Enhanced Extracellular Matrix Deposition on Titanium Implant Surfaces: Cellular and Molecular Evidences
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethic Statement
2.2. Cell Culture Establishment
2.3. Cell Immunophenotyping
2.4. Mesengenic Differentiation and Histochemical Analysis
2.5. Dental Implants
2.6. Exposure to the Titanium Surfaces
2.7. Cell Viability Assay
2.8. Scanning Electron Microscopy (SEM) Analysis
2.9. Confocal Laser Scanning Microscopy (CLSM) Analysis
2.10. RNA Isolation and Real-Time RT-PCR Analysis
2.11. Protein Expression
2.12. Data and Statistical Analysis
3. Results
3.1. Cell Characterization
3.2. Cell Viabilityassay and Morphological Features of hPDLSCs Cultured on CTRL and TEST Titanium Surfaces
3.3. hPDLSCs Adhesion
3.4. Implant Titanium Disks Affect Protein Expression at CLSM
3.5. Genes and Proteins Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Han, Y.; Li, X.; Zhang, Y.; Han, Y.; Chang, F.; Ding, J. Mesenchymal Stem Cells for Regenerative Medicine. Cells 2019, 8, 886. [Google Scholar] [CrossRef] [Green Version]
- Ruh, A.C.; Frigo, L.; Cavalcanti, M.; Svidnicki, P.; Vicari, V.N.; Lopes-Martins, R.A.B.; Junior, E.C.P.L.; De Isla, N.; Diomede, F.; Trubiani, O.; et al. Laser photobiomodulation in pressure ulcer healing of human diabetic patients: Gene expression analysis of inflammatory biochemical markers. Lasers Med. Sci. 2018, 33, 165–171. [Google Scholar] [CrossRef]
- Diomede, F.; Merciaro, I.; Martinotti, S.; Cavalcanti, M.F.; Caputi, S.; Mazzon, E.; Trubiani, O. miR-2861 is involved in osteogenic commitment of human periodontal ligament stem cells grown onto 3D scaffold. J. Biol. Regul. Homeost Agents 2016, 30, 1009–1018. [Google Scholar]
- Portron, S.; Soueidan, A.; Marsden, A.C.; Rakic, M.; Verner, C.; Weiss, P.; Badran, Z.; Struillou, X. Periodontal regenerative medicine using mesenchymal stem cells and biomaterials: A systematic review of pre-clinical studies. Dent. Mater. J. 2019, 38, 867–883. [Google Scholar] [CrossRef] [Green Version]
- Sinjari, B.; Pizzicannella, J.; D’Aurora, M.; Zappacosta, R.; Gatta, V.; Fontana, A.; Trubiani, O.; Diomede, F. Curcumin/Liposome Nanotechnology as Delivery Platform for Anti-inflammatory Activities via NFkB/ERK/pERK Pathway in Human Dental Pulp Treated With 2-HydroxyEthyl MethAcrylate (HEMA). Front. Physiol. 2019, 10, 633. [Google Scholar] [CrossRef]
- Tomokiyo, A.; Wada, N.; Maeda, H. Periodontal Ligament Stem Cells: Regenerative Potency in Periodontium. Stem Cells Dev. 2019, 28, 974–985. [Google Scholar] [CrossRef]
- Diomede, F.; Marconi, G.D.; Guarnieri, S.; D’Attilio, M.; Cavalcanti, M.; Mariggio, M.A.; Pizzicannella, J.; Trubiani, O. A Novel Role of Ascorbic Acid in Anti-Inflammatory Pathway and ROS Generation in HEMA Treated Dental Pulp Stem Cells. Materials 2019, 13, 130. [Google Scholar] [CrossRef] [Green Version]
- Pizzicannella, J.; Fonticoli, L.; Guarnieri, S.; Marconi, G.D.; Rajan, T.S.; Trubiani, O.; Diomede, F. Antioxidant Ascorbic Acid Modulates NLRP3 Inflammasome in LPS-G Treated Oral Stem Cells through NFkappaB/Caspase-1/IL-1beta Pathway. Antioxidants 2021, 10, 797. [Google Scholar] [CrossRef]
