Next Article in Journal
Displacement Efficiency Under Pulsatile Injection: The Roles of Frequency, Amplitude, and Porosity
Previous Article in Journal
Graphene-Stabilized δ-MnO2 Cathode for High-Capacity Aqueous Aluminum-Ion Batteries
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Strains Enterococcus faecalis as Contaminants of Raw Goat Milk and Their Treatment with Postbiotic Active Substances Produced by Autochthonous Lactococci

1
Centre of Biosciences of the Slovak Academy of Sciences, Institute of Animal Physiology, Šoltésovej 4-6, 040 01 Košice, Slovakia
2
Department of Microbiology and Immunology, University of Veterinary Medicine and Pharmacy in Košice, Komenského 73, 041 81 Košice, Slovakia
*
Author to whom correspondence should be addressed.
Processes 2025, 13(11), 3552; https://doi.org/10.3390/pr13113552
Submission received: 2 September 2025 / Revised: 27 October 2025 / Accepted: 29 October 2025 / Published: 4 November 2025
(This article belongs to the Section Food Process Engineering)

Abstract

Enterococci from raw goat milk were taxonomically allotted in the species Enterococcus faecalis using sequencing (16S rRNA and BLASTn analysis) with a percentage identity up to 99.91%. The virulence factor gene gelE was found in the strains EE/K3, EE/G3, and EE/G6. The agg gene was detected in the strain EE/G6, and the esp gene was detected in the strains EE/K5 and EE/G7. Each strain possessed at least one virulence factor gene. In the strain EE/G6, the gelE and esp genes were found. The strains EE/G6 and EE/G3 showed resistance to tetracycline and vancomycin. EE/G7 was resistant to vancomycin and gentamicin. All strains possessed low-grade biofilm-forming ability (0.1 < A570 ≤ 1.0). They possessed genes for biofilm formation (bopD, srt, and/or ace). They also produced esterase (20–40 nmo/L), esterase lipase, and α-chymotrypsin (10–40 nmoL). The values of acid phosphatase reached 20–40 nmoL. The strains EE/G3, EE/G6, and EE/G7 were observed to possess the most pathogenicity. However, all strains were susceptible to postbiotic active substances produced by two autochthonous lactococci, MK2/8 and MK1/3 (inhibitory activity up to 400 AU/mL). These postbiotic substances provide a new potential alternative to reducing contaminants in milk.

1. Introduction

Milk (including goat milk) represents an important nutritional source in the human diet [1]. It also plays a prominent role in physical and cognitive development [2,3]. Regarding goat milk, its specificity lies in its more abundant immunoglobulin content than human milk. As is well known, it is also higher in calcium compared with cow milk; it contains more trace elements than cow milk and a high content of some fatty acids as well [4,5]. Because milk is a highly nutritious product, it facilitates the growth and multiplication of a wide range of microbiota [6]. Among these can also appear various enterococcal species, including Enterococcus faecalis [7,8]. One of the reasons for their prevalence is their robust nature, since the majority of these species can grow at temperatures from 10° to 45 °C, in 6.5% NaCl, and in pH ranges from 4.0 to 9.6, and/or they can survive heat at 60 °C for 30 min [9]. Even the horizontal transfer of resistance genes from E. faecalis to methicillin-resistant Staphylococcus aureus has been reported previously [10]. Enterococci have often been associated with intrinsic or acquired antibiotic genes located on chromosomes, plasmids, transposons, and other virulence factor genes as well [11,12]. E. faecalis is a prevalent species among the dairy microbial community [13]. However, some authors have declared that enterococci contribute to the ripening of traditional fermented dairy products [14]. On the other hand, some authors have described virulence factor genes as possessing enterococci even in pasteurized milk [14]. They are also recognized for their ability to exchange genetic information through mobile elements and to spread antibiotic resistance among other bacteria [15].
However, the safety of food impacts consumers. Therefore, to prevent and/or reduce the effect of contaminants, especially those which possess virulence factor genes, including those harboring biofilm-forming or antibiotic resistance genes, novel challenges and tools are being experimented with. Among those which have seemed effective are allotted bacteriocins and/or postbiotic substances. Bacteriocins are antimicrobial-acting proteinaceous substances, which are more often purified to homogeneity with inhibitory effects against more or less relative bacteria. But those antimicrobial effective proteinaceous substances that are non-purified into homogeneity but confer host health benefits are now allotted into the group of postbiotics [16,17,18]. Even those substances (metabolites and secreted proteins) that are extracellularly released may be termed exopostbiotics [17]. Lauková et al. [19,20] reported raw goat-milk-derived strains, such as Lactococcus lactis MK1/3 (CCM 9209), as producing a postbiotic active substance with in vitro inhibitory activity against cheese and milk contaminant enterococci (inhibitory activity up to 3 200 AU/mL). Moreover, the strains Lactococcus lactis MK2/8 (AN PQ158272), MK2/7 (AN PQ158271), and MK2/2 (PQ158270) produced postbiotic active substances that inhibited 97.8% of indicator strains, including enterococci and staphylococci, reaching inhibitory activity in the range from 200 up to 800 AU/mL. Postbiotic substances are not only produced by probiotic bacteria [17]. Formerly mentioned, lactococci, as producers of postbiotic substances, show beneficial characteristics [19,20].
Therefore, the aim of this study was to detect the potential pathogenic risk of strains of the species Enterococcus faecalis isolated from raw goat milk and to show the inhibitory effect of postbiotic substances produced by autochthonous lactococci against these milk contaminants. The novelty of this study especially highlights the treatment effect of postbiotic substances secreted by autochthonous lactococci, from which E. faecalis contaminants were isolated from the same source, raw goat milk.

