Application of Nanomaterial Modified Aptamer-Based Electrochemical Sensor in Detection of Heavy Metal Ions
Abstract
:1. Introduction
2. Application of Nanomaterials in Aptamer-Based Electrochemical Sensors
2.1. Gold Nanoparticles
2.2. Carbon Nanotubes
2.3. Graphene
2.4. Quantum Dots
2.5. Metal-Organic Frameworks
3. Electrochemical Techniques
3.1. Electrochemical Impedance Spectroscopy
3.2. Differential Pulse Voltammetry
3.3. Square Wave Voltammetry
3.4. Photoelectric Electrochemistry
3.5. Electrochemiluminescence
4. Prospects and Challenges
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Sall, M.L.; Diaw, A.K.D.; Gningue-Sall, D.; Efremova Aaron, S.; Aaron, J.-J. Toxic Heavy Metals: Impact on the Environment and Human Health, and Treatment with Conducting Organic Polymers, a Review. Environ. Sci. Pollut. Res. 2020, 27, 29927–29942. [Google Scholar] [CrossRef] [PubMed]
- Karaouzas, I.; Kapetanaki, N.; Mentzafou, A.; Kanellopoulos, T.D.; Skoulikidis, N. Heavy Metal Contamination Status in Greek Surface Waters: A Review with Application and Evaluation of Pollution Indices. Chemosphere 2021, 263, 128192. [Google Scholar] [CrossRef] [PubMed]
- Saravanan, A.; Senthil Kumar, P.; Jeevanantham, S.; Karishma, S.; Tajsabreen, B.; Yaashikaa, P.R.; Reshma, B. Effective Water/Wastewater Treatment Methodologies for Toxic Pollutants Removal: Processes and Applications towards Sustainable Development. Chemosphere 2021, 280, 130595. [Google Scholar] [CrossRef]
- Fakhri, Y.; Saha, N.; Miri, A.; Baghaei, M.; Roomiani, L.; Ghaderpoori, M.; Taghavi, M.; Keramati, H.; Bahmani, Z.; Moradi, B.; et al. Metal Concentrations in Fillet and Gill of Parrotfish (Scarus Ghobban) from the Persian Gulf and Implications for Human Health. Food Chem. Toxicol. 2018, 118, 348–354. [Google Scholar] [CrossRef] [PubMed]
- Aragay, G.; Pons, J.; Merkoçi, A. Recent Trends in Macro-, Micro-, and Nanomaterial-Based Tools and Strategies for Heavy-Metal Detection. Chem. Rev. 2011, 111, 3433–3458. [Google Scholar] [CrossRef] [PubMed]
- Al Hamouz, O.C.S.; Akintola, O.S. Removal of Lead and Arsenic Ions by a New Series of Aniline Based Polyamines. Process Saf. Environ. Prot. 2017, 106, 180–190. [Google Scholar] [CrossRef]
- Malik, L.A.; Bashir, A.; Qureashi, A.; Pandith, A.H. Detection and Removal of Heavy Metal Ions: A Review. Environ. Chem. Lett. 2019, 17, 1495–1521. [Google Scholar] [CrossRef]
- Harrington, C.F.; Clough, R.; Drennan-Harris, L.R.; Hill, S.J.; Tyson, J.F. Atomic Spectrometry Update. Elemental Speciation. J. Anal. At. Spectrom. 2011, 26, 1561. [Google Scholar] [CrossRef]
- Xie, M.; Zhao, F.; Zhang, Y.; Xiong, Y.; Han, S. Recent Advances in Aptamer-Based Optical and Electrochemical Biosensors for Detection of Pesticides and Veterinary Drugs. Food Control 2022, 131, 108399. [Google Scholar] [CrossRef]
- Li, F.; Yu, Z.; Han, X.; Lai, R.Y. Electrochemical Aptamer-Based Sensors for Food and Water Analysis: A Review. Anal. Chim. Acta 2019, 1051, 1–23. [Google Scholar] [CrossRef]
- Wang, T.; Chen, C.; Larcher, L.M.; Barrero, R.A.; Veedu, R.N. Three Decades of Nucleic Acid Aptamer Technologies: Lessons Learned, Progress and Opportunities on Aptamer Development. Biotechnol. Adv. 2019, 37, 28–50. [Google Scholar] [CrossRef] [PubMed]
- Zhu, G.; Chen, X. Aptamer-Based Targeted Therapy. Adv. Drug Deliv. Rev. 2018, 134, 65–78. [Google Scholar] [CrossRef] [PubMed]
- Ni, S.; Zhuo, Z.; Pan, Y.; Yu, Y.; Li, F.; Liu, J.; Wang, L.; Wu, X.; Li, D.; Wan, Y.; et al. Recent Progress in Aptamer Discoveries and Modifications for Therapeutic Applications. ACS Appl. Mater. Interfaces 2021, 13, 9500–9519. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Chen, L.; Chikkanna, A.; Chen, S.; Brusius, I.; Sbuh, N.; Veedu, R.N. Development of Nucleic Acid Aptamer-Based Lateral Flow Assays: A Robust Platform for Cost-Effective Point-of-Care Diagnosis. Theranostics 2021, 11, 5174–5196. [Google Scholar] [CrossRef]
- Wu, S.; Zhang, H.; Shi, Z.; Duan, N.; Fang, C.; Dai, S.; Wang, Z. Aptamer-Based Fluorescence Biosensor for Chloramphenicol Determination Using Upconversion Nanoparticles. Food Control 2015, 50, 597–604. [Google Scholar] [CrossRef]
