LmjF.22.0810 from Leishmania major Modulates the Th2-Type Immune Response and Is Involved in Leishmaniasis Outcome
Abstract
1. Introduction
2. Materials and Methods
2.1. Parasites and Animals
2.2. Generation of the Transgenic L. major Strains
2.3. In Vitro Peritoneal Exudate Macrophage (PEM) Infections
2.4. L. major Amastigote RNA Retrieval
2.5. L. major In Vivo Infections
2.6. RNA Extraction and Gene Expression Analysis
2.7. Leishmania major Quantification
2.8. Histological Analysis and Immunohistochemistry Studies
2.9. Statistical Analyses
3. Results
3.1. LmjF.22.0810 Overexpression Conferred to Parasites Lower Infectivity In Vitro
3.2. LmJ3OE Parasites Displayed Altered Expression of Genes Implicated in Infectivity
3.3. LmjF.22.0810 Overexpressing Parasites Were Less Virulent In Vivo
3.4. LmjF.22.0810-Overexpressing Parasites Displayed an Impairment of Th2 Immune Response
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- TDR | World Health Organization Home Page. Available online: https://www.who.int/tdr/en/ (accessed on 13 November 2019).
- Didwania, N.; Shadab, M.; Sabur, A.; Ali, N. Alternative to Chemotherapy-The Unmet Demand against Leishmaniasis. Front. Immunol. 2017, 8, 1779. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khamesipour, A.; Rafati, S.; Davoudi, N.; Maboudi, F.; Modabber, F. Leishmaniasis vaccine candidates for development: A global overview. Indianj. Med. Res. 2006, 123, 423–438. [Google Scholar]
- Okwor, I.; Mou, Z.; Liu, D.; Uzonna, J. Protective immunity and vaccination against cutaneous leishmaniasis. Front. Immunol. 2012, 3, 128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nadim, A.; Javadian, E.; Mohebali, M. The experience of leishmanization in the Islamic Republic of Iran. East. Mediterr. Health J. 1997, 3, 284–289. [Google Scholar]
- Olivier, M.; Gregory, D.J.; Forget, G. Subversion mechanisms by which Leishmania parasites can escape the host immune response: A signaling point of view. Clin. Microbiol. Rev. 2005, 18, 293–305. [Google Scholar] [CrossRef] [Scilit]
- Bhattacharya, P.; Dey, R.; Dagur, P.K.; Kruhlak, M.; Ismail, N.; Debrabant, A.; Joshi, A.B.; Akue, A.; Kukuruga, M.; Takeda, K.; et al. Genetically Modified Live Attenuated Leishmania donovani Parasites Induce Innate Immunity through Classical Activation of Macrophages That Direct the Th1 Response in Mice. Infect. Immun. 2015, 83, 3800–3815. [Google Scholar] [CrossRef] [Scilit]
- Reiner, S.L.; Locksley, R.M. The regulation of immunity to Leishmania major. Annu. Rev. Immunol. 1995, 13, 151–177. [Google Scholar] [CrossRef]
- Rath, M.; Muller, I.; Kropf, P.; Closs, E.I.; Munder, M. Metabolism via Arginase or Nitric Oxide Synthase: Two Competing Arginine Pathways in Macrophages. Front. Immunol. 2014, 5, 532. [Google Scholar] [CrossRef] [Scilit]
- Chandra, D.; Naik, S. Leishmania donovani infection down-regulates TLR2-stimulated IL-12p40 and activates IL-10 in cells of macrophage/monocytic lineage by modulating MAPK pathways through a contact-dependent mechanism. Clin. Exp. Immunol. 2008, 154, 224–234. [Google Scholar] [CrossRef] [Scilit]
- Alexander, J.; Brombacher, F. T helper1/t helper2 cells and resistance/susceptibility to leishmania infection: Is this paradigm still relevant? Front. Immunol. 2012, 3, 80. [Google Scholar] [CrossRef] [Scilit]
