The Role of Serum Vitamin D Levels and Vitamin D Receptor (VDR) Gene Variants on Dental Caries
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Design and Participants
2.2. Sample Size Determination
2.3. Data Collection
2.3.1. Dental Examination and Questionnaire
2.3.2. Biochemical Tests
- A total of 5 cc of blood to analyze Ca+2, ALP, and P−3 levels was collected into yellow top tubes containing serum separating gel.
- A total of 2 cc of blood for CBC analysis was collected into purple top tubes containing K2-EDTA. Hemoglobin (HGB) values were recorded from the CBC tests.
- A total of 2 cc of blood for vitamin D measurement was collected into purple top tubes containing K2-EDTA.
2.3.3. Genetic Analysis
2.4. Statistical Analysis
3. Results
4. Discussion
5. Strengths
6. Limitations
7. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- World Health Organization. Global Oral Health Status Report: Towards Universal Health Coverage for Oral Health by 2030; World Health Organization: Geneva, Switzerland, 2023.
- Selwitz, R.H.; Ismail, A.I.; Pitts, N.B. Dental Caries. Lancet 2007, 369, 51–59. [Google Scholar] [CrossRef] [PubMed]
- Kidd, E.; Fejerskov, O. Essentials of Dental Caries; Oxford University Press: Oxford, UK, 2022; pp. 6–8. [Google Scholar]
- Gyll, J.; Ridell, K.; Öhlund, I.; Karlsland Åkeson, P.; Johansson, I.; Lif Holgerson, P. Vitamin D Status and Dental Caries in Healthy Swedish Children. Nutr. J. 2018, 17, 11. [Google Scholar] [CrossRef] [PubMed]
- Wójcik, D.; Krzewska, A.; Szalewski, L.; Pietryka-Michałowska, E.; Szalewska, M.; Krzewski, S.; Pels, E.; Beń-Skowronek, I. Dental Caries and Vitamin D3 in Children with Growth Hormone Deficiency: A STROBE Compliant Study. Medicine 2018, 97, e9811. [Google Scholar] [CrossRef] [PubMed]
- Phantumvanit, P.; Makino, Y.; Ogawa, H.; Rugg-Gunn, A.; Moynihan, P.; Petersen, P.E.; Evans, W.; Feldens, C.A.; Lo, E.; Khoshnevisan, M.H.; et al. WHO Global Consultation on Public Health Intervention against Early Childhood Caries. Community Dent. Oral Epidemiol. 2018, 46, 280–287. [Google Scholar] [CrossRef]
- Sharma, U.; Pal, D.; Prasad, R. Alkaline Phosphatase: An Overview. Indian J. Clin. Biochem. 2014, 29, 269–278. [Google Scholar] [CrossRef]
- Erdur, C.B.; Kafes, C.; Özbek, E.; Genel, F. A Harmless Clinical Condition Presenting with Dramatic Elevation of Alkaline Phosphatase: Bening Transient Hyperphosphatasemia of Childhood. J. Tepecik Educ. Res. Hosp. 2017, 27, 61–64. [Google Scholar] [CrossRef]
- Celep, G.; Durmaz, Z. A Public Health Problem: Vitamin D Status in Child Health Follow Up. Pamukkale Med. J. 2021, 14, 63–70. [Google Scholar] [CrossRef]