- Emrani, A.S.; Danesh, N.M.; Lavaee, P.; Ramezani, M.; Abnous, K.; Taghdisi, S.M. Colorimetric and Fluorescence Quenching Aptasensors for Detection of Streptomycin in Blood Serum and Milk Based on Double-Stranded DNA and Gold Nanoparticles. Food Chem. 2016, 190, 115–121. [Google Scholar] [CrossRef]
- Ouyang, Q.; Wang, L.; Ahmad, W.; Rong, Y.; Li, H.; Hu, Y.; Chen, Q. A Highly Sensitive Detection of Carbendazim Pesticide in Food Based on the Upconversion-MnO2 Luminescent Resonance Energy Transfer Biosensor. Food Chem. 2021, 349, 129157. [Google Scholar] [CrossRef]
- You, H.; Bai, L.; Yuan, Y.; Zhou, J.; Bai, Y.; Mu, Z. An Amperometric Aptasensor for Ultrasensitive Detection of Sulfadimethoxine Based on Exonuclease-Assisted Target Recycling and New Signal Tracer for Amplification. Biosens. Bioelectron. 2018, 117, 706–712. [Google Scholar] [CrossRef]
- Zhou, C.; Zou, H.; Sun, C.; Ren, D.; Xiong, W.; Li, Y. Fluorescent Aptasensor for Detection of Four Tetracycline Veterinary Drugs in Milk Based on Catalytic Hairpin Assembly Reaction and Displacement of G-Quadruplex. Anal. Bioanal. Chem. 2018, 410, 2981–2989. [Google Scholar] [CrossRef]
- Chen, Q.; Sheng, R.; Wang, P.; Ouyang, Q.; Wang, A.; Ali, S.; Zareef, M.; Hassan, M.M. Ultra-Sensitive Detection of Malathion Residues Using FRET-Based Upconversion Fluorescence Sensor in Food. Spectrochim. Acta Part A Mol. Biomol. Spectrosc. 2020, 241, 118654. [Google Scholar] [CrossRef]
- Dolati, S.; Ramezani, M.; Nabavinia, M.S.; Soheili, V.; Abnous, K.; Taghdisi, S.M. Selection of Specific Aptamer against Enrofloxacin and Fabrication of Graphene Oxide Based Label-Free Fluorescent Assay. Anal. Biochem. 2018, 549, 124–129. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Geryak, R.; Geldmeier, J.; Kim, S.; Tsukruk, V.V. Synthesis, Assembly, and Applications of Hybrid Nanostructures for Biosensing. Chem. Rev. 2017, 117, 12942–13038. [Google Scholar] [CrossRef] [PubMed]
- Yao, S.; Swetha, P.; Zhu, Y. Nanomaterial-Enabled Wearable Sensors for Healthcare. Adv. Healthc. Mater. 2018, 7, 1700889. [Google Scholar] [CrossRef] [PubMed]
- Baig, N.; Sajid, M.; Saleh, T.A. Recent Trends in Nanomaterial-Modified Electrodes for Electroanalytical Applications. TrAC Trends Anal. Chem. 2019, 111, 47–61. [Google Scholar] [CrossRef]
- Cheng, N.; Song, Y.; Fu, Q.; Du, D.; Luo, Y.; Wang, Y.; Xu, W.; Lin, Y. Aptasensor Based on Fluorophore-Quencher Nano-Pair and Smartphone Spectrum Reader for on-Site Quantification of Multi-Pesticides. Biosens. Bioelectron. 2018, 117, 75–83. [Google Scholar] [CrossRef]
- Roushani, M.; Rahmati, Z.; Hoseini, S.J.; Hashemi Fath, R. Impedimetric Ultrasensitive Detection of Chloramphenicol Based on Aptamer MIP Using a Glassy Carbon Electrode Modified by 3-Ampy-RGO and Silver Nanoparticle. Colloids Surf. B Biointerfaces 2019, 183, 110451. [Google Scholar] [CrossRef]
- Charbgoo, F.; Soltani, F.; Taghdisi, S.M.; Abnous, K.; Ramezani, M. Nanoparticles Application in High Sensitive Aptasensor Design. TrAC Trends Anal. Chem. 2016, 85, 85–97. [Google Scholar] [CrossRef]
- Fernandes, P.M.V.; Campiña, J.M.; Silva, A.F. A Layered Nanocomposite of Laccase, Chitosan, and Fe3O4 Nanoparticles-Reduced Graphene Oxide for the Nanomolar Electrochemical Detection of Bisphenol A. Microchim. Acta 2020, 187, 262. [Google Scholar] [CrossRef]
- Turkevich, J.; Stevenson, P.C.; Hillier, J. A Study of the Nucleation and Growth Processes in the Synthesis of Colloidal Gold. Discuss. Faraday Soc. 1951, 11, 55. [Google Scholar] [CrossRef]
- Priyadarshini, E.; Pradhan, N. Gold Nanoparticles as Efficient Sensors in Colorimetric Detection of Toxic Metal Ions: A Review. Sens. Actuators B Chem. 2017, 238, 888–902. [Google Scholar] [CrossRef]
- Yuan, M.; Qian, S.; Cao, H.; Yu, J.; Ye, T.; Wu, X.; Chen, L.; Xu, F. An Ultra-Sensitive Electrochemical Aptasensor for Simultaneous Quantitative Detection of Pb2+ and Cd2+ in Fruit and Vegetable. Food Chem. 2022, 382, 132173. [Google Scholar] [CrossRef] [PubMed]
- Deng, W.; Hong, L.-R.; Zhao, M.; Zhuo, Y.; Gao, M. Electrochemiluminescence-Based Detection Method of Lead(ii) Ion via Dual Enhancement of Intermolecular and Intramolecular Co-Reaction. Analyst 2015, 140, 4206–4211. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Lai, Y.; Yang, G.; Tang, C.; Deng, Y.; Li, S.; Wang, Z. Cd-Aptamer Electrochemical Biosensor Based on AuNPs/CS Modified Glass Carbon Electrode. J. Biomed. Nanotechnol. 2017, 13, 1253–1259. [Google Scholar] [CrossRef]