2. Materials and Methods

2.1. Enterococcus faecalis Strain Isolation and Identification

The strains were selected from the dilutions of 53 raw goat milk samples. They were supplied by breeders from farms located in the central Slovakia region. One milliliter from each milk sample was collected and then treated. There were standard hygienic conditions on the farms. Altogether, 132 goats were sampled throughout the year 2021. The standard microbiological dilution method was used to treat samples according to the ISO (International Organization for Standardization) as previously described by Lauková et al. [19]. The samples were diluted in Ringer solution (pH 7, Merck, Darmstadt, Germany, 1:9). Individual dilutions were plated on M-Enterococcus agar (Difco, Sparks, MD, USA). The pure selected colonies were stored for further testing by use of the Microbank system (Pro-Lab Diagnostics, Richmond Hill, ON, Canada).
The DNA extraction, PCR amplification, and sequencing were reported in detail in our previous study [19,20]. The isolation of DNA from enterococcal isolates was performed by DNAzol direct (Molecular Research Centre Inc. Cincinnati, OH, USA) according to the manufacturer’s instruction. The 16S ribosomal RNA (rRNA) genes from enterococci were amplified by a PCR cycler (TProfesional Basic, Biometra GmbH, Goettingen, Germany) using the universal primers [21,22] Bac27F (5-AGAGTTTGATCTTGGCTCAG-3) and 1492R (5-CGGTTACCTTACGACTT-3). The PCR reaction was carried out in a total master mix (One Taq 2X) with the standard buffer (New England Biolabs, Foster City, CA, USA). The PCR mixture was subjected to an initial denaturation cycle of 5 min at 94 °C followed by 30 cycles of denaturation at 94 °C for one min, annealing at 55 °C, and extension at 72 °C for 3 min followed by the final extension step at 72 °C for 10 min. The amplified PCR product was separated on 3% agarose gel electrophoresis in TRIS-acetate-EDTA buffer (pH 7.8) and visualized with GelRed (Biotium Inc. Hayword, CA, USA) under ultraviolet light. The PCR products were sent for Sanger sequencing (Microsynth, Austria GmbH, Wienna, Austria). All sequencing results (chromatogram) were analyzed using Geneious 8.0.5. (Biomatters, Auckland, New Zealand) and compared to the National Centre of Biotechnology Information GenBank database using the BLASTn program (http://www.ncbi.nlm.nih.gov/BLAST, accessed on 31 April 2022) for identification.

2.2. Hemolysis and Enzyme Analysis Using API ZYM Test

A hemolysis test was performed as reported by Semedo-Lemsaddek et al. [23]. Brain heart agar enriched with 5% defibrinated sheep blood (BHA, Difco, Sparks, MD, USA) was used for this test, performed in duplicate. Enterococci were inoculated on the BHA and cultivated at 37 °C overnight. The presence/absence of a cleared zone around the colonies that grew was assessed as α-, β-hemolysis and/or no hemolysis (ɤ-hemolysis), also including a positive control strain according to Semedo-Lemsaddek et al. [23]. The API ZYM panel (BioMerieux, Marcy L’ Etoile, France) was used to test enzyme production by selected strains to assess their character, as previously reported [19]. The panel includes the following enzymes: alkaline phosphatase, esterase (C4), esterase lipase (C8), lipase (C14), leucine arylamidase, valine arylamidase, cystine arylamidase, trypsin, α-chymotrypsin, acid phosphatase, Naphtol-AS-BI-phosphohydrolase, α-galactosidase, β-galactosidase, β-glucuronidase, α-glucosidase, β-glucosidase, N-acetyl-β-glucosaminidase, α-mannosidase, and α-fucosidase. The color intensity was assessed from 0 to 5. It corresponds with relevant values in nanomoles (5–40 nmoL). The test was performed in duplicate including the reference strain E. faecalis.

2.3. Virulence Factor Gene Analysis

The genes gelE (gelatinase), agg (aggregation substance), esp (enterococcal surface protein), hyl (hyaluronidase), cylA (cytolysin A), and IS16 (IS16 element) were tested. The procedure followed the previous description by Kubašová et al. [24] (Table 1). The PCR was carried out in a 25 µL volume with a mixture described previously by Focková et al. [25] under the following conditions (gelE, agg, cylA, and esp): denaturation at 95 °C for 3 min, 35 cycles for 30 s at 95 °C, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s and finally at 72° C for 5 min. The PCR conditions for the hyl and IS16 genes included denaturation at 94 °C for 4 min followed by 30 cycles at 94 °C for 30 s and at 50 °C for 30 s, then 30 s at 72 °C and extension at 72 °C for 4 min. The PCR products were separated using agarose electrophoresis (1.2%, v/w, Sigma Aldrich, Saint Louis, MO, USA) with a 1 µg/mL content of ethidium bromide (Sigma-Aldrich) using 0.5× TAE buffer (Merck, Darmstadt, Germany). The PCR fragments were visualized with ultraviolet light. Our strain E. faecalis 9Tr1 and E. faecium P36 (University in Lisbon, Faculty of Veterinary Medicine, Portugal) were positive controls.

2.4. Biofilm-Forming Ability and Biofilm Gene Testing

Two methods were applied for biofilm-forming ability testing: a quantitative plate assay [26] previously described by Lauková et al. [19,20] and the detection of genes responsible for biofilm formation using the appropriate primers and PCR. Following the quantitative method, a pure colony of the tested strain (grown on BH agar, Difco, overnight at 37 °C) was inoculated into 5 mL of Ringer solution (pH 7.0, 0.75% w/v) to have the suspension, which corresponded to 1 × 108 cfu/mL. Then, 100 µL from the dilution was transferred into microtiter plate wells (Greiner Elisa 12 well strips, Frickenhausen GmbH, Frickenhausen, Germany). The next step was cultivation of the plate for 24 h at 37 °C. After that time, the biofilm formed in the plate well was washed twice with 200 µL of deionized water. The plate was dried at laboratory temperature for 40 min. This was followed by staining of the attached bacteria, performed with 200 µL of 0.1% crystal violet in deionized water at 25 °C for 30 min. After the dye solution aspirated away, the wells were washed twice with 200 µL of deionized water. Then, the water was removed, and the plate was dried for 30 min at laboratory temperature. The dye bound to the adhered biofilm was eluted using 200 µL of 95% ethanol. This was followed by the transfer of 150 µL from each well into a new microtiter plate to measure absorbance (A570) using the absorbance reader Apollo 11 LB 913 (Apollo, Berthold Technologies, Oak Ridge, TN, USA). Two independent runs with 12 replicates were prepared for measurement, including a negative control (BHI broth). The positive control was the biofilm-forming strain Streptococcus equi subsp. zooepidemicus CCM 7316 (kindly provided by Dr. Eva Styková from the University of Veterinary Medicine and Pharmacy in Košice, Slovakia). The following classification was used to evaluate the biofilm-forming ability of the E. faecalis strains [26]: highly positive A570 ≥ 1.0; low-grade positive, 0.1 < A570 ≤ 1.0, and negative, A570 ≤ 0.1.
Several enterococcal virulence proteins have been studied that play an important role in biofilm-forming ability (ace, bopD, srtA, ica, Bap, and fsrA). Ace is a surface protein that is important in the initial adhesion of biofilm-forming bacteria [27]. The transcriptional regulator BopD is a protein that has a function in in vitro biofilm formation [28]. SrtA is an enzyme that is functional in surface protein processing in biofilm formation [29,30]. Fsr possesses a function in quorum sensing and may regulate many biofilm-related genes [30]. Ica and Bap are surface proteins participating in the cellular adhesion step in biofilm formation [31]. The primers used are included in Table 1. To detect the ica gene, the following mixture and cycles were used [28]: an initial denaturation cycle of 2 min at 94 °C, followed by denaturation at 94 °C for 20 s, annealing at 42 °C, 30 cycles for 20 s, extension at 72 °C for 50 s, and the final extension at 72 °C for 5 min. For the bap gene, it was an initial denaturation at 94 °C for 5 min, then 30 s at 94 °C, annealing at 55 °C, 30 cycles for 30 s, extension at 72 °C for 45 s, and the final extension at 72 °C for 7 min. To detect other genes, the PCR conditions followed those described by Hashem et al. [32]. The amplified PCR product was separated on 1.2% agarose gel electrophoresis (Sigma-Aldrich) with a 1.0 µg/mL content of ethidium bromide in 0.5× TAE buffer (Merck) and visualized under ultraviolet light. The positive control strains were those included in the references.