- Jha, A.; Jha, S.; Shree, R.; Kumar, A.; Menka, K.; Shrikaar, M. Association between Serum Ferritin, Hemoglobin, Vitamin D3, Serum Albumin, Calcium, Thyrotropin-Releasing Hormone with Early Childhood Caries: A Case–Control Study. Int. J. Clin. Pediatr. Dent. 2021, 14, 648–651. [Google Scholar] [CrossRef]
- Schroth, R.J.; Rabbani, R.; Loewen, G.; Moffatt, M.E. Vitamin D and Dental Caries in Children. J. Dent. Res. 2016, 95, 173–179. [Google Scholar] [CrossRef]
- Lopez, A.-G.; Kerlan, V.; Desailloud, R. Non-Classical Effects of Vitamin D: Non-Bone Effects of Vitamin D. Ann. D’endocrinologie 2021, 82, 43–51. [Google Scholar] [CrossRef]
- Cogulu, D.; Onay, H.; Ozdemir, Y.; Aslan, G.I.; Ozkinay, F.; Eronat, C. The Role of Vitamin D Receptor Polymorphisms on Dental Caries. J. Clin. Pediatr. Dent. 2016, 40, 211–214. [Google Scholar] [CrossRef] [PubMed]
- Kim, I.J.; Lee, H.S.; Ju, H.J.; Na, J.Y.; Oh, H.W. A Cross-Sectional Study on the Association between Vitamin D Levels and Caries in the Permanent Dentition of Korean Children. BMC Oral Health 2018, 18, 43. [Google Scholar] [CrossRef] [PubMed]
- Wójcik, D.; Szalewski, L.; Pietryka-Michałowska, E.; Borowicz, J.; Pels, E.; Beń-Skowronek, I. Vitamin D3 and Dental Caries in Children with Growth Hormone Deficiency. Int. J. Endocrinol. 2019, 5, 2172137. [Google Scholar] [CrossRef]
- Chhonkar, A.; Arya, V. Comparison of Vitamin D Level of Children with Severe Early Childhood Caries and Children with No Caries. Int. J. Clin. Pediatr. Dent. 2018, 11, 199–204. [Google Scholar] [CrossRef]
- Singleton, R.; Day, G.; Thomas, T.; Schroth, R.; Klejka, J.; Lenaker, D.; Berner, J. Association of Maternal Vitamin D Deficiency with Early Childhood Caries. J. Dent. Res. 2019, 98, 549–555. [Google Scholar] [CrossRef]
- Pludowski, P.; Karzczmarewicz, E.; Bayer, M.; Carter, G.; Chlebna-Sokół, D.; Czech-Kowalska, J.; Dębski, R.; Decsi, T.; Dobrzańska, A.; Franek, E.; et al. Practical Guidelines for the Supplementation of Vitamin D and the Treatment of Deficits in Central Europe. Endokrynol. Pol. 2013, 64, 319–327. [Google Scholar] [CrossRef]
- Küchler, E.C.; Carelli, J.; Morais, N.D.; Brancher, J.A.; de França Lopes, C.M.C.; Baratto-Filho, F.; Paddenberg, E.; de Menezes Oliveira, M.A.H.; Moro, A.; Kirschneck, C. Assessing the Association between Vitamin D Receptor and Dental Age Variability. Clin. Oral Investig. 2021, 26, 1677–1682. [Google Scholar] [CrossRef]
- Schroth, R.J.; Jeal, N.S.; Kliewer, E.; Sellers, E.A.C. The Relationship between Vitamin D and Severe Early Childhood Caries: A Pilot Study. Int. J. Vitam. Nutr. Res. 2012, 82, 53–62. [Google Scholar] [CrossRef]
- Bakanlığı, S. Pediatrik Popülasyonda Yürütülen Klinik Araştırmalarda Etik Yaklaşımlara Ilişkin Kılavuz. 2015. Available online: https://cdn.istanbul.edu.tr/FileHandler2.ashx?f=pediatrik-populasyonda-yurutulen-klinik-arastirmalarda-etik-yaklasimlara-iliskin-kilavuz[1].pdf (accessed on 21 December 2024).