- Laino, L.; La Noce, M.; Fiorillo, L.; Cervino, G.; Nucci, L.; Russo, D.; Herford, A.S.; Crimi, S.; Bianchi, A.; Biondi, A.; et al. Dental Pulp Stem Cells on Implant Surface: An In Vitro Study. BioMed Res. Int. 2021, 2021, 3582342. [Google Scholar] [CrossRef]
- Yeo, I.L. Modifications of Dental Implant Surfaces at the Micro- and Nano-Level for Enhanced Osseointegration. Materials (Basel) 2019, 13, 89. [Google Scholar] [CrossRef] [Green Version]
- Yu, Y.J.; Zhu, W.Q.; Xu, L.N.; Ming, P.P.; Shao, S.Y.; Qiu, J. Osseointegration of titanium dental implant under fluoride exposure in rabbits: Micro-CT and histomorphometry study. Clin. Oral Implant. Res. 2019, 30, 1038–1048. [Google Scholar] [CrossRef]
- Matos, G.R.M. Surface Roughness of Dental Implant and Osseointegration. J. Maxillofac. Oral Surg. 2021, 20, 1–4. [Google Scholar] [CrossRef]
- Ehrenfest, D.M.D.; Coelho, P.G.; Kang, B.S.; Sul, Y.T.; Albrektsson, T. Classification of osseointegrated implant surfaces: Materials, chemistry and topography. Trends Biotechnol. 2010, 28, 198–206. [Google Scholar] [CrossRef]
- Fischer, K.; Stenberg, T. Prospective 10-year cohort study based on a randomized, controlled trial (RCT) on implant-supported full-arch maxillary prostheses. part II: Prosthetic outcomes and maintenance. Clin. Implant. Dent. Relat. Res. 2013, 15, 498–508. [Google Scholar] [CrossRef]
- Shibata, Y.; Tanimoto, Y. A review of improved fixation methods for dental implants. Part I: Surface optimization for rapid osseointegration. J. Prosthodont. Res. 2015, 59, 20–33. [Google Scholar] [CrossRef]
- Marconi, G.D.; Diomede, F.; Pizzicannella, J.; Fonticoli, L.; Merciaro, I.; Pierdomenico, S.D.; Mazzon, E.; Piattelli, A.; Trubiani, O. Enhanced VEGF/VEGF-R and RUNX2 Expression in Human Periodontal Ligament Stem Cells Cultured on Sandblasted/Etched Titanium Disk. Front. Cell Dev. Biol. 2020, 8, 315. [Google Scholar] [CrossRef]
- Rupp, F.; Scheideler, L.; Rehbein, D.; Axmann, D.; Geis-Gerstorfer, J. Roughness induced dynamic changes of wettability of acid etched titanium implant modifications. Biomaterials 2004, 25, 1429–1438. [Google Scholar] [CrossRef]
- Albrektsson, T.; Wennerberg, A. Oral implant surfaces: Part 1-Review focusing on topographic and chemical properties of different surfaces and in vivo responses to them. Int. J. Prosthodont. 2004, 17, 536–543. [Google Scholar]
- Ramaglia, L.; Postiglione, L.; Di Spigna, G.; Capece, G.; Salzano, S.; Rossi, G. Sandblasted-acid-etched titanium surface influences in vitro the biological behavior of SaOS-2 human osteoblast-like cells. Dent. Mater. J. 2011, 30, 183–192. [Google Scholar] [CrossRef] [Green Version]
- Feller, L.; Jadwat, Y.; Khammissa, R.A.; Meyerov, R.; Schechter, I.; Lemmer, J. Cellular responses evoked by different surface characteristics of intraosseous titanium implants. BioMed Res. Int. 2015, 2015, 171945. [Google Scholar] [CrossRef] [Green Version]