- Yadav, R.; Kushwah, V.; Gaur, M.S.; Bhadauria, S.; Berlina, A.N.; Zherdev, A.V.; Dzantiev, B.B. Electrochemical Aptamer Biosensor for As 3+ Based on Apta Deep Trapped Ag-Au Alloy Nanoparticles-Impregnated Glassy Carbon Electrode. Int. J. Environ. Anal. Chem. 2020, 100, 623–634. [Google Scholar] [CrossRef]
- Zhao, Y.; Xie, X. A Novel Electrochemical Aptamer Biosensor Based on DNAzyme Decorated Au@Ag Core-Shell Nanoparticles for Hg2+ Determination. J. Braz. Chem. Soc. 2018, 29, 232–239. [Google Scholar] [CrossRef]
- Miao, P.; Tang, Y.; Wang, L. DNA Modified Fe3O4 @Au Magnetic Nanoparticles as Selective Probes for Simultaneous Detection of Heavy Metal Ions. ACS Appl. Mater. Interfaces 2017, 9, 3940–3947. [Google Scholar] [CrossRef]
- Ajayan, P.M. Nanotubes from Carbon. Chem. Rev. 1999, 99, 1787–1800. [Google Scholar] [CrossRef]
- Charbgoo, F.; Behmanesh, M.; Nikkhah, M. Enhanced Reduction of Single-Wall Carbon Nanotube Cytotoxicity in Vitro: Applying a Novel Method of Arginine Functionalization. Biotechnol. Appl. Biochem. 2015, 62, 598–605. [Google Scholar] [CrossRef]
- Wilder, J.W.G.; Venema, L.C.; Rinzler, A.G.; Smalley, R.E.; Dekker, C. Electronic Structure of Atomically Resolved Carbon Nanotubes. Nature 1998, 391, 59–62. [Google Scholar] [CrossRef]
- So, H.-M.; Won, K.; Kim, Y.H.; Kim, B.-K.; Ryu, B.H.; Na, P.S.; Kim, H.; Lee, J.-O. Single-Walled Carbon Nanotube Biosensors Using Aptamers as Molecular Recognition Elements. J. Am. Chem. Soc. 2005, 127, 11906–11907. [Google Scholar] [CrossRef]
- Zhu, Y.; Zeng, G.; Zhang, Y.; Tang, L.; Chen, J.; Cheng, M.; Zhang, L.; He, L.; Guo, Y.; He, X.; et al. Highly Sensitive Electrochemical Sensor Using a MWCNTs/GNPs-Modified Electrode for Lead (II) Detection Based on Pb 2+ -Induced G-Rich DNA Conformation. Analyst 2014, 139, 5014. [Google Scholar] [CrossRef] [PubMed]
- Wongkaew, N.; Simsek, M.; Griesche, C.; Baeumner, A.J. Functional Nanomaterials and Nanostructures Enhancing Electrochemical Biosensors and Lab-on-a-Chip Performances: Recent Progress, Applications, and Future Perspective. Chem. Rev. 2019, 119, 120–194. [Google Scholar] [CrossRef] [PubMed]
- Rabai, S.; Teniou, A.; Catanante, G.; Benounis, M.; Marty, J.-L.; Rhouati, A. Fabrication of AuNPs/MWCNTS/Chitosan Nanocomposite for the Electrochemical Aptasensing of Cadmium in Water. Sensors 2021, 22, 105. [Google Scholar] [CrossRef] [PubMed]
- He, L.; Zhang, S.; Wang, M.; Peng, D.; Yan, F.; Zhang, Z.; Zhou, L. Facile Fabrication of Zinc Phosphate-Based Nanocomposites for High-Performance Electrochemical Sensing of Hg(II). Sens. Actuators B Chem. 2016, 228, 500–508. [Google Scholar] [CrossRef]
- Tao, Z.; Zhou, Y.; Duan, N.; Wang, Z. A Colorimetric Aptamer Sensor Based on the Enhanced Peroxidase Activity of Functionalized Graphene/Fe3O4-AuNPs for Detection of Lead (II) Ions. Catalysts 2020, 10, 600. [Google Scholar] [CrossRef]
- Biswas, C.; Lee, Y.H. Graphene Versus Carbon Nanotubes in Electronic Devices. Adv. Funct. Mater. 2011, 21, 3806–3826. [Google Scholar] [CrossRef]
- Zhang, Y.; Xie, J.; Liu, Y.; Pang, P.; Feng, L.; Wang, H.; Wu, Z.; Yang, W. Simple and Signal-off Electrochemical Biosensor for Mercury(II) Based on Thymine-Mercury-Thymine Hybridization Directly on Graphene. Electrochim. Acta 2015, 170, 210–217. [Google Scholar] [CrossRef]
- Hai, H.; Yang, F.; Li, J. Highly Sensitive Electrochemiluminescence “Turn-on” Aptamer Sensor for Lead(II) Ion Based on the Formation of a G-Quadruplex on a Graphene and Gold Nanoparticles Modified Electrode. Microchim. Acta 2014, 181, 893–901. [Google Scholar] [CrossRef]
- Jiang, D.; Du, X.; Chen, D.; Zhou, L.; Chen, W.; Li, Y.; Hao, N.; Qian, J.; Liu, Q.; Wang, K. One-Pot Hydrothermal Route to Fabricate Nitrogen Doped Graphene/Ag-TiO2: Efficient Charge Separation, and High-Performance “on-off-on” Switch System Based Photoelectrochemical Biosensing. Biosens. Bioelectron. 2016, 83, 149–155. [Google Scholar] [CrossRef]
- Wang, L.; Peng, X.; Fu, H. An Electrochemical Aptasensor for the Sensitive Detection of Pb2+ Based on a Chitosan/Reduced Graphene Oxide/Titanium Dioxide. Microchem. J. 2022, 174, 106977. [Google Scholar] [CrossRef]
