Regulation of Butyrate-Induced Resistance through AMPK Signaling Pathway in Human Colon Cancer Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Cell Culture and Establishment of Butyrate-Resistant Colon Cancer Cells
2.3. Cell Proliferation Assay
2.4. Flow Cytometry
2.5. Immunofluorescence Analysis
2.6. RNA Extraction and Reverse Transcription
2.7. Quantitative Real-Time Reverse Transcription PCR
2.8. Protein Isolation and Immunoblot Analysis
2.9. Statistical Analysis
3. Results
3.1. Resistance to the Cell Proliferation of BR Colon Cancer Cells
3.2. Effects of Butyrate Resistance on Drug Efflux Pumps
3.3. Effects of Butyrate Resistance on the Cell Cycle Progression
3.4. Effect of Butyrate Resistance on the Induction of Autophagy
3.5. Effects of Butyrate Resistance on the AMPK Signaling Pathway
3.6. Activation of AMPK in BR Colon Cancer Cells
3.7. Effects of Butyrate Resistance on Enzymes Involved in the Fatty Acid Metabolism
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Shackelford, D.B.; Shaw, R.J. The LKB1–AMPK pathway: Metabolism and growth control in tumour suppression. Nat. Rev. Cancer 2009, 9, 563–575. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rattan, R.; Giri, S.; Singh, A.K.; Singh, I. 5-Aminoimidazole-4-carboxamide-1-β-D-ribofuranoside Inhibits Cancer Cell Proliferation in Vitro and in Vivo via AMP-activated Protein Kinase. J. Biol. Chem. 2005, 280, 39582–39593. [Google Scholar] [CrossRef] [Scilit]
- Luo, Z.; Saha, A.K.; Xiang, X.; Ruderman, N.B. AMPK, the metabolic syndrome and cancer. Trends Pharmacol. Sci. 2005, 26, 69–76. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Wang, N.; Liu, P.; Xie, X. AMPK and Cancer. AMP Act. Protein Kinase 2016, 107, 203–226. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Liu, P.; Chen, Q.; Deng, S.; Liu, X.; Situ, H.; Zhong, S.; Hann, S.; Lin, Y. Targeting AMPK Signaling Pathway to Overcome Drug Resistance for Cancer Therapy. Curr. Drug Targets 2016, 17, 853–864. [Google Scholar] [CrossRef] [Scilit]
- Pérez-Hernández, M.; Arias, A.; Martínez-García, D.; Pérez-Tomás, R.; Quesada, R.; Soto-Cerrato, V. Targeting Autophagy for Cancer Treatment and Tumor Chemosensitization. Cancers 2019, 11, 1599. [Google Scholar] [CrossRef] [Scilit]
- Bhutia, S.K.; Mukhopadhyay, S.; Sinha, N.; Das, D.N.; Panda, P.K.; Patra, S.K.; Maiti, T.K.; Mandal, M.; Dent, P.; Wang, X.-Y.; et al. Autophagy: Cancer’s friend or foe? Adv. Cancer Res. 2013, 118, 61–95. [Google Scholar] [CrossRef] [Scilit]
- White, E. The role for autophagy in cancer. J. Clin. Investig. 2015, 125, 42–46. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Zhou, Y.; Li, Y.; Yang, L.; Ma, Y.; Peng, X.; Yang, S.; Liu, J.; Li, H. Autophagy: A novel mecha. nism of chemoresistance in cancers. Biomed. Pharmacother. 2019, 119, 109415. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Panda, P.K.; Mukhopadhyay, S.; Das, D.N.; Sinha, N.; Naik, P.P.; Bhutia, S.K. Mechanism of autophagic regulation in carcinogenesis and cancer therapeutics. Semin. Cell Dev. Biol. 2015, 39, 43–55. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nyfeler, B.; Eng, C.H. Revisiting autophagy addiction of tumor cells. Autophagy 2016, 12, 1206–1207. [Google Scholar] [CrossRef] [Scilit]
