A Systematic Review of In Vitro Studies Using Microchip Platforms for Identifying Periodontopathogens from the Red Complex
Abstract
:1. Introduction
2. Materials and Methods
2.1. Search Approach
2.2. Selection Criteria
2.3. Question
- P:
- experimentation with P. gingivalis, T. forsythia, and T. denticola.
- I:
- microchip platforms.
- C:
- control experiments.
- O:
- identification of microorganisms of the red complex.
2.4. Review Course
2.5. Compilation of Data
2.6. Risk of Bias
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Payne, M.A.; Hashim, A.; Alsam, A.; Joseph, S.; Aduse-Opoku, J.; Wade, W.G.; Curtis, M.A. Horizontal and Vertical Transfer of Oral Microbial Dysbiosis and Periodontal Disease. J. Dent. Res. 2019, 98, 1503–1510. [Google Scholar] [CrossRef] [PubMed]
- Fragkioudakis, I.; Riggio, M.P.; Apatzidou, D.A. Understanding the microbial components of periodontal diseases and periodontal treatment-induced microbiological shifts. J. Med. Microbiol. 2021, 70, 001247. [Google Scholar] [CrossRef] [PubMed]
- Gasmi Benahmed, A.; Kumar Mujawdiya, P.; Noor, S.; Gasmi, A. Porphyromonas Gingivalis in the Development of Periodontitis: Impact on Dysbiosis and Inflammation. Arch. Razi Inst. 2022, 77, 1539–1551. [Google Scholar] [PubMed]
- Jiang, Y.; Brandt, B.W.; Buijs, M.J.; Cheng, L.; Exterkate, R.A.M.; Crielaard, W.; Deng, D.M. Manipulation of Saliva-Derived Microcosm Biofilms to Resemble Dysbiotic Subgingival Microbiota. Appl. Environ. Microbiol. 2021, 87, e02371-20. [Google Scholar] [CrossRef]
- Jiang, Y.; Song, B.; Brandt, B.W.; Cheng, L.; Zhou, X.; Exterkate, R.A.M.; Crielaard, W.; Deng, D.M. Comparison of Red-Complex Bacteria between Saliva and Subgingival Plaque of Periodontitis Patients: A Systematic Review and Meta-Analysis. Front. Cell Infect. Microbiol. 2021, 11, 727732. [Google Scholar] [CrossRef]
- Socransky, S.S.; Haffajee, A.D.; Cugini, M.A.; Smith, C.; Kent, R.L., Jr. Microbial complexes in subgingival plaque. J. Clin. Periodontol. 1998, 25, 134–144. [Google Scholar] [CrossRef]
- Prucsi, Z.; Płonczyńska, A.; Potempa, J.; Sochalska, M. Uncovering the Oral Dysbiotic Microbiota as Masters of Neutrophil Responses in the Pathobiology of Periodontitis. Front. Microbiol. 2021, 12, 729717. [Google Scholar] [CrossRef]
- Mohanty, R.; Asopa, S.J.; Joseph, M.D.; Singh, B.; Rajguru, J.P.; Saidath, K.; Sharma, U. Red complex: Polymicrobial conglomerate in oral flora: A review. J. Fam. Med. Prim. Care 2019, 8, 3480–3486. [Google Scholar]
- Ardila, C.M.; Bedoya-García, J.A.; Arrubla-Escobar, D.E. Antibiotic resistance in periodontitis patients: A systematic scoping review of randomized clinical trials. Oral Dis. 2023, 29, 2501–2511. [Google Scholar] [CrossRef]
- Hughes, C.; Ferguson, J. Phenotypic chlorhexidine and triclosan susceptibility in clinical Staphylococcus aureus isolates in Australia. Pathology 2017, 49, 633–637. [Google Scholar] [CrossRef]
- Rams, T.E.; Degener, J.E.; van Winkelhoff, A.J. Antibiotic resistance in human peri-implantitis microbiota. Clin. Oral Implant. Res. 2014, 25, 82–90. [Google Scholar] [CrossRef] [PubMed]
- Ardila, C.M.; Bedoya-García, J.A.; González-Arroyave, D. Antimicrobial resistance in patients with endodontic infections: A systematic scoping review of observational studies. Aust. Endod. J. 2023, 49, 386–395. [Google Scholar] [CrossRef] [PubMed]
- Balouiri, M.; Sadiki, M.; Ibnsouda, S.K. Methods for in vitro evaluating antimicrobial activity: A review. J. Pharm. Anal. 2016, 6, 71–79. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Rodríguez, S.; García-Aznar, J.M.; Gonzalo-Asensio, J. Microfluidic devices for studying bacterial taxis, drug testing and biofilm formation. Microb. Biotechnol. 2022, 15, 395–414. [Google Scholar] [CrossRef]