- Li, H.; Xue, Y.; Wang, W. Femtomole Level Photoelectrochemical Aptasensing for Mercury Ions Using Quercetin–Copper(II) Complex as the DNA Intercalator. Biosens. Bioelectron. 2014, 54, 317–322. [Google Scholar] [CrossRef] [PubMed]
- Esteve-Turrillas, F.A.; Abad-Fuentes, A. Applications of Quantum Dots as Probes in Immunosensing of Small-Sized Analytes. Biosens. Bioelectron. 2013, 41, 12–29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shahdost-fard, F.; Roushani, M. Designing an Ultra-Sensitive Aptasensor Based on an AgNPs/Thiol-GQD Nanocomposite for TNT Detection at Femtomolar Levels Using the Electrochemical Oxidation of Rutin as a Redox Probe. Biosens. Bioelectron. 2017, 87, 724–731. [Google Scholar] [CrossRef] [PubMed]
- Khonsari, Y.N.; Sun, S. A Novel Label Free Electrochemiluminescent Aptasensor for the Detection of Lysozyme. Mater. Sci. Eng. C 2019, 96, 146–152. [Google Scholar] [CrossRef]
- Cao, J.-T.; Liao, X.-J.; Wang, Y.-L.; Liu, Y.-M. A Novel Photoelectrochemical Strategy for Lead Ion Detection Based on CdSe Quantum Dots Co-Sensitized ZnO-CdS Nanostructure. J. Electroanal. Chem. 2021, 880, 114828. [Google Scholar] [CrossRef]
- Adegoke, O.; Daeid, N.N. Alloyed AuFeZnSe Quantum Dots@gold Nanorod Nanocomposite as an Ultrasensitive and Selective Plasmon-Amplified Fluorescence OFF-ON Aptasensor for Arsenic (III). J. Photochem. Photobiol. A Chem. 2022, 426, 113755. [Google Scholar] [CrossRef]
- Shi, J.-J.; Zhu, J.-C.; Zhao, M.; Wang, Y.; Yang, P.; He, J. Ultrasensitive Photoelectrochemical Aptasensor for Lead Ion Detection Based on Sensitization Effect of CdTe QDs on MoS2-CdS:Mn Nanocomposites by the Formation of G-Quadruplex Structure. Talanta 2018, 183, 237–244. [Google Scholar] [CrossRef]
- Feng, D.; Li, P.; Tan, X.; Wu, Y.; Wei, F.; Du, F.; Ai, C.; Luo, Y.; Chen, Q.; Han, H. Electrochemiluminescence Aptasensor for Multiple Determination of Hg2+ and Pb2+ Ions by Using the MIL-53(Al)@CdTe-PEI Modified Electrode. Anal. Chim. Acta 2020, 1100, 232–239. [Google Scholar] [CrossRef]
- Li, L.; Chen, B.; Luo, L.; Liu, X.; Bi, X.; You, T. Sensitive and Selective Detection of Hg2+ in Tap and Canal Water via Self-Enhanced ECL Aptasensor Based on NH2–Ru@SiO2-NGQDs. Talanta 2021, 222, 121579. [Google Scholar] [CrossRef]
- Zang, Y.; Lei, J.; Hao, Q.; Ju, H. “Signal-On” Photoelectrochemical Sensing Strategy Based on Target-Dependent Aptamer Conformational Conversion for Selective Detection of Lead(II) Ion. ACS Appl. Mater. Interfaces 2014, 6, 15991–15997. [Google Scholar] [CrossRef]
- Yi, H.; Qin, R.; Ding, S.; Wang, Y.; Li, S.; Zhao, Q.; Pan, F. Structure and Properties of Prussian Blue Analogues in Energy Storage and Conversion Applications. Adv. Funct. Mater. 2021, 31, 2006970. [Google Scholar] [CrossRef]
- Lv, M.; Zhou, W.; Tavakoli, H.; Bautista, C.; Xia, J.; Wang, Z.; Li, X. Aptamer-Functionalized Metal-Organic Frameworks (MOFs) for Biosensing. Biosens. Bioelectron. 2021, 176, 112947. [Google Scholar] [CrossRef] [PubMed]
- Pavadai, R.; Amalraj, A.; Subramanian, S.; Perumal, P. High Catalytic Activity of Fluorophore-Labeled Y-Shaped DNAzyme/3D MOF-MoS 2 NBs as a Versatile Biosensing Platform for the Simultaneous Detection of Hg 2+, Ni 2+, and Ag + Ions. ACS Appl. Mater. Interfaces 2021, 13, 31710–31724. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.-H.; Duan, F.-H.; Tian, J.-Y.; He, J.-Y.; Yang, L.-Y.; Zhao, H.; Zhang, S.; Liu, C.-S.; He, L.-H.; Chen, M.; et al. Aptamer-Embedded Zirconium-Based Metal–Organic Framework Composites Prepared by De Novo Bio-Inspired Approach with Enhanced Biosensing for Detecting Trace Analytes. ACS Sens. 2017, 2, 982–989. [Google Scholar] [CrossRef] [PubMed]
- Ling, P.; Lei, J.; Ju, H. Porphyrinic Metal-Organic Framework as Electrochemical Probe for DNA Sensing via Triple-Helix Molecular Switch. Biosens. Bioelectron. 2015, 71, 373–379. [Google Scholar] [CrossRef]
- Zhang, Z.; Ji, H.; Song, Y.; Zhang, S.; Wang, M.; Jia, C.; Tian, J.-Y.; He, L.; Zhang, X.; Liu, C.-S. Fe(III)-Based Metal–Organic Framework-Derived Core–Shell Nanostructure: Sensitive Electrochemical Platform for High Trace Determination of Heavy Metal Ions. Biosens. Bioelectron. 2017, 94, 358–364. [Google Scholar] [CrossRef] [PubMed]
- Wei, M.; Yue, S.; Liu, Y. An Amplified Electrochemical Aptasensor for Ochratoxin A Based on DNAzyme-Mediated DNA Walker. J. Electroanal. Chem. 2021, 891, 115269. [Google Scholar] [CrossRef]