2.5. Relation of Enterococcus faecalis Strains to Antibiotics

Two assays were applied for antibiotic resistance phenotype testing. The agar disk diffusion method uses antibiotic resistance disks according to EUCAST, as reported by Focková et al. [25]. The following antibiotic disks were used: ampicillin (10 µg), penicillin (10 IU), erythromycin (15 µg), tetracycline (30 µg), vancomycin (30 µg), rifampicin (30 µg), chloramphenicol (30 µg), kanamycin (30 µg), streptomycin (30 µg), and gentamicin (120 µg). The overnight culture of the tested strains was spread (100 µL) on the surface of BHA plates with blood. Antibiotic disks were applied on the plate surface. The plates were incubated at 37 °C overnight. The zones around the disks were measured; this was tested in duplicate. Two zone sizes are included in millimeters.
Regarding the EUCAST (to assess the MIC, minimal inhibitory concentration), the E strip method was used, as previously described by Lauková et al. [20] and Focková et al. [25]. Instead of disks, E-strips were used as follows: ampicillin, erythromycin, tetracycline, vancomycin, kanamycin, and rifampicin (256-0.016 µg/mL); gentamicin (1024-0.064 µg/mL); and streptomycin (256-0.064 µg/mL, Oxoid, the United Kingdom). In both cases, the positive control was the strain E. faecalis ATCC 29212.

2.6. Treatment of Enterococcus faecalis Strains with Postbiotic Active Substances MK1/3 and MK2/8

The strains Lactococcus lactis MK2/8 and MK1/3 were both isolated from raw goat milk (Access Number in GenBank for MK2/8 is PQ158272 and for MK1/3 is ON114093) [19,20]. The concentrated (10-fold) postbiotic substance (CPS) was prepared from the supernatant as previously described in [20]. The inhibitory activity measured against the principal indicator Enterococcus avium EA5 was 800 AU/mL. The CPS from the strain MK1/3 was prepared as reported by Lauková et al. [19]. Inhibitory activity against Enterococcus avium EA5 (the principal indicator strain) reached 1600 AU/mL. The strain MK1/3 is included in patent no. 289266 by the Industrial Property Office of the Slovak Republic. The inhibitory activity of both postbiotic substances was analyzed by the agar spot test [33] and expressed in arbitrary unit per mL (AU/mL). It corresponds to the highest dilution of the CPS (ratio 1:1 in phosphate buffer, pH6.5), which inhibited the growth of the indicator strain. The CPS was stored at −20 °C.

3. Results

3.1. Species Strain Characterization

Among the isolated enterococci, strains of Enterococcus faecalis (5) species were identified (EE/K3, EE/K5, EE/G3, EE/G6, and EE/G7). They were identified as a result of sequencing (BLASTn 16S rRNA). A sequence identity percentage from 98.45% up to 99.91% (Table 2) was achieved compared with the strain E. faecalis ATCC19433 in GenBank. The strain EE/K3 reached a sequence similarity up to 98.45% (NR_115765) with the strain E. faecalis ATCC19433. The sequence similarity for the strain EE/K5 was identical (98.56%) (NR_ 115765.1) as the strain E. faecalis ATCC19433. The other strains also showed their sequence similarity/identity with the same strain, E. faecalis ATCC19433, in GenBank. A sequence similarity (NR_115765.1) of 98.65% was also allotted to the strain EE/G3 with the species E. faecalis. The highest sequence similarity (NR_115765.1) was noted for the strains EE/G6 (99.91%) and EE/G7 (99.50%).

3.2. Hemolysis and Enzyme Analysis Using the API ZYM Test and Virulence Factor Gene Analysis

The strains EE/K3 and EE/K5 showed α-hemolysis on blood agar. The other strains, E. faecalis EE/G3, EE/G6, and EE/G7, did not produce hemolysis (ɤ-hemolysis). Regarding the enzyme profile, the tested strains of E. faecalis did not produce α-mannosidase, α-fucosidase, N-acetyl-β-glucosaminidase, β-glucuronidase, or lipase. However, they produced high levels of esterase (C40; Table 3; from 20 nmoL to 40 nmoL). Levels of 20–30 nmoL were also measured for the enzyme esterase lipase. The strains showed a high value of α-chymotrypsin production (10–40 nmoL). The values of acid phosphatase were also high (20–40 nmoL). In the case of Naphtol-AS-BI-phosphohydrolase, a production of 5–10 nmoL was detected by the strains. The other enzymes were measured in low values (5–10 nmoL).
The genes for six virulence factors (hyl, IS16, cylA, gelE, agg, and esp) were evaluated. The E. faecalis were absent of the hyl, IS16, and cyl genes. The GelE gene was detected in three strains (EE/K3, EE/G3, and EE/G6, Table 4). The agg gene was detected only in the strain EE/G6, and the esp gene was detected in the strains EE/K5 and EE/G7. It can be summarized that each tested strain possessed one virulence factor gene. The agg gene possessed the strain EE/G6, and the esp gene was found in two strains, EE/K5 and EE/G7. Two genes were found only in the strain EE/G6.

3.3. Biofilm-Forming Assay and Biofilm Gene Detection

Regarding the plate assay for biofilm-forming ability testing, all strains were measured with low-grade biofilm formation (0.1 < A570 ≤ 1.0, Table 5). The strain EE/G3 reached the highest value in biofilm formation (0.246 ± 0.171), followed by the strain EE/G6 (0.242 ± 0.166). The strains EE/K5 and EE/K3 were found to have similar values. Surprisingly, the strain with the most pathogenic character, EE/G7, showed the lowest value of biofilm formation (0.137 ± 0.062, Table 5).
Six genes coding biofilm-forming ability were tested (ace, fsrA, bopD, srtA, ica, and bap). However, E. faecalis were absent of the ica, bap, and fsr genes. All strains had the bopD gene (Table 5). The gene srtA was detected in the strain EE/G6 only, and the ace gene was only detected in the strains EE/K5 and EE/G7 (Table 5). This means that the tested strains had at most two biofilm-forming genes, bopD and srtA (EE/G6) or ace and bopD (EE/K5 and EE/G7).