- Watson, R.R. Handbook of Vitamin D in Human Health; Watson, R.R., Ed.; Brill|Wageningen Academic: Wageningen, The Netherlands, 2013; Volume 4, ISBN 9789086867653. [Google Scholar]
- Almoudi, M.M.; Hussein, A.S.; Abu Hassan, M.I.; Schroth, R.J. Dental Caries and Vitamin D Status in Children in Asia. Pediatr. Int. 2019, 61, 327–338. [Google Scholar] [CrossRef]
- Silva, C.C.; Gavinha, S.; Manso, M.C.; Rodrigues, R.; Martins, S.; Guimarães, J.T.; Santos, A.C.; Melo, P. Serum Levels of Vitamin D and Dental Caries in 7-Year-Old Children in Porto Metropolitan Area. Nutrients 2021, 13, 166. [Google Scholar] [CrossRef]
- Williams, T.L.; Boyle, J.; Mittermuller, B.; Carrico, C.; Schroth, R.J. Association between Vitamin D and Dental Caries in a Sample of Canadian and American Preschool-Aged Children. Nutrients 2021, 13, 4465. [Google Scholar] [CrossRef] [PubMed]
- Akinkugbe, A.A.; Moreno, O.; Brickhouse, T.H. Serum Cotinine, Vitamin D Exposure Levels and Dental Caries Experience in U.S. Adolescents. Community Dent. Oral Epidemiol. 2019, 47, 185–192. [Google Scholar] [CrossRef] [PubMed]
- van der Tas, J.T.; Elfrink, M.E.C.; Heijboer, A.C.; Rivadeneira, F.; Jaddoe, V.W.V.; Tiemeier, H.; Schoufour, J.D.; Moll, H.A.; Ongkosuwito, E.M.; Wolvius, E.B.; et al. Foetal, Neonatal and Child Vitamin D Status and Enamel Hypomineralization. Community Dent. Oral Epidemiol. 2018, 46, 343–351. [Google Scholar] [CrossRef] [PubMed]
- Zhan, Y.; Samietz, S.; Holtfreter, B.; Hannemann, A.; Meisel, P.; Nauck, M.; Volzke, H.; Wallaschofski, H.; Dietrich, T.; Kocher, T. Prospective Study of Serum 25-Hydroxy Vitamin d and Tooth Loss. J. Dent. Res. 2014, 93, 639–644. [Google Scholar] [CrossRef]
- Tüber, T.B.R. Türkiye Beslenme Rehberi 2015 (TÜBER). 2016; Volume 2015, ISBN 9789755906089. Available online: https://okulsagligi.meb.gov.tr/meb_iys_dosyalar/2017_01/27102535_tyrkiye_beslenme_rehberi.pdf (accessed on 21 December 2024).
- Han, F.F.; Lv, Y.L.; Gong, L.L.; Liu, H.; Wan, Z.R.; Liu, L.H. VDR Gene Variation and Insulin Resistance Related Diseases. Lipids Health Dis. 2017, 16, 157. [Google Scholar] [CrossRef]
- Parthasarathy, P.; Priya, V.; Gayathri, R. Relationship between Vitamin D and Dental Caries- Review. J. Pharm. Sci. Res. 2016, 8, 459–460. [Google Scholar]
- Seminario, A.L.; Velan, E. Vitamin D and Dental Caries in Primary Dentition. J. Dent. Child. 2016, 83, 114–119. [Google Scholar]
- Davit-Béal, T.; Gabay, J.; Antoniolli, P.; Masle-Farquhar, J.; Wolikow, M. Dental Complications of Rickets in Early Childhood: Case Report on 2 Young Girls. Pediatrics 2014, 133, e1077–e1081. [Google Scholar] [CrossRef]
- Schroth, R.J.; Levi, J.A.; Sellers, E.A.; Friel, J.; Kliewer, E.; Moffatt, M.E.K. Vitamin D Status of Children with Severe Early Childhood Caries: A Case-Control Study. BMC Pediatr. 2013, 13, 174. [Google Scholar] [CrossRef]
- Aydınoğlu, S.; Kuşgöz, A. Trabzon Ilinde, 3-6 Yaş Grubu Çocuklarda Erken Çocukluk Çağı Çürüğü Prevalansı ve Ilişkili Risk Faktörlerinin Değerlendirilmesi. Atatürk Üniversitesi Diş Hekim. Fakültesi Derg. 2020, 29, 589–596. [Google Scholar] [CrossRef]