- Li, Y.; Liu, D.; Zhu, C.; Wang, M.; Liu, Y.; You, T. A Ratiometry-Induced Successive Reusable Electrochemical Aptasensing Platform: Efficient Monitoring of Aflatoxin B1 in Peanut. Sens. Actuators B Chem. 2021, 336, 129021. [Google Scholar] [CrossRef]
- El-Moghazy, A.Y.; Amaly, N.; Istamboulie, G.; Nitin, N.; Sun, G. A Signal-on Electrochemical Aptasensor Based on Silanized Cellulose Nanofibers for Rapid Point-of-Use Detection of Ochratoxin A. Microchim. Acta 2020, 187, 535. [Google Scholar] [CrossRef]
- Yola, M.L.; Atar, N.; Özcan, N. A Novel Electrochemical Lung Cancer Biomarker Cytokeratin 19 Fragment Antigen 21-1 Immunosensor Based on Si3N4/MoS2 Incorporated MWCNTs and Core–Shell Type Magnetic Nanoparticles. Nanoscale 2021, 13, 4660–4669. [Google Scholar] [CrossRef]
- Vu, Q.K.; Tran, Q.H.; Vu, N.P.; Anh, T.-L.; Dang, T.T.L.; Matteo, T.; Nguyen, T.H.H. A Label-Free Electrochemical Biosensor Based on Screen-Printed Electrodes Modified with Gold Nanoparticles for Quick Detection of Bacterial Pathogens. Mater. Today Commun. 2021, 26, 101726. [Google Scholar] [CrossRef]
- Jin, W.; Maduraiveeran, G. Nanomaterial-Based Environmental Sensing Platforms Using State-of-the-Art Electroanalytical Strategies. J. Anal. Sci. Technol. 2018, 9, 18. [Google Scholar] [CrossRef]
- Yola, M.L. Sensitive Sandwich-Type Voltammetric Immunosensor for Breast Cancer Biomarker HER2 Detection Based on Gold Nanoparticles Decorated Cu-MOF and Cu2ZnSnS4 NPs/Pt/g-C3N4 Composite. Microchim. Acta 2021, 188, 78. [Google Scholar] [CrossRef] [PubMed]
- Mayorga-Martinez, C.C.; Chamorro-Garcia, A.; Merkoçi, A. Electrochemical Impedance Spectroscopy (Bio)Sensing through Hydrogen Evolution Reaction Induced by Gold Nanoparticles. Biosens. Bioelectron. 2015, 67, 53–58. [Google Scholar] [CrossRef] [Green Version]
- Mahmoud, A.M.; Alkahtani, S.A.; Alyami, B.A.; El-Wekil, M.M. Dual-Recognition Molecularly Imprinted Aptasensor Based on Gold Nanoparticles Decorated Carboxylated Carbon Nanotubes for Highly Selective and Sensitive Determination of Histamine in Different Matrices. Anal. Chim. Acta 2020, 1133, 58–65. [Google Scholar] [CrossRef]
- Sun, K.; Xia, N.; Zhao, L.; Liu, K.; Hou, W.; Liu, L. Aptasensors for the Selective Detection of Alpha-Synuclein Oligomer by Colorimetry, Surface Plasmon Resonance and Electrochemical Impedance Spectroscopy. Sens. Actuators B Chem. 2017, 245, 87–94. [Google Scholar] [CrossRef]
- Gu, H.; Yang, Y.; Chen, F.; Liu, T.; Jin, J.; Pan, Y.; Miao, P. Electrochemical Detection of Arsenic Contamination Based on Hybridization Chain Reaction and RecJf Exonuclease-Mediated Amplification. Chem. Eng. J. 2018, 353, 305–310. [Google Scholar] [CrossRef]
- Rabai, S.; Benounis, M.; Catanante, G.; Baraket, A.; Errachid, A.; Jaffrezic Renault, N.; Marty, J.-L.; Rhouati, A. Development of a Label-Free Electrochemical Aptasensor Based on Diazonium Electrodeposition: Application to Cadmium Detection in Water. Anal. Biochem. 2021, 612, 113956. [Google Scholar] [CrossRef]
- Diaz-Amaya, S.; Lin, L.-K.; DiNino, R.E.; Ostos, C.; Stanciu, L.A. Inkjet Printed Electrochemical Aptasensor for Detection of Hg2+ in Organic Solvents. Electrochim. Acta 2019, 316, 33–42. [Google Scholar] [CrossRef]
- Wang, Y.; Zhao, G.; Zhang, Q.; Wang, H.; Zhang, Y.; Cao, W.; Zhang, N.; Du, B.; Wei, Q. Electrochemical Aptasensor Based on Gold Modified Graphene Nanocomposite with Different Morphologies for Ultrasensitive Detection of Pb2+. Sens. Actuators B Chem. 2019, 288, 325–331. [Google Scholar] [CrossRef]
- Yadav, R.; Berlina, A.N.; Zherdev, A.V.; Gaur, M.S.; Dzantiev, B.B. Rapid and Selective Electrochemical Detection of Pb2+ Ions Using Aptamer-Conjugated Alloy Nanoparticles. SN Appl. Sci. 2020, 2, 2077. [Google Scholar] [CrossRef]
- Du, H.; Xie, Y.; Wang, J. Nanomaterial-Sensors for Herbicides Detection Using Electrochemical Techniques and Prospect Applications. TrAC Trends Anal. Chem. 2021, 135, 116178. [Google Scholar] [CrossRef]
- Luo, J.; Jiang, D.; Liu, T.; Peng, J.; Chu, Z.; Jin, W. High-Performance Electrochemical Mercury Aptasensor Based on Synergistic Amplification of Pt Nanotube Arrays and Fe3O4/RGO Nanoprobes. Biosens. Bioelectron. 2018, 104, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Lee, C.-S.; Yu, S.H.; Kim, T.H. A “Turn-on” Electrochemical Aptasensor for Ultrasensitive Detection of Cd2+ Using Duplexed Aptamer Switch on Electrochemically Reduced Graphene Oxide Electrode. Microchem. J. 2020, 159, 105372. [Google Scholar] [CrossRef]