3.4. Relation of Enterococcus faecalis Strains to Antibiotics and Susceptibility to Postbiotic Substances Produced by the Strains Lactococcus lactis MK2/8 and MK1/3

All E. faecalis strains were kanamycin- and streptomycin-resistant (Table 6). They were susceptible to ampicillin, with a susceptibility zone of 15–23 mm. The zones for penicillin reached 16–20 mm and for erythromycin 15–26 mm. In the case of rifampicin, the zones measured 20–27 mm, and for chloramphenicol the susceptibility zones reached 12–21 mm. The strains EE/G3 and EE/G6 were resistant to tetracycline (R < 10). The strain EE/G7 was also resistant to gentamicin (Table 6). Three strains were resistant to three antibiotics (Table 6).
Using the E-strip method, the strains were susceptible to antibiotics (Table 7) with different minimal inhibitory concentrations (MICs). The resistance was determined in the case of streptomycin (Table 7). For ampicillin, the MIC ranged from 0.25 to 0.50 µg. For erythromycin, the MIC reached from 1.00 up to 2 µg (Table 7). The MIC for tetracycline was in the range of 0.30 µg to 0.48 µg. For vancomycin, various MICs were achieved: 0.50 µg (EE/K5) to 6.00 µg (EE/G6). Differences were noted in the MIC for chloramphenicol at 12.0 µg–32.0 µg and for gentamicin as well (16,0 µg up to 32.0 µg).
However, the strains were susceptible to treatment with the postbiotic active substances MK2/8 (inhibitory effect from 100 to 400 AU/mL) and MK1/3 (from 100 to 400 AU/mL) as well. This susceptibility was well balanced (Table 8).

4. Discussion

4.1. Virulence Factor Genes

The species Enterococcus faecalis is a natural member of the intestinal microbiota of animals and humans, and it has also frequently been detected in various milks [5,7]. Especially, clinical strains of this species could threaten host health or cause problems during product processing. This impact has been focused on the presence of virulence factors in strains of this species. Moreover, the detection of virulence factor genes (which are responsible for their pathogenic phenotype) is of paramount interest. Regarding the biofilm formation, the presence of the following genes was tested in the strains E. faecalis: ace, bopD, fsr, srtA, bap, and ica. Among those tested genes, the genes bopD, srtA, and ace were detected. Ica and Bap are surface proteins participating in the cellular adhesion step in biofilm formation [31]. As previously mentioned [30], the fsr gene was allotted in the category regulatory system functioning in quorum sensing. The ace gene has a function in initial adhesion in the biofilm-forming process [27]. López-Salas et al. [34] reported a significant correlation between the ace gene presence and tetracycline resistance, as also confirmed in our study in the strain EE/G6. Moreover, correlation between the agg gene with biofilm formation was found and also confirmed in the strain EE/G6, which showed low-grade biofilm formation. Ghaziasgar et al. [35] found that ace-positive isolates were significantly more potent for biofilm formation, and all ace-gene-containing enterococci had high biofilm development [36]. As formerly mentioned, the BopD protein has a function in vitro as the transcriptional regulator in biofilm formation [28]. The enzyme srtA functions in surface protein processing during biofilm formation [28]. Esp is surface protein—a specific adhesin that binds to collagen, which most frequently associated with the strains of the species E. faecalis [36], as also shown in our study. The contribution of aggregation substance (agg) in adhesion has been shown in many studies. Factor determinants like agg, esp, and ace impact biofilm formation on cultured human cells [36].

4.2. Antibiotic Resistance and Enzymes

Virulence factors have also shown antibiotic resistance. Some strains have been found to vancomycin-resistant, although this has not been detected Van genes. Vancomycin disturbs the development of the cell wall in growing bacteria, and resistance is based on changed targets for antibiotic–drug interactions [37].
Bacterial enzymes play their own role in the pathogenic characteristic of bacteria. Bacterial alkaline phosphatase (ALP) is phosphatase with the physiological role of dephosphorylating compounds. In humans, this is the enzyme associated with liver diseases or bone disorders. In the detected E. faecalis, the values of ALP were low (up to 10 nmoL). On the other side, ALP is commonly used in the dairy industry as an indicator of successful pasteurization. Acid phosphatase represents enzymes that are found in organisms ranging from bacteria to mammals, and they may play an integral role in microbial virulence or can be used for bacterial taxonomy and identification [38,39]. Microbial β-glucuronidase can play role in the development of different diseases, e.g., those related to estrogen metabolism [40]. A high value of chymotrypsin (20–40 nmoL) and/or acetyl-β-glucosaminidases may be related to the pathogenic tendency of the tested E. faecalis strains. However, N-acetyl-β-glucosaminidase was not produced by the E. faecalis strains. Also, β-glucuronidase was absent in the studied E. faecalis strains, which is an enzyme related to colon cancer.

4.3. Postbiotic Substances Against Contaminant Bacteria

There is extensive evidence regarding the use of postbiotic substances against contaminants. One important factor driving the interest in postbiotics is their inherent stability, both during industrial processes and storage [18,41]. Moreover, postbiotics could reasonably be expected to have a better safety profile than, e.g., probiotics. This is because the microbiota they produce are inanimate, and they have lost the capacity to replicate. This means they are without the same risks [18,41]. They have become very prominent in both nutrition and health sciences, as they are believed to confer various health benefits to consumers without the attendant concerns arising from the ingestion of, e.g., living forms of probiotics [18,41]. Postbiotics also can minimize the potential risk of antibiotic resistance, which is, however, still being discussed. They are also usually more stable during processing and/or storage [18,41].
Maintaining the safety of goat milk is important because it is a key functional food. This means it is a food with components partially or fully affecting consumer health [42]. The components in dairy that may purport and/or indicate milk as a functional food include above all calcium, vitamin D, probiotic and postbiotic active lactic acid bacteria, conjugated derivates of linoleic acid, and other bioactive peptides derived from milk proteins [42]. Venega-Ortega et al. [43] describe bioactive peptides from lactic acid bacteria as a sustainable approach for healthier foods. Pure bacteriocins from lactococci have been studied for decades; however, new methods to achieve pure and/or non-purified substances have been developed. Nisin (now called lantibiotic bacteriocin) was first described as a bacteriocin produced by some strains of the species Lactococcus lactis [44]. Then, lacticin 3147, produced by Lactococcus lactis subsp. lactis DPC3147 [45] isolated from Irish grain kefir used for making buttermilk, was described as a two-component bacteriocin with a hydrophobic nature. Its activity is acid-dependent. It is mostly used for anti-listeria purposes in yogurts or cheeses. Postbiotic substances secreted by raw-goat-milk-derived lactococci (MK1/3, MK2/8) have been mostly found to have an inhibitory effect against Gram-positive bacteria. These postbiotic-substance-producing strains are applied in yogurts [19,20]. This evidence indicates the need for further study of postbiotic active substances, especially from autochthonous lactococci, to understand their further use for the sustainable quality and safety of dairy products. The postbiotic substance Durancin ED26E/7 inhibited the growth of E. faecium and E. hirae from raw goat milk [5]. In addition, Luenglusontigit et al. [46] described a postbiotic preparation produced by E. faecalis PK1201 with an inhibitory effect against Clostridioides difficile.