- Krishnan, R.; Kumar, V.; Ramesh, M.; Stephen, A. Prevalence of Early Childhood Caries and Its Risk Factors in 18-72 Month Old Children in Salem, Tamil Nadu. J. Int. Soc. Prev. Community Dent. 2015, 5, 95. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Wulaerhan, J.; Liu, Y.; Abudureyimu, A.; Zhao, J. Prevalence of Severe Early Childhood Caries and Associated Socioeconomic and Behavioral Factors in Xinjiang, China: A Cross-Sectional Study. BMC Oral Health 2017, 17, 144. [Google Scholar] [CrossRef] [PubMed]
- Navarro, C.L.A.; Grgic, O.; Trajanoska, K.; Van Der Tas, J.T.; Rivadeneira, F.; Wolvius, E.B.; Voortman, T.; Kragt, L. Associations between Prenatal, Perinatal, and Early Childhood Vitamin D Status and Risk of Dental Caries at 6 Years. J. Nutr. 2021, 151, 1993–2000. [Google Scholar] [CrossRef] [PubMed]
- Seminario, A.L.; Jumani, K.; Velan, E.; Scott, J.M.; Latimer, J.; Schroth, R.J. Suboptimal Serum Vitamin D Associated with Early Childhood Caries in Special Health Care Needs Children. J. Dent. Child. 2018, 85, 93–101. [Google Scholar]
- Pavlesen, S.; Mai, X.; Wactawski-Wende, J.; LaMonte, M.J.; Hovey, K.M.; Genco, R.J.; Millen, A.E. Vitamin D Status and Tooth Loss in Postmenopausal Females: The Buffalo Osteoporosis and Periodontal Disease Study. J. Periodontol. 2016, 87, 852–863. [Google Scholar] [CrossRef]
- Dudding, T.; Thomas, S.J.; Duncan, K.; Lawlor, D.A.; Timpson, N.J. Re-Examining the Association between Vitamin D and Childhood Caries. PLoS ONE 2015, 10, e0143769. [Google Scholar] [CrossRef][Green Version]
- Herzog, K.; Scott, J.M.; Hujoel, P.; Seminario, A.L. Association of Vitamin D and Dental Caries in Children. J. Am. Dent. Assoc. 2016, 147, 413–420. [Google Scholar] [CrossRef]
- Hujoel, P.P.; Lingström, P. Nutrition, Dental Caries and Periodontal Disease: A Narrative Review. J. Clin. Periodontol. 2017, 44, 79–84. [Google Scholar] [CrossRef]
- Cagetti, M.G.; Wolf, T.G.; Tennert, C.; Camoni, N.; Lingström, P.; Campus, G. The Role of Vitamins in Oral Health. A Systematic Review and Meta-Analysis. Int. J. Environ. Res. Public Health 2020, 17, 938. [Google Scholar] [CrossRef]
- Akın, F.E.; Güleç Ceylan, G.; Demirezer Bolat, A.; Tayfur Yürekli, Ö.; Mustafa, T.; Selvi, E.; Büyükaşık, N.Ş.; Ersoy, O. Vitamin D Reseptör Gen Polimorfizmi Ile Primer Biliyer Siroz Ilişkisi. Akad. Gastroenteroloji Derg. 2017, 25, 106–109. [Google Scholar] [CrossRef]
- Yang, L.; Ma, J.; Zhang, X.; Fan, Y.; Wang, L. Protective Role of the Vitamin D Receptor. Cell. Immunol. 2012, 279, 160–166. [Google Scholar] [CrossRef] [PubMed]
- de la Guía-Galipienso, F.; Martínez-Ferran, M.; Vallecillo, N.; Lavie, C.J.; Sanchis-Gomar, F.; Pareja-Galeano, H. Vitamin D and Cardiovascular Health. Clin. Nutr. 2021, 40, 2946–2957. [Google Scholar] [CrossRef] [PubMed]
- Ferrari, S.; Bonjour, J.-P.; Rizzoli, R. The Vitamin D Receptor Gene and Calcium Metabolism. Trends Endocrinol. Metab. 1998, 9, 259–265. [Google Scholar] [CrossRef] [PubMed]