- Barral, A.; Teixeira, M.; Reis, P.; Vinhas, V.; Costa, J.; Lessa, H.; Bittencourt, A.L.; Reed, S.; Carvalho, E.M.; Barral-Netto, M. Transforming growth factor-beta in human cutaneous leishmaniasis. Am. J. Pathol. 1995, 147, 947–954. [Google Scholar] [PubMed]
- Cheekatla, S.S.; Aggarwal, A.; Naik, S. mTOR signaling pathway regulates the IL-12/IL-10 axis in Leishmania donovani infection. Med. Microbiol. Immunol. 2012, 201, 37–46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jaramillo, M.; Gomez, M.A.; Larsson, O.; Shio, M.T.; Topisirovic, I.; Contreras, I.; Luxenburg, R.; Rosenfeld, A.; Colina, R.; McMaster, R.W.; et al. Leishmania repression of host translation through mTOR cleavage is required for parasite survival and infection. Cell Host Microbe 2011, 9, 331–341. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brittingham, A.; Morrison, C.J.; McMaster, W.R.; McGwire, B.S.; Chang, K.P.; Mosser, D.M. Role of the Leishmania surface protease gp63 in complement fixation, cell adhesion, and resistance to complement-mediated lysis. J. Immunol. 1995, 155, 3102–3111. [Google Scholar] [CrossRef] [Scilit]
- Marth, T.; Kelsall, B.L. Regulation of interleukin-12 by complement receptor 3 signaling. J. Exp. Med. 1997, 185, 1987–1995. [Google Scholar] [CrossRef] [Scilit]
- Gupta, G.; Oghumu, S.; Satoskar, A.R. Mechanisms of immune evasion in leishmaniasis. Adv. Appl. Microbiol. 2013, 82, 155–184. [Google Scholar]
- Vacas, A.; Fernández-Rubio, C.; Algarabel, M.; Peña-Guerrero, J.; Larrea, E.; Rocha Formiga, F.; García-Sosa, A.T.; Nguewa, P.A. The Novel Serine/Threonine Protein Kinase LmjF.22.0810 from Leishmania major may be Involved in the Resistance to Drugs such as Paromomycin. Biomolecules 2019, 9, 723. [Google Scholar] [CrossRef] [Scilit]
- Bhandari, V.; Sundar, S.; Dujardin, J.C.; Salotra, P. Elucidation of cellular mechanisms involved in experimental paromomycin resistance in Leishmania donovani. Antimicrob. Agents Chemother. 2014, 58, 2580–2585. [Google Scholar] [CrossRef] [Scilit]
- Manzano, J.I.; Garcia-Hernandez, R.; Castanys, S.; Gamarro, F. A new ABC half-transporter in Leishmania major is involved in resistance to antimony. Antimicrob. Agents Chemother. 2013, 57, 3719–3730. [Google Scholar] [CrossRef] [Scilit]
- Al-Mohammed, H.I.; Chance, M.L.; Bates, P.A. Production and characterization of stable amphotericin-resistant amastigotes and promastigotes of Leishmania mexicana. Antimicrob. Agents Chemother. 2005, 49, 3274–3280. [Google Scholar] [CrossRef] [Scilit]
- Turner, K.G.; Vacchina, P.; Robles-Murguia, M.; Wadsworth, M.; McDowell, M.A.; Morales, M.A. Fitness and Phenotypic Characterization of Miltefosine-Resistant Leishmania major. PLoS Negl. Trop. Dis. 2015, 9, e0003948. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sacks, D.L.; Hieny, S.; Sher, A. Identification of cell surface carbohydrate and antigenic changes between noninfective and infective developmental stages of Leishmania major promastigotes. J. Immunol. 1985, 135, 564–569. [Google Scholar] [PubMed]
- Medina-Acosta, E.; Cross, G.A.M. Rapid isolation of DNA from trypanosomatid protozoa using a simple “mini-prep” procedure. Mol. Biochem. Parasitol. 1993, 59, 327–329. [Google Scholar] [CrossRef] [Scilit]
- Cruz, A.; Coburn, C.M.; Beverley, S.M. Double targeted gene replacement for creating null mutants. Proc. Natl. Acad. Sci. USA 1991, 88, 7170–7174. [Google Scholar] [CrossRef] [Scilit]