- Bodor, A.; Bounedjoum, N.; Vincze, G.E.; Erdeiné Kis, Á.; Laczi, K.; Bende, G.; Szilágyi, Á.; Kovács, T.; Perei, K.; Rákhely, G. Challenges of unculturable bacteria: Environmental perspectives. Rev. Environ. Sci. Biotechnol. 2020, 19, 1–22. [Google Scholar] [CrossRef]
- Lebeaux, D.; Chauhan, A.; Rendueles, O.; Beloin, C. From in vitro to in vivo Models of Bacterial Biofilm-Related Infections. Pathogens 2013, 2, 288–356. [Google Scholar] [CrossRef]
- Postek, W.; Pacocha, N.; Garstecki, P. Microfluidics for antibiotic susceptibility testing. Lab Chip 2022, 22, 3637–3662. [Google Scholar] [CrossRef]
- Kaprou, G.D.; Bergšpica, I.; Alexa, E.A.; Alvarez-Ordóñez, A.; Prieto, M. Rapid Methods for Antimicrobial Resistance Diagnostics. Antibiotics 2021, 10, 209. [Google Scholar] [CrossRef]
- Lee, W.B.; Chien, C.C.; You, H.L.; Kuo, F.C.; Lee, M.S.; Lee, G.B. An integrated microfluidic system for antimicrobial susceptibility testing with antibiotic combination. Lab Chip 2019, 19, 2699–2708. [Google Scholar] [CrossRef]
- Boedicker, J.Q.; Li, L.; Kline, T.R.; Ismagilov, R.F. Detecting bacteria and determining their susceptibility to antibiotics by stochastic confinement in nanoliter droplets using plug-based microfluidics. Lab Chip 2008, 8, 1265–1272. [Google Scholar] [CrossRef]
- Hou, H.W.; Bhattacharyya, R.P.; Hung, D.T.; Han, J. Direct detection and drug-resistance profiling of bacteremias using inertial microfluidics. Lab Chip 2015, 15, 2297–2307. [Google Scholar] [CrossRef] [PubMed]
- Sun, H.; Liu, Z.; Hu, C.; Ren, K. Cell-on-hydrogel platform made of agar and alginate for rapid, low-cost, multidimensional test of antimicrobial susceptibility. Lab Chip 2016, 16, 3130–3138. [Google Scholar] [CrossRef] [PubMed]
- Page, M.J.; McKenzie, J.E.; Bossuyt, P.M.; Boutron, I.; Hoffmann, T.C.; Mulrow, C.D.; Shamseer, L.; Tetzlaff, J.M.; Akl, E.A.; Brennan, S.E.; et al. The PRISMA 2020 statement: An updated guideline for reporting systematic reviews. Int. J. Surg. 2021, 88, 105906. [Google Scholar] [CrossRef] [PubMed]
- Sheth, V.H.; Shah, N.P.; Jain, R.; Bhanushali, N.; Bhatnagar, V. Development and validation of a risk-of-bias tool for assessing in vitro studies conducted in dentistry: The QUIN. J. Prosthet. Dent. 2022; in press. [Google Scholar] [CrossRef]
- Zhu, T.; Pei, Z.; Huang, J.; Xiong, C.; Shi, S.; Fang, J. Detection of bacterial cells by impedance spectra via fluidic electrodes in a microfluidic device. Lab Chip 2010, 10, 1557–1560. [Google Scholar] [CrossRef]
- Li, Z.; Ju, R.; Sekine, S.; Zhang, D.; Zhuang, S.; Yamaguchi, Y. All-in-one microfluidic device for on-site diagnosis of pathogens based on an integrated continuous flow PCR and electrophoresis biochip. Lab Chip 2019, 19, 2663–2668. [Google Scholar] [CrossRef]
- Li, Z.; Li, Y.; Sekine, S.; Xi, H.; Amano, A.; Zhang, D.; Yamaguchi, Y. Design and fabrication of portable continuous flow PCR microfluidic chip for DNA replication. Biomed. Microdevices 2019, 22, 5. [Google Scholar] [CrossRef]
- Li, Z.; Liu, J.; Wang, P.; Tao, C.; Zheng, L.; Sekine, S.; Zhuang, S.; Zhang, D.; Yamaguchi, Y. Multiplex amplification of target genes of periodontal pathogens in continuous flow PCR microfluidic chip. Lab Chip 2021, 21, 3159–3164. [Google Scholar] [CrossRef]
- Yang, B.; Wang, P.; Li, Z.; Tao, C.; You, Q.; Sekine, S.; Zhuang, S.; Zhang, D.; Yamaguchi, Y. A continuous flow PCR array microfluidic chip applied for simultaneous amplification of target genes of periodontal pathogens. Lab Chip 2022, 22, 733–737. [Google Scholar] [CrossRef]
- Li, Z.; Wang, Y.; Gao, Z.; Sekine, S.; You, Q.; Zhuang, S.; Zhang, D.; Feng, S.; Yamaguchi, Y. Lower fluidic resistance of double-layer droplet continuous flow PCR microfluidic chip for rapid detection of bacteria. Anal. Chim. Acta 2023, 1251, 340995. [Google Scholar] [CrossRef]