- Bikle, D.; Christakos, S. New Aspects of Vitamin D Metabolism and Action—Addressing the Skin as Source and Target. Nat. Rev. Endocrinol. 2020, 16, 234–252. [Google Scholar] [CrossRef]
- Ruiz-Ballesteros, A.I.; Meza-Meza, M.R.; Vizmanos-Lamotte, B.; Parra-Rojas, I.; de la Cruz-Mosso, U. Association of Vitamin D Metabolism Gene Polymorphisms with Autoimmunity: Evidence in Population Genetic Studies. Int. J. Mol. Sci. 2020, 21, 9626. [Google Scholar] [CrossRef]
- Dayangaç, D.; Özaydın, E.; Gerçeker, F.; Coşkun, T.; Yurter, H. Sağlıklı Türk Populasyonunda Vitamin D Reseptör (VDR) Gen Polimorfizm Analizi. Türk Biyokim. Derg. 2002, 27, 11–16. [Google Scholar]
- Sadeghi, M.; Golshah, A.; Godiny, M.; Sharifi, R.; Khavid, A.; Nikkerdar, N.; Tadakamadla, S.K. The Most Common Vitamin D Receptor Polymorphisms (ApaI, FokI, TaqI, BsmI, and BglI) in Children with Dental Caries: A Systematic Review and Meta-Analysis. Children 2021, 8, 302. [Google Scholar] [CrossRef]
- Yu, M.; Jiang, Q.-Z.; Sun, Z.-Y.; Kong, Y.-Y.; Chen, Z. Association between Single Nucleotide Polymorphisms in Vitamin D Receptor Gene Polymorphisms and Permanent Tooth Caries Susceptibility to Permanent Tooth Caries in Chinese Adolescent. BioMed Res. Int. 2017, 2017, 4096316. [Google Scholar] [CrossRef]
- Madalena, I.R.; Xavier, T.A.; Cruz, G.V.; Brancher, J.A.; da Silva, L.A.B.; Paza, A.O.; Segato, R.A.B.; Küchler, E.C. Evaluation of Vitamin D Receptor Genetic Polymorphisms with Dental Caries and Developmental Defects of Enamel in Brazilian Children. Pediatr. Dent. J. 2020, 30, 161–166. [Google Scholar] [CrossRef]
- Kong, Y.-Y.; Zheng, J.-M.; Zhang, W.-J.; Jiang, Q.-Z.; Yang, X.-C.; Yu, M.; Zeng, S.-J. The Relationship between Vitamin D Receptor Gene Polymorphism and Deciduous Tooth Decay in Chinese Children. BMC Oral Health 2017, 17, 111. [Google Scholar] [CrossRef]
- Lei, W.; Tian, H.; Xia, Y. Association between the TaqI (Rs731236 T>C) Gene Polymorphism and Dental Caries Risk: A Meta-Analysis. Genet. Test. Mol. Biomark. 2021, 25, 368–375. [Google Scholar] [CrossRef] [PubMed]
- Hu, X.P.; Li, Z.Q.; Zhou, J.Y.; Yu, Z.H.; Zhang, J.M.; Guo, M.L. Analysis of the Association between Polymorphisms in the Vitamin D Receptor (VDR) Gene and Dental Caries in a Chinese Population. Genet. Mol. Res. 2015, 14, 11631–11638. [Google Scholar] [CrossRef] [PubMed]
- Protyusha, G.; Sundharam, B.S. Analysis of the Association between Polymorphisms in Vitamin D Receptor Gene and Dental Caries. Indian J. Dent. Res. 2021, 32, 3. [Google Scholar] [CrossRef] [PubMed]
- Izakovicova Holla, L.; Borilova Linhartova, P.; Kastovsky, J.; Bartosova, M.; Musilova, K.; Kukla, L.; Kukletova, M. Vitamin D Receptor TaqI Gene Polymorphism and Dental Caries in Czech Children. Caries Res. 2017, 51, 7–11. [Google Scholar] [CrossRef]

| Baseline Reference Range 1 | Ege University Faculty of Medicine Reference Range 2 | ||
|---|---|---|---|
| Status | Serum 25(OD)D level | Status | Serum 25(OH)D level |
| severe deficiency | 0–9 ng/mL | significant deficiency | 10 ng/mL and below |