- Kwon, Y.; Kim, M.; Jung, H.S.; Kim, Y.; Jeoung, D. Targeting Autophagy for Overcoming Resistance to Anti-EGFR Treatments. Cancers 2019, 11, 1374. [Google Scholar] [CrossRef] [Scilit]
- Bertotti, A.; Sassi, F. Molecular Pathways: Sensitivity and Resistance to Anti-EGFR Antibodies. Clin. Cancer Res. 2015, 21, 3377–3383. [Google Scholar] [CrossRef] [Scilit]
- Beyer-Sehlmeyer, G.; Glei, M.; Hartmann, E.; Hughes, R.; Persin, C.; Böhm, V.; Schubert, R.; Jahreis, G.; Pool-Zobel, B.L. Butyrate is only one of several growth inhibitors produced during gut flora-mediated fermentation of dietary fibre sources. Br. J. Nutr. 2003, 90, 1057–1070. [Google Scholar] [CrossRef] [Scilit]
- Blouin, J.-M.; Penot, G.; Collinet, M.; Nacfer, M.; Forest, C.; Laurent-Puig, P.; Coumoul, X.; Barouki, R.; Benelli, C.; Bortoli, S. Butyrate elicits a metabolic switch in human colon cancer cells by targeting the pyruvate dehydrogenase complex. Int. J. Cancer 2010, 128, 2591–2601. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.; Yi, M.; Zha, L.; Chen, S.; Li, Z.; Li, C.; Gong, M.; Deng, H.; Chu, X.; Chen, J.; et al. Sodium butyrate induces endo plasmic reticulum stress and autophagy in colorectal cells: Implications for apoptosis. PLoS ONE 2016, 11, e0147218. [Google Scholar] [CrossRef] [Scilit]
- de Silanes, I.L.; Olmo, N.; Turnay, J.; de Buitrago, G.G.; Pérez-Ramos, P.; Guzmán-Aránguez, A.; García-Díez, M.; Lecona, E.; Gorospe, M.; Lizarbe, M.A. Acquisition of resistance to butyrate enhances survival after stress and induces malignancy of human colon carcinoma cells. Cancer Res. 2004, 64, 4593–4600. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kang, H.R.; Choi, H.G.; Jeon, C.K.; Lim, S.-J.; Kim, S.H. Butyrate-mediated acquisition of chemoresistance by human colon cancer cells. Oncol. Rep. 2016, 36, 1119–1126. [Google Scholar] [CrossRef] [Scilit]
- Barrasa, J.I.; Santiago-Gómez, A.; Olmo, N.; Lizarbe, M.A.; Turnay, J. Resistance to butyrate impairs bile acid-induced apoptosis in human colon adenocarcinoma cells via up-regulation of Bcl-2 and inactivation of Bax. Biochim. Biophys. Acta Mol. Cell Res. 2012, 1823, 2201–2209. [Google Scholar] [CrossRef] [Scilit]
- Derjuga, A.; Richard, C.; Crosato, M.; Wright, P.S.; Chalifour, L.; Valdez, J.; Barraso, A.; Crissman, H.A.; Nishioka, W.; Bradbury, E.M.; et al. Expression of p21Waf1/Cip1 and Cyclin D1 Is Increased in Butyrate-resistant HeLa Cells. J. Biol. Chem. 2001, 276, 37815–37820. [Google Scholar] [CrossRef] [Scilit]
- Bae, S.H.; Park, J.H.; Choi, H.G.; Kim, H.; Kim, S.H. Imidazole Antifungal Drugs Inhibit the Cell Proliferation and Invasion of Human Breast Cancer Cells. Biomol. Ther. 2018, 26, 494–502. [Google Scholar] [CrossRef] [Scilit]
- Chen, G.; Kim, S.H.; King, A.N.; Zhao, L.; Simpson, R.U.; Christensen, P.J.; Wang, Z.; Thomas, D.G.; Giordano, T.J.; Lin, L.; et al. CYP24A1 is an independent prognostic marker of survival in patients with lung adenocarcinoma. Clin. Cancer Res. 2011, 17, 817–826. [Google Scholar] [CrossRef] [Scilit]
- Ramnath, N.; Nadal, E.; Jeon, C.K.; Sandoval, J.; Colacino, J.; Rozek, L.S.; Christensen, P.J.; Esteller, M.; Beer, D.G.; Kim, S.H. Epigenetic Regulation of Vitamin D Metabolism in Human Lung Adenocarcinoma. J. Thorac. Oncol. 2014, 9, 473–482. [Google Scholar] [CrossRef] [Scilit]