5. Conclusions

Biofilm-forming strains of E. faecalis (from raw goat milk) with the presence of the ace, bopD, and/or srt genes encoding biofilm formation, with two strains possessing gelE, esp, and agg virulence factor genes, were susceptible to postbiotic active substances produced by the autochthonous strains Lactococcus lactis MK2/8 and MK1/3. Treatment of E. faecalis with postbiotic substances indicates an alternative eliminating strategy to fighting raw goat milk contaminants.

Author Contributions

Conceptualization, A.L.; methodology, A.L., E.B., M.M. and N.Z.; validation, A.L.; investigation, A.L.; formal analysis, M.P.S.; data curation, A.L., M.M., E.B. and N.Z.; writing—original draft preparation, A.L.; writing—review and editing, A.L.; project administration, A.L.; funding acquisition, A.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Slovak Research and Development Agency under the project contracts APVV-20-0204, APVV-17-0028, and SK-PT-18-0005.

Institutional Review Board Statement

Enterococci (from raw goat milk) were used in this study. Raw goat milk samples selected from farms located in central Slovakia region were kindly provided by the Dairy Research Institute, Žilina, Slovakia, and bacterial isolates for studying as well.

Data Availability Statement

The original contributions in this study are included in the article. Further inquiries can be directed to the corresponding author.