| deficiency | 10–19 ng/mL | mild–medium deficiency | 10–19 ng/mL |
| suboptimal | 20–29 ng/mL | optimal | 20–50 ng/mL |
| optimal | 30–49 ng/mL | increased risk level for hypercalciuria | 51–80 ng/mL |
| high | ≥50 ng/mL | possibility of toxicity | 80 ng/mL and above |
| Primers | Sequence (5′-3′) | |
|---|---|---|
| 3 | forward | GCACCAAGGATGCCAGC |
| reverse | CCTTCATGGAAACACCTTGC | |
| 4 | forward | GTGATGACAGGGTGAGGAGC |
| reverse | AAGGCCTTTCCCTGACTCC | |
| 5 | forward | AAGGTTTCCTGGAGGAGCTG |
| reverse | CCCTCTGTCCCTACTCCCTG | |
| 6 | forward | ATCAGGGCCAAGGTAGGAAG |
| reverse | GTGCGGTGGACTCCTCG | |
| 7 | forward | CAGAGGGAAGCCTGGGGCT |
| reverse | GTGGTGGATGAGTGATCTCCAACCC | |
| 8/9 | forward | TGATTTGTGTGGCTTGAAGG |
| reverse | TTTGTCCTTCATACTCCCCG | |
| 10 | forward | GGTGGTGGGATTGAGCAG |
| reverse | ACGTGGCCCTGGAGGAG | |
| Caries-free (n = 64) | Caries (n = 64) | ||||||
|---|---|---|---|---|---|---|---|
| Variables | Classification | n | (%) | n | (%) | t | p |
| Age (years) | 3 | 14 | 21.9 | 2 | 3.1 | Chi-square trend = 28.949 * | 0.000 |
| 4 | 19 | 29.7 | 8 | 12.5 | |||
| 5 | 19 | 29.7 | 12 | 18.8 | |||
| 6 | 12 | 18.8 | 42 | 65.6 | |||
| Sex | female | 32 | 50.0 | 32 | 50.0 | Chi-square = 0.000 ** | 1.000 |
| male | 32 | 50.0 | 32 | 50.0 | |||
| Frequency of tooth brushing (per day) | <2 | 44 | 68.7 | 45 | 71.3 | Chi-square = 1.368 | 0.505 |
| 2≥ | 20 | 31.3 | 19 | 29.7 | |||
| Who brushed the teeth | by child alone | 32 | 50.0 | 35 | 54.7 | Chi-square = 0.407 | 0.816 |
| with family | 23 | 35.9 | 22 | 34.4 | |||
| by family | 9 | 14.1 | 7 | 10.9 | |||
| Frequency of routine dental visits (6 month) | yes | 1 | 1.6 | 7 | 10.9 | Chi-square = 4.879 | 0.087 |
| more than 6 months | 10 | 15.6 | 8 | 12.5 | |||
| no | 53 | 82.8 | 49 | 76.6 | |||
| Fluoride treatment (in the last 6 months) | yes | 1 | 1.6 | 1 | 1.6 | Chi-square = 0.000 | 1.000 |
| no | 63 | 98.4 | 63 | 98.4 | |||
| Use of fluoridated toothpaste | yes | 22 | 34.4 | 45 | 70.3 | Chi-square = 16.568 | 0.000 |
| no | 42 | 65.6 | 19 | 29.7 | |||
| Sugar consumption between meals | never | 8 | 12.5 | 1 | 1.6 | Chi-square = 8.098 | 0.017 |
| rarely | 29 | 45.3 | 24 | 37.5 | |||
| every day | 27 | 42.2 | 39 | 60.9 | |||
| Measurement serum vitamin D level | yes | 15 | 23.4 | 13 | 20.3 | Chi-square = 0.183 | 0.669 |
| no | 49 | 76.6 | 51 | 79.7 | |||
| Taking a vitamin D supplement | yes | 23 | 35.9 | 13 | 20.3 | Chi-square = 3.865 | 0.049 |
| no | 41 | 64.1 | 51 | 79.7 | |||
| Daily milk, cheese, egg, and fish consumption | Does not eat | 8 | 12.5 | 5 | 7.8 | Chi-square = 5.824 | 0.054 |
| rarely | 4 | 6.3 | 13 | 20.3 | |||
| eats at least one every day | 52 | 81.3 | 46 | 71.9 | |||
| Caries-free (n = 64) | Caries (n = 64) | ||||||
|---|---|---|---|---|---|---|---|
| n | (%) | n | (%) | t | p | ||
| 25(OH)D Level (two classifications) | deficiency and suboptimal (3–29 ng/mL) | 50 | 78.10 | 55 | 85.90 | Chi-square = 1.325 | 0.250 |
| optimal (30–50 ng/mL) | 14 | 21.90 | 9 | 14.10 | |||