- Fernández-Rubio, C.; Larrea, E.; Guerrero, J.P.; Herrero, E.S.; Gamboa, I.; Berrio, C.; Plano, D.; Amin, S.; Sharma, A.K.; Nguewa, P.A. Leishmanicidal activity of isoselenocyanate derivatives. Antimicrob. Agents Chemother. 2019, 63, e00904–e00918. [Google Scholar] [CrossRef] [Scilit]
- Schwartz, J.; Moreno, E.; Calvo, A.; Blanco, L.; Fernández-Rubio, C.; Sanmartín, C.; Nguewa, P.; Irache, J.M.; Larrea, E.; Espuelas, S. Combination of paromomycin plus human anti-TNF-α antibodies to control the local inflammatory response in BALB/mice with cutaneous leishmaniasis lesions. J. Dermatol. Sci. 2018, 92, 78–88. [Google Scholar] [CrossRef] [Scilit]
- Fernandez-Rubio, C.; Campbell, D.; Vacas, A.; Ibanez, E.; Moreno, E.; Espuelas, S.; Calvo, A.; Palop, J.A.; Plano, D.; Sanmartin, C.; et al. Leishmanicidal activities of novel methylseleno-imidocarbamates. Antimicrob. Agents Chemother. 2015, 59, 5705–5713. [Google Scholar] [CrossRef] [Scilit]
- Moreno, E.; Schwartz, J.; Larrea, E.; Conde, I.; Font, M.; Sanmartin, C.; Irache, J.M.; Espuelas, S. Assessment of beta-lapachone loaded in lecithin-chitosan nanoparticles for the topical treatment of cutaneous leishmaniasis in L. major infected BALB/c mice. Nanomedicine 2015, 11, 2003–2012. [Google Scholar] [CrossRef] [Scilit]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [Scilit]
- Naula, C.; Parsons, M.; Mottram, J.C. Protein kinases as drug targets in trypanosomes and Leishmania. Proc. Biochim. Et Biophys. Acta Proteins Proteom. 2005, 1754, 151–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morales, M.A.; Watanabe, R.; Laurent, C.; Lenormand, P.; Rousselle, J.-C.; Namane, A.; Späth, G.F. Phosphoproteomic analysis of Leishmania donovani pro- and amastigote stages. Proteomics 2008, 8, 350–363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Varela-M., R.E.; Ochoa, R.; Muskus, C.E.; Muro, A.; Mollinedo, F. Identification of a RAC/AKT-like gene in Leishmania parasites as a putative therapeutic target in leishmaniasis. Parasit. Vectors 2017, 10, 458. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tirado-Duarte, D.; Marín-Villa, M.; Ochoa, R.; Blandón-Fuentes, G.; Soares, M.J.; Robledo, S.M.; Varela-Miranda, R.E. The Akt-like kinase of Leishmania panamensis: As a new molecular target for drug discovery. Acta Trop. 2018, 177, 171–178. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marshall, S.; Kelly, P.H.; Singh, B.K.; Pope, R.M.; Kim, P.; Zhanbolat, B.; Wilson, M.E.; Yao, C. Extracellular release of virulence factor major surface protease via exosomes in Leishmania infantum promastigotes. Parasit. Vectors 2018, 11, 355. [Google Scholar] [CrossRef] [Scilit]
- Olivier, M.; Atayde, V.D.; Isnard, A.; Hassani, K.; Shio, M.T. Leishmania virulence factors: Focus on the metalloprotease GP63. Microbes Infect. 2012, 14, 1377–1389. [Google Scholar] [CrossRef] [Scilit]
- Alcolea, P.J.; Alonso, A.; Molina, R.; Jiménez, M.; Myler, P.J.; Larraga, V. Functional genomics in sand fly–derived Leishmania promastigotes. PLoS Negl. Trop. Dis. 2019, 13, e0007288. [Google Scholar] [CrossRef] [Scilit]
- Lye, L.F.; Cunningham, M.L.; Beverley, S.M. Characterization of quinonoid-dihydropteridine reductase (QDPR) from the lower eukaryote Leishmania major. J. Biol. Chem. 2002, 277, 38245–38253. [Google Scholar] [CrossRef] [Scilit]