- Gonçalves, P.; Martel, F. Butyrate and Colorectal Cancer: The Role of Butyrate Transport. Curr. Drug Metab. 2013, 14, 994–1008. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meyer, G.; Czompa, A.; Reboul, C.; Csepanyi, E.; Czegledi, A.; Bak, I.; Balla, G.; Balla, J.; Tosaki, A.; Lekli, I. The Cellular Autophagy Markers Beclin-1 and LC3B-II are increased during Reperfusion in Fibrillated Mouse Hearts. Curr. Pharm. Des. 2013, 19, 6912–6918. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bjørkøy, G.; Lamark, T.; Pankiv, S.; Øvervatn, A.; Brech, A.; Johansen, T. Monitoring autophagic degradation of p62/SQSTM1. Methods Enzymol. 2009, 452, 181–197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mathew, R.; Karp, C.M.; Beaudoin, B.; Vuong, N.; Chen, G.; Chen, H.-Y.; Bray, K.; Reddy, A.; Bhanot, G.; Gelinas, C.; et al. Autophagy Suppresses Tumorigenesis through Elimination of p62. Cell 2009, 137, 1062–1075. [Google Scholar] [CrossRef] [Scilit]
- Zhao, L.; Bin, S.; He, H.-L.; Yang, J.-M.; Pu, Y.-C.; Gao, C.-H.; Wang, H.; Wang, B.-L. Sodium butyrate increases P-gp expression in lung cancer by upregulation of STAT3 and mRNA stabilization of ABCB1. Anticancer Drugs 2018, 29, 227–233. [Google Scholar] [CrossRef] [Scilit]
- Xie, Q.-S.; Zhang, J.-X.; Liu, M.; Liu, P.-H.; Wang, Z.-J.; Zhu, L.; Jiang, L.; Jin, M.-M.; Liu, X.-N.; Liu, L. Short-chain fatty acids exert opposite effects on the expression and function of p-glycoprotein and breast cancer resistance protein in rat intestine. Acta Pharmacol. Sin. 2020, 42, 470–481. [Google Scholar] [CrossRef] [Scilit]
- Talukdar, S.; Pradhan, A.K.; Bhoopathi, P.; Shen, X.-N.; August, L.A.; Windle, J.J.; Sarkar, D.; Furnari, F.B.; Cavenee, W.K.; Das, S.K.; et al. Regulation of protective autophagy in anoikis-resistant glioma stem cells by SDCBP/MDA-9/Syntenin. Autophagy 2018, 14, 1845–1846. [Google Scholar] [CrossRef] [Scilit]
- Talukdar, S.; Pradhan, A.K.; Bhoopathi, P.; Shen, X.-N.; August, L.A.; Windle, J.J.; Sarkar, D.; Furnari, F.B.; Cavenee, W.K.; Das, S.K.; et al. MDA-9/Syntenin regulates protective autophagy in anoikis-resistant glioma stem cells. Proc. Natl. Acad. Sci. USA 2018, 115, 5768–5773. [Google Scholar] [CrossRef] [Scilit]
- Xiang, H.; Zhang, J.; Lin, C.; Zhang, L.; Liu, B.; Ouyang, L. Targeting autophagy-related protein kinases for potential therapeutic purpose. Acta Pharm. Sin. B 2019, 10, 569–581. [Google Scholar] [CrossRef] [Scilit]
- Sui, X.; Chen, R.; Wang, Z.; Huang, Z.; Kong, N.; Zhang, M.; Han, W.; Lou, F.; Yang, J.; Zhang, Q.; et al. Autophagy and chemotherapy resistance: A promising therapeutic target for cancer treatment. Cell Death Dis. 2013, 4, e838. [Google Scholar] [CrossRef] [Scilit]
- Sobhakumari, A.; Schickling, B.; Love-Homan, L.; Raeburn, A.; Fletcher, E.V.; Case, A.; Domann, F.; Miller, F.J.; Simons, A.L. NOX4 mediates cytoprotective autophagy induced by the EGFR inhibitor erlotinib in head and neck cancer cells. Toxicol. Appl. Pharmacol. 2013, 272, 736–745. [Google Scholar] [CrossRef] [Scilit]
- Zhai, B.; Hu, F.; Jiang, X.; Xu, J.; Zhao, D.; Liu, B.; Pan, S.; Dong, X.; Tan, G.; Wei, Z.; et al. Inhibition of Akt Reverses the Acquired Resistance to Sorafenib by Switching Protective Autophagy to Autophagic Cell Death in Hepatocellular Carcinoma. Mol. Cancer Ther. 2014, 13, 1589–1598. [Google Scholar] [CrossRef] [Scilit]