- Khalili, A.A.; Ahmad, M.R. A Review of Cell Adhesion Studies for Biomedical and Biological Applications. Int. J. Mol. Sci. 2015, 16, 18149–18184. [Google Scholar] [CrossRef] [Green Version]
- Gallant, N.D.; Michael, K.E.; Garcia, A.J. Cell adhesion strengthening: Contributions of adhesive area, integrin binding, and focal adhesion assembly. Mol. Biol. Cell 2005, 16, 4329–4340. [Google Scholar] [CrossRef]
- Garcia, A.J.; Boettiger, D. Integrin-fibronectin interactions at the cell-material interface: Initial integrin binding and signaling. Biomaterials 1999, 20, 2427–2433. [Google Scholar] [CrossRef]
- Bhatavadekar, N.B.; Gharpure, A.S.; Balasubramanium, N.; Scheyer, E.T. In Vitro Surface Testing Methods for Dental Implants-Interpretation and Clinical Relevance: A Review. Compend. Contin. Educ. Dent. 2020, 41, e1–e9. [Google Scholar]
- Diomede, F.; D’Aurora, M.; Gugliandolo, A.; Merciaro, I.; Orsini, T.; Gatta, V.; Piattelli, A.; Trubiani, O.; Mazzon, E. Biofunctionalized Scaffold in Bone Tissue Repair. Int. J. Mol. Sci. 2018, 19, 1022. [Google Scholar] [CrossRef] [Green Version]
- Pizzicannella, J.; Diomede, F.; Gugliandolo, A.; Chiricosta, L.; Bramanti, P.; Merciaro, I.; Orsini, T.; Mazzon, E.; Trubiani, O. 3D Printing PLA/Gingival Stem Cells/ EVs Upregulate miR-2861 and-210 during Osteoangiogenesis Commitment. Int. J. Mol. Sci. 2019, 20, 3256. [Google Scholar] [CrossRef] [Green Version]
- Diomede, F.; Marconi, G.D.; Cavalcanti, M.; Pizzicannella, J.; Pierdomenico, S.D.; Fonticoli, L.; Piattelli, A.; Trubiani, O. VEGF/VEGF-R/RUNX2 Upregulation in Human Periodontal Ligament Stem Cells Seeded on Dual Acid Etched Titanium Disk. Materials 2020, 13, 706. [Google Scholar] [CrossRef] [Green Version]
- Gugliandolo, A.; Diomede, F.; Cardelli, P.; Bramanti, A.; Scionti, D.; Bramanti, P.; Trubiani, O.; Mazzon, E. Transcriptomic analysis of gingival mesenchymal stem cells cultured on 3D bioprinted scaffold: A promising strategy for neuroregeneration. J. Biomed. Mater. Res. Part. A 2018, 106, 126–137. [Google Scholar] [CrossRef]
- Diomede, F.; Zini, N.; Pizzicannella, J.; Merciaro, I.; Pizzicannella, G.; D’Orazio, M.; Piattelli, A.; Trubiani, O. 5-Aza Exposure Improves Reprogramming Process Through Embryoid Body Formation in Human Gingival Stem Cells. Front. Genet. 2018, 9, 419. [Google Scholar] [CrossRef] [Green Version]
- Pizzicannella, J.; Cavalcanti, M.; Trubiani, O.; Diomede, F. MicroRNA 210 Mediates VEGF Upregulation in Human Periodontal Ligament Stem Cells Cultured on 3DHydroxyapatite Ceramic Scaffold. Int. J. Mol. Sci. 2018, 19, 3916. [Google Scholar] [CrossRef] [Green Version]
- Mazzatenta, A.; Marconi, G.D.; Zara, S.; Cataldi, A.; Porzionato, A.; Di Giulio, C. In the carotid body, galanin is a signal for neurogenesis in young, and for neurodegeneration in the old and in drug-addicted subjects. Front. Physiol. 2014, 5, 427. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Albrektsson, T.; Jacobsson, M. Bone-metal interface in osseointegration. J. Prosthet. Dent. 1987, 57, 597–607. [Google Scholar] [CrossRef]