- Leprohon, P.; Légaré, D.; Girard, I.; Papadopoulou, B.; Ouellette, M. Modulation of Leishmania ABC protein gene expression through life stages and among drug-resistant parasites. Eukaryot. Cell 2006, 5, 1713–1725. [Google Scholar] [CrossRef] [Scilit]
- Coelho, A.C.; Messier, N.; Ouellette, M.; Cotrim, P.C. Role of the ABC transporter PRP1 (ABCC7) in pentamidine resistance in Leishmania amastigotes. Antimicrob. Agents Chemother. 2007, 51, 3030–3032. [Google Scholar] [CrossRef] [Scilit]
- Lieke, T.; Nylen, S.; Eidsmo, L.; McMaster, W.R.; Mohammadi, A.M.; Khamesipour, A.; Berg, L.; Akuffo, H. Leishmania surface protein gp63 binds directly to human natural killer cells and inhibits proliferation. Clin. Exp. Immunol. 2008, 153, 221–230. [Google Scholar] [CrossRef] [Scilit]
- Isnard, A.; Shio, M.T.; Olivier, M. Impact of Leishmania metalloprotease GP63 on macrophage signaling. Front. Cell. Infect. Microbiol. 2012, 2, 72. [Google Scholar] [CrossRef] [Scilit]
- Scott, P.; Novais, F.O. Cutaneous leishmaniasis: Immune responses in protection and pathogenesis. Nat. Rev. Immunol. 2016, 16, 581–592. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reithinger, R.; Dujardin, J.-C.; Louzir, H.; Pirmez, C.; Alexander, B.; Brooker, S. Cutaneous leishmaniasis. Lancet. Infect. Dis. 2007, 7, 581–596. [Google Scholar] [CrossRef] [Scilit]
- Himmelrich, H.; Launois, P.; Maillard, I.; Biedermann, T.; Tacchini-Cottier, F.; Locksley, R.M.; Rocken, M.; Louis, J.A. In BALB/c mice, IL-4 production during the initial phase of infection with Leishmania major is necessary and sufficient to instruct Th2 cell development resulting in progressive disease. J. Immunol. 2000, 164, 4819–4825. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tripathi, P.; Singh, V.; Naik, S. Immune response to leishmania: Paradox rather than paradigm. FEMS Immunol. Med. Microbiol. 2007, 51, 229–242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- da Silva Santos, C.; Brodskyn, C.I. The Role of CD4 and CD8 T Cells in Human Cutaneous Leishmaniasis. Front. Public Health 2014, 2, 165. [Google Scholar]
- Taslimi, Y.; Zahedifard, F.; Rafati, S. Leishmaniasis and various immunotherapeutic approaches. Parasitology 2018, 145, 497–507. [Google Scholar] [CrossRef] [Scilit]
- Kauffmann, F.; Meert, E.; de Jonge, K.; Elkrim, Y.; Hanot Mambres, D.; Denis, O.; Muraille, E.; Magez, S.; De Trez, C. STAT6 Mediates Footpad Immunopathology in the Absence of IL-12p40 Following Infection of Susceptible BALB/c Mice With Leishmania major. Front. Immunol. 2018, 9, 503. [Google Scholar] [CrossRef] [Scilit]
- Gonzalez-Lombana, C.; Gimblet, C.; Bacellar, O.; Oliveira, W.W.; Passos, S.; Carvalho, L.P.; Goldschmidt, M.; Carvalho, E.M.; Scott, P. IL-17 Mediates Immunopathology in the Absence of IL-10 Following Leishmania major Infection. PLoS Pathog. 2013, 9. [Google Scholar] [CrossRef] [Scilit]
- Padigel, U.M.; Farrell, J.P. Control of infection with Leishmania major in susceptible BALB/c mice lacking the common gamma-chain for FcR is associated with reduced production of IL-10 and TGF-beta by parasitized cells. J. Immunol. 2005, 174, 6340–6345. [Google Scholar] [CrossRef] [Scilit]