- Yu, S.H.; Lee, C.-S.; Kim, T.H. Electrochemical Detection of Ultratrace Lead Ion through Attaching and Detaching DNA Aptamer from Electrochemically Reduced Graphene Oxide Electrode. Nanomaterials 2019, 9, 817. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ding, J.; Zhang, D.; Liu, Y.; Yu, M.; Zhan, X.; Zhang, D.; Zhou, P. An Electrochemical Aptasensor for Detection of Lead Ions Using a Screen-Printed Carbon Electrode Modified with Au/Polypyrrole Composites and Toluidine Blue. Anal. Methods 2019, 11, 4274–4279. [Google Scholar] [CrossRef]
- Ma, N.; Ren, X.; Wang, H.; Kuang, X.; Fan, D.; Wu, D.; Wei, Q. Ultrasensitive Controlled Release Aptasensor Using Thymine–Hg 2+ –Thymine Mismatch as a Molecular Switch for Hg 2+ Detection. Anal. Chem. 2020, 92, 14069–14075. [Google Scholar] [CrossRef]
- Jin, H.; Zhang, D.; Liu, Y.; Wei, M. An Electrochemical Aptasensor for Lead Ion Detection Based on Catalytic Hairpin Assembly and Porous Carbon Supported Platinum as Signal Amplification. RSC Adv. 2020, 10, 6647–6653. [Google Scholar] [CrossRef]
- Williams, T.; Shum, R.; Rappleye, D. Review—Concentration Measurements In Molten Chloride Salts Using Electrochemical Methods. J. Electrochem. Soc. 2021, 168, 123510. [Google Scholar] [CrossRef]
- Fakude, C.T.; Arotiba, O.A.; Arduini, F.; Mabuba, N. Flexible Polyester Screen-printed Electrode Modified with Carbon Nanofibers for the Electrochemical Aptasensing of Cadmium (II). Electroanalysis 2020, 32, 2650–2658. [Google Scholar] [CrossRef]
- Fakude, C.T.; Arotiba, O.A.; Mabuba, N. Electrochemical Aptasensing of Cadmium (II) on a Carbon Black-Gold Nano-Platform. J. Electroanal. Chem. 2020, 858, 113796. [Google Scholar] [CrossRef]
- Mushiana, T.; Mabuba, N.; Idris, A.O.; Peleyeju, G.M.; Orimolade, B.O.; Nkosi, D.; Ajayi, R.F.; Arotiba, O.A. An Aptasensor for Arsenic on a Carbon-gold Bi-Nanoparticle Platform. Sens. Bio-Sens. Res. 2019, 24, 100280. [Google Scholar] [CrossRef]
- Si, X.; Tang, S.; Wang, K.; Zhou, G.; Xia, J.; Zhao, Y.; Zhao, H.; Shen, Q.; Liu, Z. Electrochemical Amplification for Hg(II) Quantification by Anchoring an Enzymatically Extended Aptamer. Anal. Lett. 2019, 52, 2883–2895. [Google Scholar] [CrossRef]
- Wen, J.; Zeng, G. Chemical and Biological Assessment of Cd-Polluted Sediment for Land Use: The Effect of Stabilization Using Chitosan-Coated Zeolite. J. Environ. Manag. 2018, 212, 46–53. [Google Scholar] [CrossRef] [PubMed]
- Kong, W.; Qu, F.; Lu, L. A Photoelectrochemical Aptasensor Based on P-n Heterojunction CdS-Cu2O Nanorod Arrays with Enhanced Photocurrent for the Detection of Prostate-Specific Antigen. Anal. Bioanal. Chem. 2020, 412, 841–848. [Google Scholar] [CrossRef] [PubMed]
- Niu, Y.; Xie, H.; Luo, G.; Zhuang, Y.; Wu, X.; Li, G.; Sun, W. ZnO-Reduced Graphene Oxide Composite Based Photoelectrochemical Aptasensor for Sensitive Cd(II) Detection with Methylene Blue as Sensitizer. Anal. Chim. Acta 2020, 1118, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Niu, Y.; Luo, G.; Xie, H.; Zhuang, Y.; Wu, X.; Li, G.; Sun, W. Photoelectrochemical Aptasensor for Lead(II) by Exploiting the CdS Nanoparticle-Assisted Photoactivity of TiO2 Nanoparticles and by Using the Quercetin-Copper(II) Complex as the DNA Intercalator. Microchim. Acta 2019, 186, 826. [Google Scholar] [CrossRef]
- Yuan, Y.; Li, X.; Chen, A.-Y.; Wang, H.-J.; Chai, Y.-Q.; Yuan, R. Highly-Efficient Luminol Immobilization Approach and Exponential Strand Displacement Reaction Based Electrochemiluminescent Strategy for Monitoring MicroRNA Expression in Cell. Biosens. Bioelectron. 2019, 132, 62–67. [Google Scholar] [CrossRef] [PubMed]
- Tang, H.; Chen, W.; Li, D.; Duan, X.; Ding, S.; Zhao, M.; Zhang, J. Luminol-Based Ternary Electrochemiluminescence Nanospheres as Signal Tags and Target-Triggered Strand Displacement Reaction as Signal Amplification for Highly Sensitive Detection of Helicobacter Pylori DNA. Sens. Actuators B Chem. 2019, 293, 304–311. [Google Scholar] [CrossRef]