| 25(OH)D Level (three classifications) | severe deficiency (0–9 ng/mL) | 7 | 5.50 | 9 | 7.00 | Chi-square = 0.888 | 0.642 |
| deficiency (10–19 ng/mL) | 29 | 22.70 | 32 | 25.00 | |||
| optimal (20–50 ng/mL) | 28 | 21.90 | 23 | 18.00 | |||
| HGB | low (<11.5) | 15 | 23.40 | 14 | 22.20 | Chi-square = 0.027 | 0.870 |
| normal (11.5–14.5) | 49 | 76.60 | 49 | 77.80 | |||
| Ca+2 | normal (8.6–10.2 mg/dL) | 57 | 89.10 | 62 | 96.90 | Chi-square = 2.988 | 0.84 |
| high (>10.2 mg/dL) | 7 | 10.90 | 2 | 3.10 | |||
| P−3 | normal (3.1–6) | 64 | 100.00 | 63 | 98.40 | Chi-square = 1.008 | 0.315 |
| high (>6) | - | - | 1 | 1.60 | |||
| ALP | low (<142 IU/mL) | 5 | 7.80 | 5 | 7.80 | Chi-square = 1.009 | 0.604 |
| normal (142–335 IU/mL) | 59 | 92.20 | 58 | 90.60 | |||
| high (>335 IU/mL) | - | - | 1 | 1.16 | |||
| Vitamin D | ||
|---|---|---|
| dmft | Spearman rho | −0.151 |
| p | 0.088 | |
| Age | Spearman rho | −0.127 |
| p | 0.153 | |
| HGB | Spearman rho | −0.075 |
| p | 0.403 | |
| Ca+2 | Spearman rho | 0.115 |
| p | 0.196 | |
| P−3 | Spearman rho | −0.088 |
| p | 0.322 | |
| ALP | Spearman rho | −0.119 |
| p | 0.181 |
| Result of the Exon-3 (FokI Polymorphism) | Result of the Exon-10 (TaqI Polymorphism) | Result of the Exon–Intron Junctions-10 (ApaI Polymorphism) | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Caries-Free * | Caries | Caries-Free | Caries | Caries-Free | Caries | |||||||
| n | % | n | % | n | % | n | % | n | % | n | % | |
| Normal | 1 | 4.0 | 1 | 4.0 | 3 | 11.5 | 3 | 11.5 | 1 | 3.8 | 2 | 7.7 |
| Heterozygous polymorphism | 3 | 12.0 | 7 | 28.0 | 10 | 38.5 | 6 | 23.1 | 10 | 38.5 | 6 | 23.1 |
| Homozygous polymorphism | 8 | 32.0 | 5 | 20.0 | 0 | 0.0 | 4 | 15.4 | 2 | 7.7 | 5 | 19.2 |
| Total | 12 | 48.0 | 13 | 52.0 | 13 | 50.0 | 13 | 50.0 | 13 | 50.0 | 13 | 50.0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Şengün Berber, E.; Koç, F.U.; Aykut, A.; Barutçuoğlu, B.; Ertuğrul, F.; Tosyalı, M.; Pekerbaş, M.; Aykut Yetkiner, A. The Role of Serum Vitamin D Levels and Vitamin D Receptor (VDR) Gene Variants on Dental Caries. Children 2025, 12, 7. https://doi.org/10.3390/children12010007
Şengün Berber E, Koç FU, Aykut A, Barutçuoğlu B, Ertuğrul F, Tosyalı M, Pekerbaş M, Aykut Yetkiner A. The Role of Serum Vitamin D Levels and Vitamin D Receptor (VDR) Gene Variants on Dental Caries. Children. 2025; 12(1):7. https://doi.org/10.3390/children12010007
Chicago/Turabian StyleŞengün Berber, Ece, Feyza Umay Koç, Ayça Aykut, Burcu Barutçuoğlu, Fahinur Ertuğrul, Merve Tosyalı, Mert Pekerbaş, and Arzu Aykut Yetkiner. 2025. "The Role of Serum Vitamin D Levels and Vitamin D Receptor (VDR) Gene Variants on Dental Caries" Children 12, no. 1: 7. https://doi.org/10.3390/children12010007
APA StyleŞengün Berber, E., Koç, F. U., Aykut, A., Barutçuoğlu, B., Ertuğrul, F., Tosyalı, M., Pekerbaş, M., & Aykut Yetkiner, A. (2025). The Role of Serum Vitamin D Levels and Vitamin D Receptor (VDR) Gene Variants on Dental Caries. Children, 12(1), 7. https://doi.org/10.3390/children12010007