- Boussoffara, T.; Boubaker, M.S.; Ben Ahmed, M.; Mokni, M.; Feriani, S.; Ben Salah, A.; Louzir, H. Activated cytotoxic T cells within zoonotic cutaneous leishmaniasis lesions. Immun. Inflamm. Dis. 2019, 7, 95–104. [Google Scholar] [CrossRef] [Scilit]
- Badirzadeh, A.; Taheri, T.; Taslimi, Y.; Abdossamadi, Z.; Heidari-Kharaji, M.; Gholami, E.; Sedaghat, B.; Niyyati, M.; Rafati, S. Arginase activity in pathogenic and non-pathogenic species of Leishmania parasites. PLoS Negl. Trop. Dis. 2017, 11, e0005774. [Google Scholar] [CrossRef] [Scilit]
- Mortazavi, H.; Sadeghipour, P.; Taslimi, Y.; Habibzadeh, S.; Zali, F.; Zahedifard, F.; Rahmati, J.; Kamyab, K.; Ghandi, N.; Zamanian, A.; et al. Comparing acute and chronic human cutaneous leishmaniasis caused by Leishmania major and Leishmania tropica focusing on arginase activity. J. Eur. Acad. Dermatol. Venereol. 2016, 30, 2118–2121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Selvapandiyan, A.; Dey, R.; Nylen, S.; Duncan, R.; Sacks, D.; Nakhasi, H.L. Intracellular replication-deficient Leishmania donovani induces long lasting protective immunity against visceral leishmaniasis. J. Immunol. 2009, 183, 1813–1820. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Gene | Sense Primer (5′→ 3′) | Antisense Primer (5′→ 3′) |
|---|---|---|
| LmjF.22.0810 | cctccacagggaaagcaac | caatgcaccccatcgaccaa |
| GP63 | actgcccgtttgttatcgac | ccggcgtacgacttgactat |
| SHERP | gacgctctgcccttcacatac | tctctcagctctcggatcttgtc |
| QDPR | atgaaaaatgtactcctcatcg | ttcaccctgcgtactgaacacat |
| PRP1 | ctcatgcgtcagtgcaagtg | aaacaacgggcaaaaagcga |
| Lm18S | ccaaagtgtggagatcgaag | ggccggtaaaggccgaatag |
| GAPDH | accaccatccactcctaca | cgtgctcgggatgatgttta |
| Gene | Sense Primer (5′→ 3′) | Antisense Primer (5′→ 3′) |
|---|---|---|
| IL12p35 | cacgctacctcctctttttg | aggcaactctcgttcttgtg |
| IL10 | ggacaacatactgctaaccg | aatcactcttcacctgctcc |
| IL1β | gccaccttttgacagtgatg | taatgggaacgtcacacacc |
| ARG1 | tggggaaagccaatgaagag | aggagaaaggacacaggttg |
| IL4 | gctattgatgggtctcaacc | tctgtggtgttcttgttgc |
| TGFβ | cggcagctgtacattgac | tcagctgcacttgcaggagc |
| TNFα | cttccagaactccaggcggt | ggtttgctacgacgtggg |
| iNOS | tcctacaccacaccaaactg | aatctctgcctatccgtctc |
| β-actin | cgcgtccacccgcgag | cctggtgcctagggcg |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vacas, A.; Fernández-Rubio, C.; Larrea, E.; Peña-Guerrero, J.; Nguewa, P.A. LmjF.22.0810 from Leishmania major Modulates the Th2-Type Immune Response and Is Involved in Leishmaniasis Outcome. Biomedicines 2020, 8, 452. https://doi.org/10.3390/biomedicines8110452
Vacas A, Fernández-Rubio C, Larrea E, Peña-Guerrero J, Nguewa PA. LmjF.22.0810 from Leishmania major Modulates the Th2-Type Immune Response and Is Involved in Leishmaniasis Outcome. Biomedicines. 2020; 8(11):452. https://doi.org/10.3390/biomedicines8110452
Chicago/Turabian StyleVacas, Andrés, Celia Fernández-Rubio, Esther Larrea, José Peña-Guerrero, and Paul A. Nguewa. 2020. "LmjF.22.0810 from Leishmania major Modulates the Th2-Type Immune Response and Is Involved in Leishmaniasis Outcome" Biomedicines 8, no. 11: 452. https://doi.org/10.3390/biomedicines8110452
APA StyleVacas, A., Fernández-Rubio, C., Larrea, E., Peña-Guerrero, J., & Nguewa, P. A. (2020). LmjF.22.0810 from Leishmania major Modulates the Th2-Type Immune Response and Is Involved in Leishmaniasis Outcome. Biomedicines, 8(11), 452. https://doi.org/10.3390/biomedicines8110452