- Xie, X.; Wang, H.; Zhang, L.; Liu, Y.; Chai, Y.; Yuan, Y.; Yuan, R. A Novel Electrochemiluminescence Immunosensor Based on Functional β-Cyclodextrin-Ferrocene Host-Guest Complex with Multiple Signal Amplification. Sens. Actuators B Chem. 2018, 258, 1146–1151. [Google Scholar] [CrossRef]
- Walker, G.T.; Fraiser, M.S.; Schram, J.L.; Little, M.C.; Nadeau, J.G.; Malinowski, D.P. Strand Displacement Amplification—an Isothermal, in Vitro DNA Amplification Technique. Nucleic Acids Res. 1992, 20, 1691–1696. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, X.; Zhang, S.; Li, W.; Zhan, Y.; Yu, L.; Wu, X.; Li, J.; Xu, H.; Yang, G. Label-Free and Immobilization-Free Electrochemiluminescent Sensing Platform for Highly Sensitive Detection of As(III) by Combining Target-Induced Strand Displacement Amplification with Polydopamine Nanospheres. Sens. Actuators B Chem. 2020, 311, 127818. [Google Scholar] [CrossRef]
- Xu, H.; Zhang, S.; Zhang, T.; Huang, W.; Dai, Y.; Zheng, R.; Wu, G. An Electrochemiluminescence Biosensor for Cadmium Ion Based on Target-Induced Strand Displacement Amplification and Magnetic Fe3O4-GO Nanosheets. Talanta 2022, 237, 122967. [Google Scholar] [CrossRef]
- Ma, F.; Chen, Y.; Zhu, Y.; Liu, J. Electrogenerated Chemiluminescence Biosensor for Detection of Mercury (II) Ion via Target-Triggered Manipulation of DNA Three-Way Junctions. Talanta 2019, 194, 114–118. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Chen, M.; Wu, J.; Mo, F.; Fu, Y. Multi-Functional Electrochemiluminescence Aptasensor Based on Resonance Energy Transfer between Au Nanoparticles and Lanthanum Ion-Doped Cadmium Sulfide Quantum Dots. Anal. Chim. Acta 2019, 1086, 66–74. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Deng, Y.; Li, T.; Chen, Z.; Chen, H.; Li, S.; Liu, H. Aptamer-Based Electrochemical Biosensor for Mercury Ions Detection Using AuNPs-Modified Glass Carbon Electrode. J. Biomed. Nanotechnol. 2018, 14, 2156–2161. [Google Scholar] [CrossRef]
- Wu, D.; Wang, Y.; Zhang, Y.; Ma, H.; Pang, X.; Hu, L.; Du, B.; Wei, Q. Facile Fabrication of an Electrochemical Aptasensor Based on Magnetic Electrode by Using Streptavidin Modified Magnetic Beads for Sensitive and Specific Detection of Hg 2+. Biosens. Bioelectron. 2016, 82, 9–13. [Google Scholar] [CrossRef]
- Taghdisi, S.M.; Danesh, N.M.; Lavaee, P.; Ramezani, M.; Abnous, K. An Electrochemical Aptasensor Based on Gold Nanoparticles, Thionine and Hairpin Structure of Complementary Strand of Aptamer for Ultrasensitive Detection of Lead. Sens. Actuators B Chem. 2016, 234, 462–469. [Google Scholar] [CrossRef]
- Jia, J.; Chen, H.G.; Feng, J.; Lei, J.L.; Luo, H.Q.; Li, N.B. A Regenerative Ratiometric Electrochemical Biosensor for Selective Detecting Hg2+ Based on Y-Shaped/Hairpin DNA Transformation. Anal. Chim. Acta 2016, 908, 95–101. [Google Scholar] [CrossRef]
- Niu, Y.; Chen, Y.; Zhang, X.; Xie, H.; Luo, G.; Sun, W. Target-Enhanced Photoelectrochemical Aptasensor for Cd(II) Detection Using Graphite-like Carbon Nitride as Sensitizer with High Sensitivity. Microchem. J. 2021, 168, 106394. [Google Scholar] [CrossRef]
Method | Target | LOD (nM) | Linear Range (nM) | Aptamer Sequence | Sample | Reference |
---|---|---|---|---|---|---|
EIS | Hg2+ | 0.071 | 0.1~50 | 5′-CCCCCCCCCCCCTTCTTTCTTCCCCT TGTTTGTT-3′ | Tap water | [44] |
Hg2+ | 25 | 25~500 | 5′-TTTCTTCTTTCTTCCCCCCTTGTTTGT TT-3′ | Water | [79] | |
Cd2+ | 0.275 | 1~1 × 106 | 5’-ACCGACCGTGCTGGACTCTGGACTG TTGTGGTATTATTTTTGGTTGTGCAGTA TGAGCGAGCGTTGCG-3′ | River water | [78] | |
Pb2+ | 1.67 × 10−3 | 5 × 10−3~1 | 5′-HS-TTTTTTCGATAACTCACTATrAGG AAGAGATG-3′ | Serum Water | [80] | |
As3+ | 0.26 | 1.3~6.5 | 5′-TGATGTTTGTTTACGCATGTGTGAG GAGGCTGGGGTGATGAATCCCAATCCC-3′ | Tap water | [77] | |
Pb2+ As3+ | 2.27 × 10−3 6.73 × 10−3 | 0.01~10.0 | 5′-CAACGGTGGGTGTGGTTGG-3′ 5′-GGTAATACGACTCACTATAGGGAG ATACCA GCTTATTCAATTTTACAGAA CAACCAACGTCGCTCCGGGTACTTCTT CATCGAGATAGTAAGTGCAATCT-3′ | River water | [66] | |
DPV | Hg2+ | 0.03 | 0.01~100 | 5′-SH-(CH2)6-AAAAATTTCCTTTGCTTT-3′ | Lake water | [35] |
Hg2+ | 5 × 10−3 | 0.025~1 × 10−6 | 5′-(NH2C6)-CTT GCT TTC TGT-3′ | Lake water | [47] | |
Hg2+ | 0.03 | 0.1~100 | 5’-SH-(CH2)6-ACCGTGTTTGCCTTTGAC CTC-3’ | Lake water | [83] | |
Hg2+ | 2.9 × 10−3 | 0.01~1 × 105 | 5′-COOH-CTTCTTCCCCCCCCTTCTTC -SH-3′ | River water | [87] | |
Hg2+ | 5 × 10−3 | 0.01~500 | 5′-SH-(CH2)6-TCATGTTTGTTTGTGGCC CCCCTTCTTTCTTA-Fc-3′ | Tap water | [106] | |
