. Agri. Sci. 2016, 8, 71–78. [Google Scholar]
- Torku, F.; Akgül, D.S.; Bicici, M.; Karaköy, T. The Relationship between Black Point and Fungi Species and Effects of Black Point on Seed Germination Properties in Bread Wheat. Turk. J. Agric. For. 2008, 32, 267–272. [Google Scholar]
- Sisterna, M.; Sarandon, S. Wheat grain discoloration in Argentina: Current status. Am. J. Plant Sci. Biotechnol. 2010, 3, 54–64. [Google Scholar]
- Hudec, K.; Muchova, D. Correlation between Black Point Symptoms and Fungal Infestation and Seedling Viability of Wheat Kernels. Plant Protect. Sci. 2008, 44, 138–146. [Google Scholar] [CrossRef] [Green Version]
- Wang, H.; Fernandez, M.R.; Clarke, F.R.; DePauw, R.M.; Clarke, J.M. Effects of foliar fungicides on kernel black point of wheat in southern Saskatchewan. Can. J. Plant Pathol. 2002, 24, 287–293. [Google Scholar] [CrossRef]
- Khani, M.; Cheong, J.; Mrva, K.; Mares, D. Wheat black point: Role of environment and genotype. J. Cereal Sci. 2018, 82, 25–33. [Google Scholar] [CrossRef]
Target Species | Oligo Name | Sequence (5′–3′) | References |
---|---|---|---|
Alternaria alternata | AaltFor/AaltRev | GTGCCTTCCCCCAAGGTCTCCG CGGAAACGAGGTGGTTCAGGTC | Kordalewska et al., 2015 [49] |
Cladosporium cladosporioides | CladoFor/CladoRev | TACTCCAATGGTTCTAATATTTTCCTCTC GGGTACCTAGACAGTATTTCTAGCCT | Zeng et al., 2005 [50] |
Epicoccum nigrum | ENiFor/ENiRev | CCTAGAGTTTGTAGACTTCGGT GACGTCGTCGTTATGAGTG | Martini et al., 2009 [51] |
Penicillium verrucosum | PVerFor/PVerRev | TTGCGAATCAGGGTCCAAGTA CGAGCATCGAAAGCAAAAACA | Schmidt-Heydt et al., 2009 [52] |
Aspergillus niger | AspNiF/AspNiR | GGGCAAAGGGTTGGGTCTTC GACGAGGACGGCACGAGGA | Morgan von Hertwig et al., 2018 [53] |
Hordeum vulgare | Hor1F/Hor1R | TCTCTGGGTTTGAGGGTGAC GGCCCTTGTACCAGTCAAGGT | Nicolaisen et al., 2009 [39] |
Year | Parameter | Fusarium spp. | Alternaria spp. | Cladosporium spp. | Penicillium spp. | Aspergillus spp. | Epicoccum nigrum | Rhizopus spp. | Mucor spp. | Ulocladium spp. | Others |
---|---|---|---|---|---|---|---|---|---|---|---|
2018 | RB | 0.022 | 0.357 | 0.004 | 0.286 | 0.098 | 0.004 | 0.219 | 0 | 0.004 | 0.004 |
BM | 0.246 | 0.305 | 0.085 | 0.157 | 0.008 | 0.008 | 0.182 | 0 | 0.004 | 0.004 | |
2019 | RB | 0.299 | 0.612 | 0 | 0.010 | 0.010 | 0.005 | 0.065 | 0 | 0 | 0 |
BM | 0.277 | 0.533 | 0.070 | 0.014 | 0.014 | 0 | 0.035 | 0.028 | 0.028 | 0.003 | |
2020 | RB | 0.581 | 0.066 | 0.017 | 0.156 | 0.123 | 0 | 0.050 | 0 | 0.007 | 0 |
BM | 0.587 | 0.135 | 0.100 | 0.023 | 0.010 | 0.010 | 0.092 | 0.010 | 0013 | 0.020 | |
2021 | RB | 0.505 | 0.334 | 0.094 | 0.021 | 0.024 | 0.007 | 0.003 | 0 | 0.003 | 0.010 |
BM | 0.777 | 0.093 | 0.025 | 0.006 | 0.033 | 0.003 | 0.062 | 0 | 0 | 0 |