- Yang, B.; Huang, J.; Tao, C.; Li, Z.; Zhang, D.; Yamaguchi, Y. Detection of Periodontal Pathogens Based on an Integrated Continuous Flow PCR and Capillary Electrophoresis Microfluidic Chip. Separations 2023, 10, 271. [Google Scholar] [CrossRef]
- Yang, B.; Wang, P.; Li, Z.; You, Q.; Sekine, S.; Ma, J.; Zhuang, S.; Zhang, D.; Yamaguchi, Y. Simultaneous amplification of DNA in a multiplex circular array shaped continuous flow PCR microfluidic chip for on-site detection of bacterial. Lab Chip 2023, 23, 2633–2639. [Google Scholar] [CrossRef] [PubMed]
- Baumgartner, D.; Johannsen, B.; Specht, M.; Lüddecke, J.; Rombach, M.; Hin, S.; Paust, N.; von Stetten, F.; Zengerle, R.; Herz, C.; et al. OralDisk: A Chair-Side Compatible Molecular Platform Using Whole Saliva for Monitoring Oral Health at the Dental Practice. Biosensors 2021, 11, 423. [Google Scholar] [CrossRef] [PubMed]
- Nakka, S.S.; Lönn, J.; Starkhammar Johansson, C.; Bengtsson, T.; Nayeri, F. Antibodies produced in vitro in the detection of periodontal bacteria by using surface plasmon resonance analysis. Clin. Exp. Dent. Res. 2015, 1, 32–44. [Google Scholar] [CrossRef] [PubMed]
- Mullis, K.; Faloona, F.; Scharf, S.; Saiki, R.; Horn, G.; Erlich, H. Specific enzymatic amplification of DNA in vitro: The polymerase chain reaction. Cold Spring Harb. Symp. Quant. Biol. 1986, 51 Pt 1, 263–273. [Google Scholar] [CrossRef]
- Son, J.; Cho, B.; Hong, S.; Lee, S.H.; Hoxha, O.; Haacket, A.J.; Lee, L.P. Ultrafast photonic PCR. Light Sci. Appl. 2015, 4, e280. [Google Scholar] [CrossRef]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, E63. [Google Scholar] [CrossRef]
- Wang, X.; Seo, D.J.; Lee, M.H.; Choi, C. Comparison of conventional PCR, multiplex PCR, and loop-mediated isothermal amplification assays for rapid detection of Arcobacter species. J. Clin. Microbiol. 2014, 52, 557–563. [Google Scholar] [CrossRef]
- Waliullah, S.; Ling, K.S.; Cieniewicz, E.J.; Oliver, J.E.; Ji, P.; Ali, M.E. Development of Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Cucurbit Leaf Crumple Virus. Int. J. Mol. Sci. 2020, 21, 1756. [Google Scholar] [CrossRef]
- Krishnan, M.; Ugaz, V.M.; Burns, M.A. PCR in a Rayleigh-Bénard convection cell. Science 2002, 298, 793. [Google Scholar] [CrossRef]
- Li, Z.; Yang, Z.; Zhang, D.; Zhuang, S.; Yamaguchi, Y. The development of a portable buoyancy-driven PCR system and its evaluation by capillary electrophoresis. Sens. Actuators B-Chem. 2016, 230, 779–784. [Google Scholar] [CrossRef]
- Qiu, X.; Zhang, S.; Xiang, F.; Wu, D.; Guo, M.; Ge, S.; Li, K.; Ye, X.; Xia, N.; Qian, S. Instrument-free point-of-care molecular diagnosis of H1N1 based on microfluidic convective PCR. Sens. Actuators B-Chem. 2017, 243, 738–744. [Google Scholar] [CrossRef]
- Kopp, M.U.; Mello, A.J.; Manz, A. Chemical amplification: Continuous-flow PCR on a chip. Science 1998, 280, 1046–1048. [Google Scholar] [CrossRef] [PubMed]
- van Meer, B.J.; de Vries, H.; Firth, K.S.A.; van Weerd, J.; Tertoolen, L.G.J.; Karperien, H.B.J.; Karperien, P.; Jonkheijm, C.; Denning, A.P.; IJzerman, C.L. Small molecule absorption by PDMS in the context of drug response bioassays. Biochem. Biophys. Res. Commun. 2017, 482, 323–328. [Google Scholar] [CrossRef]
- You, J.B.; Lee, B.; Choi, Y.; Lee, C.S.; Peter, M.; Im, S.G.; Lee, S.S. Nanoadhesive layer to prevent protein absorption in a poly(dimethylsiloxane) microfluidic device. Biotechniques 2020, 69, 404–409. [Google Scholar] [CrossRef]
- Ardila, C.M.; Jiménez-Arbeláez, G.A.; Vivares-Builes, A.M. Potential Clinical Application of Organs-on-a-Chip in Periodontal Diseases: A Systematic Review of In Vitro Studies. Dent. J. 2023, 11, 158. [Google Scholar] [CrossRef]
- Ardila, C.M.; Zuluaga-Gómez, M.; Vivares-Builes, A.M. Applications of Lab on a Chip in Antimicrobial Susceptibility of Staphylococcus aureus: A Systematic Review. Medicina 2023, 59, 1719. [Google Scholar] [CrossRef]