Hg2+ | 0.33 | 1~200 | 5′-Bio-TCTTTCTTCCCTTGTTTGT-3′ | Tap water | [107] | |
Cd2+ | 5 × 10−5 | 1 × 10−3~100 | 5′-ACCGACCGTGCTGGACTCTGACTG TTGTGGTATTATTTTTGGTTGTGCAGT ATGAGCGAGCGTTGCG-3′ | Tap water | [33] | |
Cd2+ | 6.5 × 10−7 | 1 × 10−6~1 | 5′-GGGGGGGGACTGTTGTGGTATTATT TTTGGTTGTGCAGT-MB-3′ | Valley water | [84] | |
Pb2+ | 4.3×10−9 | 1.0×10−8~5.0×10−5 | 5′-GGGTGGGTGGGTGGGT-3′ | Springwater | [41] | |
Pb2+ | 1.6 × 10−3 | 4.8 × 10−3~4.8 | 5′-GGTTGGGCGGGATGGGTG-3′ | Tea and Rice | [50] | |
Pb2+ | 5.1 × 10−7 | 1 × 10−6~1 | 5′-MB-GGTGGTGGTGGTTGTGGTGGTG GTGG-3′ | Tap water | [85] | |
Pb2+ | 2.88 | 2.4~120 | 5′-GGGTGGGTGGGTGGGT-3′ | Soil | [86] | |
Pb2+ | 0.018 | 0.05~1 × 103 | 5′-GGGTGGGTGGGTGGGTAT-3′ | Tap water | [88] | |
Pb2+ | 0.312 | 0.5~50 | 5′-GGGTGGGTGGGTGGGT-3′ | Serum | [108] | |
As3+ | 4 × 10−5 | 0.13~130 | 5′-HS-GGTAATACGACTCATAAGGGA GATGCTTATTCAATTTTACAGAACACCAAGTCGCTTACTTCTTCATCGAGATAGTAAGTGCAATCT-3′ | River water | [34] | |
SWV | Hg2+ | 1.79 | 10~100 | 5′-MB-CGCTTTAGATG-3′ | Juice | [36] |
Hg2+ | 1 × 10−4 | 2 × 10−3~20 | 5′-SH-AATTCTCTCTTCGACGTTGTGT GTT-3′ | Tap water | [93] | |
Hg2+ | 0.094 | 1~5 × 103 | 5’-SH-(CH2)6-CTGTTTTCTTTCGGACGA CCCCCCTCGTCCGTTTGTTTTCAG-MB+-3′ | River water | [109] | |
Cd2+ Pb2+ | 0.089 0.016 | 0.1~1000 | 5′-CTCAGGACGACGGGTTCACAGTC CGTTGTC-Fc-3′ 5′-GGT TGG TGT GGT TGG-MB-3′ | Lettuce Orange | [31] | |
Cd2+ | 0.014 | 0.1~5 | 5′-HS(CH2)6GGACTGTTGTGGTATTAT TTTTGGTTGTGCAGTATG-3′ | Tap water | [91] | |
As3+ | 0.7 | 3.83~766 | 5′-HS-GGTAATACGACTCATTAGGGAG ATCAGCTTATTCAATTTTACAGAACA ACCAACGTCGCTCCGGTACTTCTTCAT CGAGATAGTAAGTGCAATCT-3′ | None | [92] | |
PEC | Hg2+ | 3.33 × 10−6 | 1 × 10−5−1 × 10−3 | 5′-NH2-(CH2)6-TTTTTTTTTTTTTTTTTTTT -3′ | Tap water | [51] |
Cd2+ | 1.8 × 10−3 | 5 × 10−3~29 | 5′-GGACTGTTGTGGTATTATTTTTGGT TGTGCAGTATG-3′ | Lake water | [96] | |
Cd2+ | 0.011 | 0.03~40 | 5′-SH-GGACTGTTGTGGTATTATTTTTG GTTGTGCAGTATG-NH2-3′ | Lake water | [110] | |
Pb2+ | 3 × 10−4 | 1 × 10−3~5 | 5′-TTGGGTGGGTGGGTGGGT-3′ | Tap water | [49] | |
Pb2+ | 1.67 × 10−5 | 5 × 10−5~1 × 103 | 5′-NH2-(CH2)6-TTGGGTGGGTGGGTGGG T-P-3′ | Reservoir water | [57] | |
Pb2+ | 0.05 | 0.1~50 | 5′-NH2-(CH2)6-TTGGGTGGGTGGGTGG GT-3′ | Tap water | [60] | |
Pb2+ | 1.6 × 10−3 | 5 × 10−3~10 | 5′-SH-GGGTGGGTGGGTGGGT-3′ | Soil | [97] | |
Pb2+ | 0.34 | 1~1 × 104 | 5′-NH2-(CH2)6-TTGGGTGGGTGGGTGGG T-3′ | River water | [55] | |
ECL | Hg2+ | 0.01 | 0.05~1 × 103 | 5′-NH2-TTGTTTGTCCCCTCTTTCTTA-(CH2)3-SH-3′ | Tap water | [59] |
Hg2+ | 4 × 10−5 | 1 × 10−4~0.01 | 5′-amino-(CH2)6-O-TCTCCAGCGTCGTT TGTTTGCGGGAGCTTTCTTAAATCTCG AGCTAAA-3′ | Water | [104] | |
Hg2+ | 3 × 10−4 | 1 × 10−3~1 × 104 | 5′-GGTTGGTGTGGTTGGTTCTTTCTT CCCTTGTTTGTT(CH2)6-SH-3′ | None | [105] | |
Hg2+ Pb2+ | 4.1 × 10−6 2.4 × 10−5 | 1.0 × 10−5~0.01 1.0 × 10−4~10 | 5′-TTTTTTAAAATTTTTT-SH-3′ 5′-COOH-(CH2)10-AAAAAAAAAGGGG-SH-3′ | Shrimp | [58] | |
Cd2+ | 9.7 × 10−4 | 0.26~2.6 × 106 | 5′-ACCGACCGTGCTGGACTCTGGAC TGTTGTGGTATTATTTTTGGTTGTGCA GTATGAGCGAGCGTTGCG-3′ | Extracting solution of sophora | [103] | |
Pb2+ | 4 × 10−8 | 1.0 × 10−7~0.1 | 5′-GGTTGGTGTGGTTGG-3′ | Soil | [32] | |
Pb2+ | 3.82 × 10−6 | 1.0 × 10−5~1.0 × 10−2 | 5′-SH- (CH2)6-TTTTTACCCAGGGTGGG TGGG-TGGGT-(CH2)6-NH2-3′ | River water | [48] | |
As3+ | 9.2 × 10−3 | 15.3~1.53 × 104 | 5′-GGTAATACGACTCACTATAGGGAG ATACCAGCTTATTCAATTTTACAGAA CAACCAACGTCGCTCCGGGTACTTCT TCATCGAGATAGTAAGTGCAATCT-3′ | Extracting solution of sophora | [102] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Z.; Xie, M.; Zhao, F.; Han, S. Application of Nanomaterial Modified Aptamer-Based Electrochemical Sensor in Detection of Heavy Metal Ions. Foods 2022, 11, 1404. https://doi.org/10.3390/foods11101404
Chen Z, Xie M, Zhao F, Han S. Application of Nanomaterial Modified Aptamer-Based Electrochemical Sensor in Detection of Heavy Metal Ions. Foods. 2022; 11(10):1404. https://doi.org/10.3390/foods11101404
Chicago/Turabian StyleChen, Zanlin, Miaojia Xie, Fengguang Zhao, and Shuangyan Han. 2022. "Application of Nanomaterial Modified Aptamer-Based Electrochemical Sensor in Detection of Heavy Metal Ions" Foods 11, no. 10: 1404. https://doi.org/10.3390/foods11101404
APA StyleChen, Z., Xie, M., Zhao, F., & Han, S. (2022). Application of Nanomaterial Modified Aptamer-Based Electrochemical Sensor in Detection of Heavy Metal Ions. Foods, 11(10), 1404. https://doi.org/10.3390/foods11101404