Location | Parameter | Fusarium spp. | Alternaria spp. | Cladosporium spp. | Penicillium spp. | Aspergillus spp. | Epicoccum nigrum | Rhizopus spp. | Mucor spp. | Ulocladium spp. | Others |
---|---|---|---|---|---|---|---|---|---|---|---|
1 | RB | 0.161 | 0.445 | 0.088 | 0.088 | 0.204 | 0.007 | 0 | 0 | 0 | 0.007 |
BM | 0.280 | 0.379 | 0.056 | 0.201 | 0.019 | 0.005 | 0.374 | 0.005 | 0.014 | 0.005 | |
2 | RB | 0.266 | 0.383 | 0.008 | 0.227 | 0.055 | 0.008 | 0.055 | 0 | 0 | 0 |
BM | 0.441 | 0.330 | 0.117 | 0.011 | 0 | 0.016 | 0.320 | 0.011 | 0.016 | 0.027 | |
3 | RB | 0.313 | 0.470 | 0.006 | 0.006 | 0.048 | 0.006 | 0.084 | 0 | 0.006 | 0 |
BM | 0.497 | 0.272 | 0.139 | 0 | 0.026 | 0.007 | 0.003 | 0 | 0.020 | 0.007 | |
4 | RB | 0.513 | 0.146 | 0.015 | 0.221 | 0.045 | 0 | 0.055 | 0 | 0.005 | 0 |
BM | 0.628 | 0.233 | 0.247 | 0.015 | 0.050 | 0 | 0.050 | 0 | 0 | 0 | |
5 | RB | 0.285 | 0.388 | 0.085 | 0.091 | 0.050 | 0 | 0.091 | 0 | 0.012 | 0 |
BM | 0.411 | 0.265 | 0.060 | 0.011 | 0.005 | 0 | 0.184 | 0.043 | 0.022 | 0 | |
6 | RB | 0.650 | 0.097 | 0.005 | 0.036 | 0.041 | 0.005 | 0.157 | 0 | 0 | 0.010 |
BM | 0.702 | 0.083 | 0.033 | 0 | 0.008 | 0.004 | 0.165 | 0 | 0 | 0.004 |
Year | Parameter | Epicoccum nigrum | Alternaria alternata | Cladosporium spp. | Penicillium verrucosum | Aspergillus niger |
---|---|---|---|---|---|---|
2018 | RB | 0.47 | 0.91 | 60.62 | n.d. | n.d. |
BM | 0.05 | 0.43 | 22.34 | n.d. | n.d. | |
2019 | RB | 4.69 | 1.27 | 33.36 | n.d. | n.d. |
BM | 2.05 | 1.04 | 18.70 | n.d. | n.d. | |
2020 | RB | 0.68 | 1.20 | 116.95 | n.d. | n.d. |
BM | 0.97 | 1.06 | 32.98 | n.d. | n.d. | |
2021 | RB | 0.54 | 215.23 | 8.05 | n.d. | n.d. |
BM | 0.82 | 149.47 | 3.59 | n.d. | n.d. |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bretträger, M.; Becker, T.; Gastl, M. Screening of Mycotoxigenic Fungi in Barley and Barley Malt (Hordeum vulgare L.) Using Real-Time PCR—A Comparison between Molecular Diagnostic and Culture Technique. Foods 2022, 11, 1149. https://doi.org/10.3390/foods11081149
Bretträger M, Becker T, Gastl M. Screening of Mycotoxigenic Fungi in Barley and Barley Malt (Hordeum vulgare L.) Using Real-Time PCR—A Comparison between Molecular Diagnostic and Culture Technique. Foods. 2022; 11(8):1149. https://doi.org/10.3390/foods11081149
Chicago/Turabian StyleBretträger, Marina, Thomas Becker, and Martina Gastl. 2022. "Screening of Mycotoxigenic Fungi in Barley and Barley Malt (Hordeum vulgare L.) Using Real-Time PCR—A Comparison between Molecular Diagnostic and Culture Technique" Foods 11, no. 8: 1149. https://doi.org/10.3390/foods11081149
APA StyleBretträger, M., Becker, T., & Gastl, M. (2022). Screening of Mycotoxigenic Fungi in Barley and Barley Malt (Hordeum vulgare L.) Using Real-Time PCR—A Comparison between Molecular Diagnostic and Culture Technique. Foods, 11(8), 1149. https://doi.org/10.3390/foods11081149