Purpose of the Microchip | Materials Used | Culture, Bacterial Strains, and Growing Conditions | Main Results | Reference |
---|---|---|---|---|
A method for identifying bacterial cells in deionized water solution, utilizing fluidic electrodes and a hydrodynamic focusing technique is provided. | The chip system includes three-dimensional electrodes and an adjustable gap. A syringe pump is used to precisely control the flows. A computer-programmed syringe pump drives the bacterial suspension and KCl solution from their inlets. | The bacterial culture was compressed to create three flowing layers with varying conductivities on a microfluidic device, using a KCl solution for both sheath flow and fluidic electrodes. The impedance spectra of the bacterial suspensions were measured to determine their sensitivities to concentration changes. | For the current design of the microfluidic chip, the lowest bacterial detection concentration is 103 cells mL−1 in deionized water, with quantifiable concentrations ranging from 103 to 109 cells mL−1 for P. gingivalis. The detection sensitivity of this fluidic electrode system can be modified by adjusting the velocity ratio between the sample suspension and the KCl fluid. | [25] |
Using an integrated continuous flow polymerase chain reaction and electrophoresis biochip, a portable all-in-one microfluidic system for rapid pathogen testing has been developed. | The system primarily consists of an innovative pumping unit, two aluminum heaters, and a continuous flow polymerase chain reaction and electrophoresis microfluidic chip. The integrated biochip, made from polycarbonate, was created using plastic injection molding. | Bacterial strains of P. gingivalis (ATCC 33277), T. denticola (ATCC 35405), and T. forsythia (ATCC 43037) were provided by Microbiologics Inc. The polymerase chain reaction solution was pumped into the channel for the reaction at various speeds. Conventional PCR was performed using a T100 thermal cycler. | The results showed that DNA can be amplified in as little as 2′31′′ and PCR products can be detected in as little as 3′43′′, with a minimum quantity of bacteria amplified of 125 cfu per μL. | [26] |
Water was used as a substitute for PCR solution, and finite element analysis was used to evaluate the influence of the cross-section, width-to-depth ratio, and length ratio. | The topographical arrangement of the continuous flow polymerase chain reaction chip includes direct and curved microchannels positioned on two heating blocks. The chip was constructed from polycarbonate. | Bacterial strains of T. denticola (ATCC 35405) were obtained from Microbiologics Inc. The experiment used 10× TBE buffer, SpeedSTAR HS DNA Polymerase, hydroxyethyl cellulose, and 100 bp DNA ladders. | Conserved sections of bacterial 16S ribosomal DNA were successfully amplified in T. denticola within 8 min using the portable continuous-flow polymerase chain reaction chip. | [27] |
A continuous flow polymerase chain reaction microfluidic chip was used. | A silicon wafer was spin-deposited with SU-8 photoresist. It was then prebaked at 65 °C for 5 min before being soft baked at 95 °C for 15 min. A photolithography machine carved a pattern onto the photoresist using a photolithography mask. | Bacterial strains of P. gingivalis (ATCC 33277), T. denticola (ATCC 35405), and T. forsythia (ATCC 43037) were obtained from Microbiologics Inc. The sterile paper tip was then placed in a centrifuge tube containing 100 µL phosphate-buffered saline and centrifuged at 10,000 rpm for 10 min. Finally, 2 µL of supernatant was employed as the PCR sample. | The results showed that P. gingivalis and T. denticola target genes can be amplified in 3′48″; however, T. forsythia (641 bp) required at least 8′25′′. When multi-PCR of these bacteria was done, just P. gingivalis was identified following 11′20′′. As a result, continuous flow polymerase chain reaction has a significant speed advantage. | [28] |
A microfluidic device based on a continuous flow polymerase chain reaction array microfluidic chip was designed and built. | A continuous flow polymerase chain reaction array microfluidic chip, a syringe pump, and two aluminum heating blocks comprised the microfluidic system. The PCR solution was pumped into the microchannels at various speeds via the syringe pump. | The specificity and selectivity of the primers for P. gingivalis, T. denticola, and T. forsythia were determined using a traditional thermal cycler and electrophoresis. (P. gingivalis forward: GCGCTCAACGT TCAGCC; reverse: CACGAATTCCGCCTGC; T. denticola forward: TAATAC CGAATGTGCTCATTTACAT; reverse: TCAAAGAAGCATTCCCTCT TCTTCTTA; T. forsythia forward: GCGTATGTAACCTGCCCGCA; reverse: TGCTTCAGTGTCAGTTATACCT). | The results showed that the shortest amplification time for P. gingivalis, T. denticola, and T. forsythia was 2′07′′, 2′51′′, and 5′32′′, respectively. Moreover, in this microfluidic chip, simultaneous amplification of P. gingivalis, T. denticola, and T. forsythia was achieved in 8′05′′. This research could pave the road for high-throughput DNA amplification, potentially advancing continuous flow polymerase chain reaction technology from the lab to the field. | [29] |
A double-layer droplet continuous flow PCR microfluidic device was presented to reduce fluidic resistance. | The integrated droplet continuous flow PCR micro-fluidic chip sketch included a T-junction for droplet generation, a serpentine microchannel for continuous flow PCR, and an outlet reservoir for PCR product detection. The prepolymer polydime-thylsiloxane and curing agent were mixed 10:1 and placed into the duplicate mold. | P. gingivalis bacterial strains (ATCC 33277) were obtained from Microbiologics Inc. For PCR amplification, SYBR Green PCR Mastermix was utilized. Sangon Biotech synthesized the primers. | The amplification of P. gingivalis was completed in 11′16′′, and the fluorescence signal from the positive droplets was obtained. A microfluidic chip of this type can effectively reduce the high resistance caused by long meandering microchannels and significantly reduce the time required for droplets’ continuous flow PCR. | [30] |
An integrated microchip was developed that combines continuous flow PCR with microfluidic chip electrophoresis. | The polydimethylsiloxane prepolymer and curing agent were combined in an equal 10:1 ratio before the polydimethylsiloxane was molded onto the replica mold. The continuous-flow PCR microfluidic chip electrophoresis was made up of two polydimethylsiloxane components. | In the continuous-flow PCR microfluidic chip electrophoresis technique, P. gingivalis (TGTAGATGACTGATGGTGAAAACC), T. denticola (AAGGCGGTAGAGCCGCTCA), and T. forsythia (GCGTATGTAACCTGCCCGCA) were detected. An injector containing the PCR solution was attached to the entrance of the chip’s PCR portion. | The amplification of target genes for P. gingivalis, T. forsythia, and T. denticola was completed in 11 min, and the correct PCR products were recognized in the microfluidic chip. | [31] |
The creation of a functioning microfluidic device based on a multiplex circular array-shaped continuous-flow PCR microfluidic chip was discussed. | Soft lithography and plasma oxidation bonding were used to create the microchannels. The layout of the microchannels was initially printed as a mask onto a transparent film. A 10.1 cm silicon wafer was spin-coated with a thick negative photoresist and separately baked at 95 °C for 25 min. | P. gingivalis (ATCC 33277), T. denticola (ATCC 35405), and T. forsythia (ATCC 43037) bacterial strains were received from Microbiologics. Sangon Biotech produced and delivered all the primers. | A system of this type may amplify 12 samples at the same time and detect PCR results on-site using fluorescence intensity. In the microfluidic chip, the volume of PCR reagent required was as low as 5 μL. The PCR reagent took 5.38 min to pass through the serpentine microchannel. | [32] |
A disk-shaped microfluidic platform that is chair-side compatible was demonstrated. | The disk-shaped microfluidic platform was created by microthermoforming polycarbonate polymer foils on a chip foundry service at the Hahn-Schickard lab using a hot embossing machine. A polydimethylsiloxane elastomeric mold was heated. The covering polymer foil was also heated, and the air was blasted into it at a particular temperature above the foil’s glass transition, causing it to take on the shape of the mold. | The disk-shaped microfluidic platform contained P. gingivalis, T. forsythia, and T. denticola. The GenEluteTM Bacterial Genomic DNA Kit was used to perform enzymatic lysis on 920 μL of entire saliva, followed by silica column-based extraction. A multiplex real-time qPCR test was used to assess bacterial cell counts using 16S rRNA. | The ability of the disk-shaped microfluidic device to identify P. gingivalis, T. forsythia, and T. denticola in < 3 h was established. When the disk-shaped microfluidic platform was compared to a lab-based reference approach, there was a ~90% agreement between targets recognized as positive and negative. | [33] |
It was created in vitro antibodies to P. gingivalis for real-time detection of microorganisms in clinical samples. The antibodies were immobilized on a CM-5 sensor chip of a biosensor to detect the presence of P. gingivalis. | Anti-P. gingivalis antibodies were mounted on a Biacore® 1000 CM 5 sensor chip to study antigen-antibody interactions utilizing the amine coupling approach. | The cells were grown in L-15 media supplemented with 10% fetal bovine serum and incubated at 37 °C overnight. P. gingivalis ATCC 33277 was cultivated in a chamber under anaerobic conditions at 37 °C in fastidious anaerobe broth. The lymphocytes were stimulated with heat-killed P. gingivalis ATCC 33277 at 109 cfu/mL and incubated at 37 °C. | In surface plasmon resonance, incubation with anti-P. gingivalis reduced the bacterial response. The in vitro antibody generation approach established in this study could be employed for effective real-time diagnosis of periodontitis, and the attenuating effects of in vitro antibodies imply a role in passive immunization to prevent periodontitis and its associated risk factors. | [34] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ardila, C.M.; Jiménez-Arbeláez, G.A.; Vivares-Builes, A.M. A Systematic Review of In Vitro Studies Using Microchip Platforms for Identifying Periodontopathogens from the Red Complex. Dent. J. 2023, 11, 245. https://doi.org/10.3390/dj11110245
Ardila CM, Jiménez-Arbeláez GA, Vivares-Builes AM. A Systematic Review of In Vitro Studies Using Microchip Platforms for Identifying Periodontopathogens from the Red Complex. Dentistry Journal. 2023; 11(11):245. https://doi.org/10.3390/dj11110245
Chicago/Turabian StyleArdila, Carlos M., Gustavo A. Jiménez-Arbeláez, and Annie Marcela Vivares-Builes. 2023. "A Systematic Review of In Vitro Studies Using Microchip Platforms for Identifying Periodontopathogens from the Red Complex" Dentistry Journal 11, no. 11: 245. https://doi.org/10.3390/dj11110245
APA StyleArdila, C. M., Jiménez-Arbeláez, G. A., & Vivares-Builes, A. M. (2023). A Systematic Review of In Vitro Studies Using Microchip Platforms for Identifying Periodontopathogens from the Red Complex. Dentistry Journal, 11(11), 245. https://doi.org/10.3390/dj11110245