- Junker, R.; Dimakis, A.; Thoneick, M.; Jansen, J.A. Effects of implant surface coatings and composition on bone integration: A systematic review. Clin. Oral Implant. Res. 2009, 20 (Suppl. 4), 185–206. [Google Scholar] [CrossRef]
- Le Guehennec, L.; Soueidan, A.; Layrolle, P.; Amouriq, Y. Surface treatments of titanium dental implants for rapid osseointegration. Dent. Mater. Off. Publ. Acad. Dent. Mater. 2007, 23, 844–854. [Google Scholar] [CrossRef]
- Coelho, P.G.; Jimbo, R.; Tovar, N.; Bonfante, E.A. Osseointegration: Hierarchical designing encompassing the macrometer, micrometer, and nanometer length scales. Dent. Mater. 2015, 31, 37–52. [Google Scholar] [CrossRef]
- Li, D.; Ferguson, S.J.; Beutler, T.; Cochran, D.L.; Sittig, C.; Hirt, H.P.; Buser, D. Biomechanical comparison of the sandblasted and acid-etched and the machined and acid-etched titanium surface for dental implants. J. Biomed. Mater. Res. 2002, 60, 325–332. [Google Scholar] [CrossRef]
- Cervino, G.; Fiorillo, L.; Iannello, G.; Santonocito, D.; Risitano, G.; Cicciu, M. Sandblasted and Acid Etched Titanium Dental Implant Surfaces Systematic Review and Confocal Microscopy Evaluation. Materials (Basel) 2019, 12, 1763. [Google Scholar] [CrossRef] [Green Version]
- Velasco-Ortega, E.; Ortiz-Garcia, I.; Jimenez-Guerra, A.; Monsalve-Guil, L.; Munoz-Guzon, F.; Perez, R.A.; Gil, F.J. Comparison between Sandblasted Acid-Etched and Oxidized Titanium Dental Implants: In Vivo Study. Int. J. Mol. Sci. 2019, 20, 3267. [Google Scholar] [CrossRef] [Green Version]
- Zizzari, V.L.; Marconi, G.D.; De Colli, M.; Zara, S.; Zavan, B.; Salini, V.; Fontana, A.; Cataldi, A.; Piattelli, A. In Vitro Behavior of Primary Human Osteoblasts Onto Microrough Titanium Surface. Implant. Dent. 2015, 24, 377–383. [Google Scholar] [CrossRef] [Green Version]
- Feng, B.; Weng, J.; Yang, B.C.; Qu, S.X.; Zhang, X.D. Characterization of surface oxide films on titanium and adhesion of osteoblast. Biomaterials 2003, 24, 4663–4670. [Google Scholar] [CrossRef]
- Manescu, A.; Giuliani, A.; Mohammadi, S.; Tromba, G.; Mazzoni, S.; Diomede, F.; Zini, N.; Piattelli, A.; Trubiani, O. Osteogenic potential of dualblocks cultured with human periodontal ligament stem cells: In vitro and synchrotron microtomography study. J. Periodontal Res. 2016, 51, 112–124. [Google Scholar] [CrossRef] [PubMed]
- Marconi, G.D.; Fonticoli, L.; Guarnieri, S.; Cavalcanti, M.F.X.B.; Franchi, S.; Gatta, V.; Trubiani, O.; Pizzicannella, J.; Diomede, F. Ascorbic Acid: A New Player of Epigenetic Regulation in LPS-gingivalis Treated Human Periodontal Ligament Stem Cells. Oxidative Med. Cell. Longev. 2021, 2021, 6679708. [Google Scholar] [CrossRef] [PubMed]
- Gugliandolo, A.; Fonticoli, L.; Trubiani, O.; Rajan, T.S.; Marconi, G.D.; Bramanti, P.; Mazzon, E.; Pizzicannella, J.; Diomede, F. Oral Bone Tissue Regeneration: Mesenchymal Stem Cells, Secretome, and Biomaterials. Int. J. Mol. Sci. 2021, 22, 5236. [Google Scholar] [CrossRef]