Acknowledgments

This research was supported by the projects APVV-20-0204, APVV-17-0028, and SK-PT-18-0005. The authors have reviewed and edited the output and take full responsibility for the content of this publication. We would like to thank Maria Joao Fraqueza for supervising Eva Bino during her stay at the University in Lisbon analyzing biofilm-forming genes (ica and bap). We are also grateful to the team from the Dairy Research Institute in Žilina and Maroš Drončovský, Martin Tomáška, and Miroslav Kološta for the first detection of milk isolates.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Kourkouta, L.; Frantzana, A.; Koukorikos, K.; Illiadis, C.; Papathanasiou, V.I.; Tsaloglidou, A. Milk nutritional composition and its role in human health. J. Pharm. Pharmacol. 2021, 9, 10–15. [Google Scholar] [CrossRef] [Scilit]
  2. Adzitey, F.; Awini Tibile, B.; Addy, F.; Adu-Bonsu, G.; Senaru Atsu Amalogh, A.; Noyoro, E.J.; Tsigbey, V.E. Occurrence, antimicrobial susceptibility and genomic characterization of Salmonella Enterica isolated from milk and related sources. Cogent Food Agric. 2025, 11, 2486330. [Google Scholar] [CrossRef] [Scilit]
  3. Pereira, P.C. Milk nutritional composition and its role in human health. Nutrition 2014, 30, 619–627. [Google Scholar] [CrossRef] [Scilit]
  4. Uhrín, V.; Lauková, A.; Jančová, A.; Plintovič, V. Mlieko a mliečna žľaza (in Slovak) Milk and Mammary Gland; Publ. No. 92; Faculty of Natural Sciences of the University Constantinus Philosophus: Nitra, Slovakia, 2002; pp. 5–167. ISBN 80-8050-511-X. [Google Scholar]
  5. Lauková, A.; Focková, V.; Pogány Simonová, M. Enterococcal species associated with Slovak raw goat milk, their safety and susceptibility to lantibiotics and durancin ED26E/7. Processes 2021, 9, 681. [Google Scholar] [CrossRef] [Scilit]
  6. Worku, T.; Negera, E.; Nurfeta, A.; Walearegay, H. Microbiological quality and safety of raw milk collected from Borana pastoral community, Oromio regional state. Afr. J. Food Sci. Technol. 2012, 3, 213–222. [Google Scholar]
  7. Hanzelová, Z.; Dudríková, E.; Lovayová, V.; Výrostková, J.; Regecová, I.; Zigo, F.; Bartáková, K. Occurrence of enterococci in the process of artinasal cheesemaking and their antimicrobial resistance. Life 2024, 14, 890. [Google Scholar] [CrossRef] [Scilit]
  8. Bondi, M.; Lauková, A.; de Niederhausern, S.; Messi, P.; Papadopoulou, C.; Economou, V. Controversial aspects displayed by enterococci: Probiotics or pathogens? Biomed. Res. Int. 2020, 20, e9816185. [Google Scholar] [CrossRef] [Scilit]
  9. Švec, P.; Franz, C.M.A.P. The genus Enterococcus. In Lactic Acid Bacteria: Biodiversity and Taxonomy; Holzapfel, W.H., Wood, B.J.B., Eds.; Wiley Blackwell: Hoboken, NJ, USA, 2014; pp. 171–213. [Google Scholar]
  10. Alonso, V.P.P.; Quieroz, M.M.; Gualberto, M.L.; Nascimento, M.S. Klebsiella pneumonia carbapenemase (KPC), methicillin-resistant Staphylococcus aureus (MRSA), and vancomycin-resistant Enterococcus spp. (VRE) in the food production chain and biofilm formation on abiotic surfaces. Curr. Opin. Food Sci. 2019, 26, 79–86. [Google Scholar] [CrossRef] [Scilit]
  11. Zaheer, R.; Cook, S.R.; Barbieri, R.; Goji, N.; Cameron, A.; Petkau, A.; Polo, R.O.; Tymensen, L.; Stamm, C.; Song, J.; et al. Surveillance of Enterococcus spp. reveals distinct species and antimicrobial resistance diversity across a One-health continuu. Sci. Rep. 2020, 10, 3937. [Google Scholar]
  12. Popovic, N.; Dinic, M.; Tolinacki, M.; Mihajlovic, S.; Terzic-Vidojevic, A.; Bojic, S.; Djokic, J.; Golic, N.; Veljovic, K. New insight into biofilm formation ability, the presence of virulence genes and probiotic potential of Enterococcus spp. dairy isolates. Front. Microbiol. 2018, 9, 78. [Google Scholar] [CrossRef] [Scilit]
  13. Silvetti, T.; Morandi, S.; Brasca, M. Does Enterococcus faecalis from traditional raw milk cheeses serve as a reservoir of antibiotic resistance and pathogenic traits? Foodbor. Pathog. Dis. 2019, 16, 359–367. [Google Scholar] [CrossRef] [Scilit]
  14. Nasiri, M.; Hhanifian, S. Enterococcus faecalis and Enterococcus faecium in pasteurized milk: Prevalence, genotyping, and characterization of virulence traits. LWT-Food Sci. Technol. 2022, 153, 112452. [Google Scholar] [CrossRef] [Scilit]
  15. Haubert, L.; da Cunha, C.E.P.; Lopes, G.V.; da Silva, W.P. Food isolate Listeria monocytogenes harboring tet M gene plasmid mediated exchangeable to Enterococcus faecalis on the surface of processed cheese. Food Res. Int. 2018, 107, 503–508. [Google Scholar] [CrossRef] [Scilit]
  16. Salminen, S.; Collado, M.C.; Endo, A.; Hill, C.; Lebeer, S.; Quigley, E.M.M.; Sanders, M.E.; Shamir, R.; Swan, J.R.; Szajewska, H.; et al. The International Scientific Association of Probiotics and Prebiotics (ISAPP) consensus statement on the definition and scope of postbiotics. Nat. Rev. Gastroent. Hepatol. 2021, 18, 649–667. [Google Scholar] [CrossRef] [Scilit]
  17. Chikindas, M.L.; Sichel, L.S.; Popov, I.V.; Tagg, J.R.; Lu, X.; Mitrokhin, O.V.; Todorov, S.D. Postbiotics:what are they? Ben. Microbes 2025, 1–8. [Google Scholar] [CrossRef] [Scilit]
  18. Amobonye, A.; Pillaz, B.; Hlope, F.; Tofac Asong, S.; Pillai, S. Postbiotics: An insighfutful review of the latest category in functional biotics. World J. Microbiol. Biotechnol. 2025, 41, 293. [Google Scholar] [CrossRef] [Scilit]
  19. Lauková, A.; Tomáška, M.; Drončovský, M.; Mucha, R.; Dvorožňáková, E.; Kološta, M.; Pogány Simonová, M. The application potential of the raw goat milk-derived strain Lactococcus lactis MK1/3 for the dairy industry. Appl. Sci. 2025, 15, 6781. [Google Scholar] [CrossRef] [Scilit]
  20. Lauková, A.; Maďar, M.; Zábolyová, N.; Troscianczyk, A.; Pogány Simonová, M. Fortification of goat milk yogurts with encapsulated postbiotic active lactococci. Life 2025, 14, 1147. [Google Scholar] [CrossRef] [Scilit]
  21. Kačírová, J.; Horňáková, Ľ.; Maďari, A.; Mravcová, K.; Maďar, M. Cultivable oral microbiota in puppies. Folia Vet. 2021, 65, 69–74. [Google Scholar] [CrossRef] [Scilit]
  22. Lane, D.J. 16S/23S rRNA sequencing. In Nucleic Acid Techniques in Bacterial Systematic; Stackebrandt, E., Goodfellow, M., Eds.; Wiley: Hoboken, NJ, USA, 1991; pp. 371–375. [Google Scholar]