- Han, F.; Li, C.-F.; Cai, Z.; Zhang, X.; Jin, G.; Zhang, W.-N.; Xu, C.; Wang, C.-Y.; Morrow, J.; Zhang, S.; et al. The critical role of AMPK in driving Akt activation under stress, tumorigenesis and drug resistance. Nat. Commun. 2018, 9, 4728. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, X.; Cheng, C.; Tan, Z.; Li, N.; Tang, M.; Yang, L.; Cao, Y. Emerging roles of lipid metabolism in cancer metastasis. Mol. Cancer 2017, 16, 76. [Google Scholar] [CrossRef] [Scilit]
- Luo, J.; Hong, Y.; Lu, Y.; Qiu, S.; Chaganty, B.K.; Zhang, L.; Wang, X.; Li, Q.; Fan, Z. Acetyl-CoA carboxylase rewires cancer metabolism to allow cancer cells to survive inhibition of the Warburg effect by cetuximab. Cancer Lett. 2016, 384, 39–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, Y.; Bollu, L.; Tozzi, F.; Ye, X.; Bhattacharya, R.; Gao, G.; Dupre, E.; Xia, L.; Lu, J.; Fan, F.; et al. ATP Citrate Lyase Mediates Resistance of Colorectal Cancer Cells to SN38. Mol. Cancer Ther. 2013, 12, 2782–2791. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, H.; Liu, Y.; Zhang, J.-T. A new mechanism of drug resistance in breast cancer cells: Fatty acid synthase overexpression-mediated palmitate overproduction. Mol. Cancer Ther. 2008, 7, 263–270. [Google Scholar] [CrossRef] [Scilit]








| Gene | Forward Primer (5′→3′) | Reverse Primer (5′→3′) |
|---|---|---|
| CPT1A | ATCAATCGGACTCTGGAAACGG | TCAGGGAGTAGCGCATGGT |
| LCAD | TGCAATAGCAATGACAGAGCC | CGCAACTACAATCACAACATCAC |
| SCAD | CGGCAGTTACACACCATCTAC | GCAATGGGAAACAACTCCTTCTC |
| ACC | CTCCTGCTCATCACAGTATG | GCAAGGCTACTAAGGCAGG |
| ACLY | TCCAGGAGTCAAAATGATTGTG | ATCTCTCCAAGCTCATCAAAGC |
| FASN | CTTCCGAGATTCCATCCTACGC | TGGCAGTCAGGCTACACAAACG |
| GAPDH | TTCGACAGTCAGCCGCATCTTCT | AGGCGCCCAATACGACCAAATC |
| Drugs | HCT116 | HT29 | SW480 | |||
|---|---|---|---|---|---|---|
| PT | BR | PT | BR | PT | BR | |
| Sodium butyrate (mM) | 4.911.39 | 74.54.36 *** | 2.390.146 | 33.513.3 *** | 4.010.481 | 24.40.805 *** |
| Oxaliplatin (µM) | 3.830.591 | 20.00.679 *** | 11.42.72 | 54.20.905 ** | 5.091.94 | 40.70.418 *** |
| Doxorubicin (nM) | 44.35.83 | 15136.8 ** | 2960.283 | 10363.54 ** | 36.88.21 | 1704.78 *** |
| 5-Fluorouracil (µM) | 4.430.934 | 15.10.721 *** | 14.31.27 | 52.06.24 *** | 4.780.865 | 13.91.28 *** |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yoo, H.Y.; Park, S.Y.; Chang, S.-Y.; Kim, S.H. Regulation of Butyrate-Induced Resistance through AMPK Signaling Pathway in Human Colon Cancer Cells. Biomedicines 2021, 9, 1604. https://doi.org/10.3390/biomedicines9111604
Yoo HY, Park SY, Chang S-Y, Kim SH. Regulation of Butyrate-Induced Resistance through AMPK Signaling Pathway in Human Colon Cancer Cells. Biomedicines. 2021; 9(11):1604. https://doi.org/10.3390/biomedicines9111604
Chicago/Turabian StyleYoo, Hee Young, So Yeon Park, Sun-Young Chang, and So Hee Kim. 2021. "Regulation of Butyrate-Induced Resistance through AMPK Signaling Pathway in Human Colon Cancer Cells" Biomedicines 9, no. 11: 1604. https://doi.org/10.3390/biomedicines9111604
APA StyleYoo, H. Y., Park, S. Y., Chang, S.-Y., & Kim, S. H. (2021). Regulation of Butyrate-Induced Resistance through AMPK Signaling Pathway in Human Colon Cancer Cells. Biomedicines, 9(11), 1604. https://doi.org/10.3390/biomedicines9111604