- Shekaran, A.; Garcia, A.J. Extracellular matrix-mimetic adhesive biomaterials for bone repair. J. Biomed. Mater. Res. Part A 2011, 96A, 261–272. [Google Scholar] [CrossRef] [Green Version]
- Jung, S.; Bohner, L.; Hanisch, M.; Kleinheinz, J.; Sielker, S. Influence of Implant Material and Surface on Mode and Strength of Cell/Matrix Attachment of Human Adipose Derived Stromal Cell. Int. J. Mol. Sci. 2020, 21, 4110. [Google Scholar] [CrossRef]
- Rosset, E.M.; Bradshaw, A.D. SPARC/osteonectin in mineralized tissue. Matrix Biol.: J. Int. Soc. Matrix Biol. 2016, 52–54, 78–87. [Google Scholar] [CrossRef] [Green Version]
- Kramer, P.R.; JanikKeith, A.; Cai, Z.; Ma, S.; Watanabe, I. Integrin mediated attachment of periodontal ligament to titanium surfaces. Dent. Mater. 2009, 25, 877–883. [Google Scholar] [CrossRef]
- Hamidouche, Z.; Fromigue, O.; Ringe, J.; Haupl, T.; Vaudin, P.; Pages, J.C.; Srouji, S.; Livne, E.; Marie, P.J. Priming integrin alpha5 promotes human mesenchymal stromal cell osteoblast differentiation and osteogenesis. Proc. Natl. Acad. Sci. USA 2009, 106, 18587–18591. [Google Scholar] [CrossRef] [Green Version]





| Gene | Forward Primer Sequence (5-3) | Reverse Primer Sequence (5-3) |
|---|---|---|
| RUNX2 | CTTCACAAATCCTCCCCAAGT | AGGCGGTCAGAGAACAAAC |
| VIM | CAAGACCTGCTCAATGTTAAGATG | GTGAATCCAGATTAGTTTCCCTCA |
| FN1 | CGTCCTAAAGACTCCATGATCTG | ACCAATCTTGTAGGACTGACC |
| CDH2 | GTTTGCCAGTGTGACTCCA | CATACCACAAACATCAGCACAAG |
| LAMB1 | TTG GAG CAA ATG TAG TGA CCA | CTA CTG TAT CGT CAG CCA CTT G |
| ITGA5 | ACCAACAAGAGAGCCAAAGTC | TTGTACACAGCCTCACACTG |
| ITGB1 | GTAGCAAAGGAACAGCAGAGA | GGTCAATGGGATAGTCTTCAGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Marconi, G.D.; Fonticoli, L.; Della Rocca, Y.; Oliva, S.; Rajan, T.S.; Trubiani, O.; Murmura, G.; Diomede, F.; Pizzicannella, J. Enhanced Extracellular Matrix Deposition on Titanium Implant Surfaces: Cellular and Molecular Evidences. Biomedicines 2021, 9, 1710. https://doi.org/10.3390/biomedicines9111710
Marconi GD, Fonticoli L, Della Rocca Y, Oliva S, Rajan TS, Trubiani O, Murmura G, Diomede F, Pizzicannella J. Enhanced Extracellular Matrix Deposition on Titanium Implant Surfaces: Cellular and Molecular Evidences. Biomedicines. 2021; 9(11):1710. https://doi.org/10.3390/biomedicines9111710
Chicago/Turabian StyleMarconi, Guya Diletta, Luigia Fonticoli, Ylenia Della Rocca, Stefano Oliva, Thangavelu Soundara Rajan, Oriana Trubiani, Giovanna Murmura, Francesca Diomede, and Jacopo Pizzicannella. 2021. "Enhanced Extracellular Matrix Deposition on Titanium Implant Surfaces: Cellular and Molecular Evidences" Biomedicines 9, no. 11: 1710. https://doi.org/10.3390/biomedicines9111710
APA StyleMarconi, G. D., Fonticoli, L., Della Rocca, Y., Oliva, S., Rajan, T. S., Trubiani, O., Murmura, G., Diomede, F., & Pizzicannella, J. (2021). Enhanced Extracellular Matrix Deposition on Titanium Implant Surfaces: Cellular and Molecular Evidences. Biomedicines, 9(11), 1710. https://doi.org/10.3390/biomedicines9111710