  23. Semedo-Lemsaddek, T.; Nobrega, C.S.; Ribeiro, T.; Pedroso, N.M.; Sales-Luis, T.; Lemsaddek, A.; Tenreiro, R.; Tavares, L.; Vilela, C.L.; Oliveira, M. Virulence traits and antibiotic resistance among enterococci isolated from Eurasian otter (Lutra lutra). Vet. Microbiol. 2013, 163, 378–382. [Google Scholar] [CrossRef] [Scilit]
  24. Kubašová, I.; Strompfová, V.; Lauková, A. Safety assessment of commensal enterococci from dogs. Folia Microbiol. 2017, 20, 491–498. [Google Scholar] [CrossRef] [Scilit]
  25. Focková, V.; Styková, E.; Pogány Simonová, M.; Vargová, M.; Dvorožňáková, E.; Lauková, A. Safety assessment of fecal, bacteriocin-producing strains Enterococcus mundtii from horses. Austin J. Vet. Sci. Anim. Husb. 2022, 9, 1097. [Google Scholar]
  26. Chaieb, K.; Chehab, O.; Ymantar, T.; Rouabhia, M.; Mahdouani, K.; Bakhrouf, A. In vitro effect of pH and ethanol on biofilm formation by clinical ica-positive Staphylococcus epidermidis strains. Ann. Microbiol. 2007, 57, 431–437. [Google Scholar] [CrossRef] [Scilit]
  27. Lebreton, F.; Riboulet-Bisson, E.; Serror, P.; Sanguinetti, M.; Posteraro, B.; Torelli, R.; Hartke, A.; Auffray, Y.; Giard, J.-C. Ace, which encodes an adhesin in Enterococcus faecalis, is regulated by ers and is involved in virulence. Infect. Immun. 2009, 77, 2832–2839. [Google Scholar] [CrossRef] [Scilit]
  28. Hufnagel, M.; Koch, S.; Creti, R.; Baldassarri, L.; Huebner, J. A putative Sugar -binding transcriptional regulator in a novel gene locus in Enterococcus faecalis contributes to production of biofilm and prolonged bacteremia in mice. J. Infect. Dis. 2004, 189, 420–430. [Google Scholar] [CrossRef] [Scilit]
  29. Guiton, P.S.; Hannan, T.J.; Ford, B.; Caparon, M.G.; Hultgren, S.J. Enterococcus faecalis overcomes foreign body-mediated inflammation to establish urinary tract infection. Infect. Immun. 2013, 81, 329–339. [Google Scholar] [CrossRef] [Scilit]
  30. Hancock, L.E.; Perego, M. The Enterococcus faecalis fsr two component system controls biofilm-development through production of gelatinase. J. Bacterial. 2004, 186, 5629–5639. [Google Scholar] [CrossRef] [Scilit]
  31. Cucarella, C.; Solano, C.; Valle, J.; Amorena, B.; Lasa, I.; Penadés, J.R. Bap, a Staphylococcus aureus surface protein involved in biofilm formation. J. Bacteriol. 2001, 183, 2888–2896. [Google Scholar] [CrossRef] [Scilit]
  32. Hashem, Y.A.; Amin, H.M.; Essam, T.M.; Yassin, A.S.; Aziz, R.K. Biofilm formation in enterococci:genotype-phenotype correlations and inhibition by vancomycin. Sci. Rep. 2017, 7, 5733. [Google Scholar] [CrossRef] [Scilit]
  33. Lauková, A.; Focková, V.; Maďar, M.; Belzecki, G.; Miltko, R.; Pogány Simonová, M. Fecal strains Enterococcus mundtii from wild ruminants, their safety and postbiotic potential. Vet. Res. Com. 2025, 49, 141. [Google Scholar] [CrossRef] [Scilit]
  34. López-Salas, P.; Llaca-Díaz, J.; Morfin-Otero, R.; Tinoco, J.C.; Rodriguéz-Noriega, I.; Salcido-Gutierrez, L.; Gonzaléz, G.M.; Mendoza-Plazaran, S.; Garza-González, E. Virulence and antibiotic resistance of Enterococcus faecalis clinical isolates recovered from three states of Mexico. Arch. Med. Res. 2013, 44, 422–428. [Google Scholar] [CrossRef] [Scilit]
  35. Ghaziasgar, F.S.; Poursina, F.; Hassanzadeh, A. Virulence factors, biofilm formation and antibiotic resistance pattern in Enterococcus faecalis and Enterococcus faecium isolated from clinical and commensal human samples in Isfahan, Iran. Ann. Ig. 2019, 31, 156–164. [Google Scholar] [CrossRef] [Scilit]
  36. Ruhal, R.; Sahu, A.; Koujalagi, T.; Das, A.; Prasanth, H.; Kataria, R. Biofilm-specific determinants of enterococci pathogen. Arch. Microbiol. 2024, 206, 397. [Google Scholar] [CrossRef] [Scilit]
  37. Bonten, M.J.M.; Willems, R.; Weinstein, R.A. Vancomycin-resistant enterococci: Why are they here, and where do they come from? Lancet Infect. Dis. 2001, 1, 314–325. [Google Scholar] [CrossRef] [Scilit]
  38. Gandhi, N.U.; Chandra, S.B. A comparative analysis of three classes of bacterial non-specific acid phosphatase and archaeal phosphoesterases: Evolutionary perspective. Acta Inf. Medica 2012, 20, 167–173. [Google Scholar] [CrossRef] [Scilit]
  39. Amoozadeh, M.; Behbani, M.; Mohabatkar, H.; Keyhanfar, M. Analysis and comparison of alkaline and acid phosphatases of Gram-negative bacteria by bioinformatic and colorimetric methods. J. Biotechnol. 2020, 308, 56–62. [Google Scholar] [CrossRef] [Scilit]
  40. Hu, S.; Ding, Q.; Zhang, W.; Kang, M.; Ma, J.; Zhao, L. Gut microbial β-glucuronidase:a vital regulator in female estrogen. Gut Microbes 2023, 15, 2236749. [Google Scholar] [CrossRef] [Scilit]
  41. Sabahi, S.; Homayouni, R.A.; Aghebati-Maleki, L.; Sangtarash, N.; Ozma, M.A.; Karimi, A.; Hosseini, H.; Abassi, A. Postbiotics as the new frontier in food and pharmaceutical research. Crit. Rev. Food Sci. Nutr. 2023, 63, 8375–8402. [Google Scholar] [CrossRef] [Scilit]
  42. Rogelj, I. Milk, dairy products, nutrition and health. Food Technol. Biotechnol. 2000, 38, 143–147. [Google Scholar]
  43. Venegas-Ortega, M.G.; Flores-Gallegos, A.; Martínez-Hernández, J.L.; Aguilar, C.N.; Nevárez-Moorillón, G.V. Production of bioactive peptides from lactic acid bacteria:a sustainable approach for healthier foods. Compr. Rev. Food Sci. Food Safety 2019, 18, 10391051. [Google Scholar] [CrossRef] [Scilit]
  44. Delves-Broughton, J. Nisin and its uses as a food preservative. Food Technol. 1990, 44, 100–117. [Google Scholar]
  45. McAuliffe, O.; Ryan, M.P.; Ross, P.R.; Hill, C.; Breeuwer, P.; Abee, T. Lacticin 3147, a broad-spectrum bacteriocin which selectively dissipates the membrane potential. Appl. Environ. Microbiol. 1998, 64, 439–445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Luenglusontigit, P.; Sathapondecha, P.; Saengsuwan, P.; Surachat, K.; Boonserm, P.; Singhamanan, K. Effects of postbiotic from bacteriocin-like inhibitory substance producing Enterococcus faecalis on toxigenic Clostridioides difficile. J. Health Sci. Med. Res. 2023, 41, e2023918. [Google Scholar] [CrossRef] [Scilit]
Table 1. Oligonucleotides used in this study to amplify virulence genes and biofilm in enterococci.
Table 1. Oligonucleotides used in this study to amplify virulence genes and biofilm in enterococci.
GenesPrimer Locus SequenceProduct Size
gelEF: ACCCCGTATCATTGGTTT
R: ACGCATTGCTTTTCCATC
419 bp
Element IS16F: CATGTTCCACGAACCAGAG
R: TCAAAAAGTGGGCTTGGC
547 bp
Cytolysin cylAF: TAGCGAGTTATATCGTTCACTGTA
R: CTCACCTCTTTGTATTTAAGCATG
1282 bp
Enterococcal surface protein espF: TTGCTAATGCTAGTCCACGACC
R: GCGTCAACACTTGCATTGCCGAA
933 bp
HyaluronidaseF: GAGTAGAGGAATATCTTAGC
R: AGGCTCCAATTCTGT
661 bp
Aggregation substance aggF: AAGAAAAAGAAGTAGACCAAC
R: AAACGGCAAGACAAGTAAATA
1553 bp
icaica4F-TGGGATACTGATATGATTAC,
ica4R-CCTCTGTCTGGGGCTTGACCATG
568 bp
bapSasp7c-TGTTGAAGTTAATACTGTACCTGC,
Sasp6m-CCCTATATCGAAGGTGTAGAATTGCAC
970 bp
fsrAF-5-GAGCCGTTATGCTCCTATGC-3
R-5-CTGCGGTAGTTGTTGGA-3
450 bp
aceF-5-TTGATGCTGCTGCTGATGTG-3,
R-5-ACGGATGAGCTTGTTGGGTA-3
400 bp
srtF-5-TCTTGGTAGTGGGTCGTTGA-3
R-5-CGCAGTGTGTTTGATGTTGG-3
420 bp
bopDF-5-GATCGTCTTCGCCATAGTAGG-3
R-5-RACACAACAGCCCTTGGCT-3
312 bp
Table 2. The species identification of isolated strains based on sequencing.
Table 2. The species identification of isolated strains based on sequencing.
Strain% Identity BLASTn 16S rRNA Sequence
Enterococcus faecalis EE/K398.45%
Enterococcus faecalis EE/K599.56%
Enterococcus faecalis EE/G398.65%
Enterococcus faecalis EE/G699.91%
Enterococcus faecalis EE/G799.50%
Table 3. The enzyme production tested in E. faecalis strains using the API ZYM panel in nmoL.
Table 3. The enzyme production tested in E. faecalis strains using the API ZYM panel in nmoL.
EE/K3EE.EF/K5EE/G3EE/G6EE/G7
Alkaline phosphatase510055
Esterase (C4)2040303020
Esterase lipase (C8)2030202030
Leucine arylamidase1010101010
Valine arylamidase5101055
Cystin arylamidase510555
Trypsin55550
α-chymotrypsin2020402010
Acid phosphatase4040203020
Naphtol-AS-BI-phosphohydrolase10101055
α-galactosidase05000
β-galactosidase55050
α-glucosidase05000
β-glucosidase00550
N-acetyl-β-glucosaminidase, α-mannosidase, α-fucosidase, lipase, and β-glucuronidase were not produced by selected E. faecalis strains.
Table 4. Virulence factor encoding genes detected in selected E. faecalis.
Table 4. Virulence factor encoding genes detected in selected E. faecalis.
StrainsgelE Geneagg Geneesp Gene
EE/K3+
EE/K5+
EE/G3+
EE/G6++
EE/G7+
The genes IS16, hyl, and cylA were not present in the E. faecalis strains.
Table 5. Biofilm-formation-encoding genes detected in E. faecalis.
Table 5. Biofilm-formation-encoding genes detected in E. faecalis.
Strainsace GenebopD GenesrtA GeneBiofilm
EE/K3+0.153 ± 0.077
EE/K5++0.157 ± 0.082
EE/G3+0.246 ± 0.171
EE/G6++0.242 ± 0.166
EE/G7++0.137 ± 0.062
The genes fsr, ica, and bap were not present in E. faecalis strains.
Table 6. Average size of inhibitory zone testing susceptibility to antibiotics of the strains E. faecalis using disk diffusion method expressed in mm from double testing.
Table 6. Average size of inhibitory zone testing susceptibility to antibiotics of the strains E. faecalis using disk diffusion method expressed in mm from double testing.
EE/K3EE/K5EE/G3EE/G6EE/G7
Ampicillin
(10 µg)
15/2223/1520/1020/1022/10
Penicillin
(10 IU)
20/2020/2020/2016/1619/19
Erythromycin
(15 µg)
20/2615/2516/2115/2020/25
Tetracycline
(30 µg)
20/2515/23R (<10)R (<10)20/23
Vancomycin
(30 µg)
15/1514/14R (<10)R (<10)R (<10)
Rifampicin
(30 µg)
25/2520/2322/2521/2720/22
Chloramphenicol
(30 µg)
19/2017/2020/2012/2118/21
Gentamicin
(120 µg)
12/1112/1215/1117/17R (<10)
Table 7. The minimal inhibitory concentration under which strains are inhibited and/or susceptible by antibiotic used (E-strip method).
Table 7. The minimal inhibitory concentration under which strains are inhibited and/or susceptible by antibiotic used (E-strip method).
EE/K3EE/K5EE/G3EE/G6EE/G7
Ampicillin
(256-0.016 µg/mL)
MIC: 0.25 µg (S) 0.50 µg (S)0.50 µg (S)0.50 µg (S)0.50 µg (S)
Erythromycin
(256-0.016 µg/mL)
1.00 µg (S) 1.00 µg (S)2.00 µg (S)2.00 µg (S)1.5 µg (S)
Tetracycline
(256-0.016 µg/mL
0.30 µg (S)0.38 µg (S)32.00 µg (S)48.00 µg (S)0.38 µg (S)
Vancomycin
(256-0.016 µg/mL)
1.00 µg (S)0.50 µg (S)4.00 µg (S)6.00 µg (S)1.3 µg (S)
Streptomycin
(256-0.064 µg/mL)
128.0 µg (R/S) 256 µg (R)256 µg (R)256 µg (R)128.0 µg (R/S)
Chloramphenicol
(256-0.016 µg/mL)
12.00 µg (S)16.00 µg (S)8.00 µg (S)32.00 µg (S)12.00 µg (S)
Gentamicin
(1024-0.064 µg/mL)
16.00 µg (S)24.00 µg (S)32.00 µg (S)24.00 µg (S)32.00 µg (S)
S: susceptible; R: resistant; MIC: minimal inhibitory concentration.
Table 8. Susceptibility of E. faecalis to postbiotic substances produced by lactococci MK2/8 and MK1/3 (inhibitory activity in arbitrary unit per milliliter (AU/mL)).
Table 8. Susceptibility of E. faecalis to postbiotic substances produced by lactococci MK2/8 and MK1/3 (inhibitory activity in arbitrary unit per milliliter (AU/mL)).
StrainsSubstance MK2/8Substance MK1/3
EE/K3400 AU/mL100 AU/mL
EE/K5100 AU/mL400 AU/mL
EE/G3400 AU/mL100 AU/mL
EE/G6400 AU/mL400 AU/mL
EE/G7400 AU/mL400 AU/mL
The activity against E. avium (the principal indicator ranged from 800 up to 1600 AU/mL).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lauková, A.; Bino, E.; Zábolyová, N.; Maďar, M.; Pogány Simonová, M. The Strains Enterococcus faecalis as Contaminants of Raw Goat Milk and Their Treatment with Postbiotic Active Substances Produced by Autochthonous Lactococci. Processes 2025, 13, 3552. https://doi.org/10.3390/pr13113552

AMA Style

Lauková A, Bino E, Zábolyová N, Maďar M, Pogány Simonová M. The Strains Enterococcus faecalis as Contaminants of Raw Goat Milk and Their Treatment with Postbiotic Active Substances Produced by Autochthonous Lactococci. Processes. 2025; 13(11):3552. https://doi.org/10.3390/pr13113552

Chicago/Turabian Style

Lauková, Andrea, Eva Bino, Natália Zábolyová, Marián Maďar, and Monika Pogány Simonová. 2025. "The Strains Enterococcus faecalis as Contaminants of Raw Goat Milk and Their Treatment with Postbiotic Active Substances Produced by Autochthonous Lactococci" Processes 13, no. 11: 3552. https://doi.org/10.3390/pr13113552

APA Style

Lauková, A., Bino, E., Zábolyová, N., Maďar, M., & Pogány Simonová, M. (2025). The Strains Enterococcus faecalis as Contaminants of Raw Goat Milk and Their Treatment with Postbiotic Active Substances Produced by Autochthonous Lactococci. Processes, 13(11), 3552. https://doi.org/10.3390/pr13113552

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop