Therapeutic Actions of Hepatocyte Extracellular Vesicles in a Murine Model of Diet-Induced Steatohepatitis with Fibrosis
Abstract
:1. Introduction
2. Materials and Methods
2.1. MASH Disease Model
2.2. Histology and Immunofluorescence
2.3. Liver Function Tests
2.4. Isolation and Characterization of EVs from HepG2 Cells
2.5. RNA Extraction and RT-qPCR
2.6. EV miR Sequencing
2.7. Statistical Analysis
3. Results
3.1. Establishment of MASLD Mouse Model
3.2. HepG2 EVs Ameliorate Fibrosis in MASLD Mice
3.3. HepG2 EVs Ameliorate Immune Cell Infiltration
3.4. HepG2 EVs Improve Liver Function
3.5. HepG2 EVs Are Therapeutic After Onset of MASLD
3.6. HepG2 EV miR Profiling
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rinella, M.E.; Lazarus, J.V.; Ratziu, V.; Francque, S.M.; Sanyal, A.J.; Kanwal, F.; Romero, D.; Abdelmalek, M.F.; Anstee, Q.M.; Arab, J.P.; et al. A multisociety Delphi consensus statement on new fatty liver disease nomenclature. J. Hepatol. 2023, 79, 1542–1556. [Google Scholar] [CrossRef] [PubMed]
- Machado, M.V.; Diehl, A.M. Pathogenesis of Nonalcoholic Steatohepatitis. Gastroenterology 2016, 150, 1769–1777. [Google Scholar] [CrossRef] [PubMed]
- Diehl, A.M.; Day, C. Cause, Pathogenesis, and Treatment of Nonalcoholic Steatohepatitis. N. Engl. J. Med. 2017, 377, 2063–2072. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, A.; Diehl, A.M. Nonalcoholic Steatohepatitis. Annu. Rev. Med. 2017, 68, 85–98. [Google Scholar] [CrossRef]
- Kingwell, K. NASH field celebrates ‘hurrah moment’ with a first FDA drug approval for the liver disease. Nat. Rev. Drug Discov. 2024, 23, 235–237. [Google Scholar] [CrossRef] [PubMed]
- Angulo, P.; Kleiner, D.E.; Dam-Larsen, S.; Adams, L.A.; Bjornsson, E.S.; Charatcharoenwitthaya, P.; Mills, P.R.; Keach, J.C.; Lafferty, H.D.; Stahler, A.; et al. Liver Fibrosis, but No Other Histologic Features, Is Associated with Long-term Outcomes of Patients with Nonalcoholic Fatty Liver Disease. Gastroenterology 2015, 149, 389–397.e10. [Google Scholar] [CrossRef] [PubMed]
- Hansen, H.H.; HM, A.E.; Oro, D.; Evers, S.S.; Heeboll, S.; Eriksen, P.L.; Thomsen, K.L.; Bengtsson, A.; Veidal, S.S.; Feigh, M.; et al. Human translatability of the GAN diet-induced obese mouse model of non-alcoholic steatohepatitis. BMC Gastroenterol. 2020, 20, 210. [Google Scholar] [CrossRef] [PubMed]
- Wei, G.; An, P.; Vaid, K.A.; Nasser, I.; Huang, P.; Tan, L.; Zhao, S.; Schuppan, D.; Popov, Y.V. Comparison of murine steatohepatitis models identifies a dietary intervention with robust fibrosis, ductular reaction, and rapid progression to cirrhosis and cancer. Am. J. Physiol. Gastrointest. Liver Physiol. 2020, 318, G174–G188. [Google Scholar] [CrossRef] [PubMed]
- Brigstock, D.R. Extracellular Vesicles in Organ Fibrosis: Mechanisms, Therapies, and Diagnostics. Cells 2021, 10, 1596. [Google Scholar] [CrossRef]
- Hernandez, A.; Arab, J.P.; Reyes, D.; Lapitz, A.; Moshage, H.; Banales, J.M.; Arrese, M. Extracellular Vesicles in NAFLD/ALD: From Pathobiology to Therapy. Cells 2020, 9, 817. [Google Scholar] [CrossRef]
- Povero, D.; Eguchi, A.; Li, H.; Johnson, C.D.; Papouchado, B.G.; Wree, A.; Messer, K.; Feldstein, A.E. Circulating extracellular vesicles with specific proteome and liver microRNAs are potential biomarkers for liver injury in experimental fatty liver disease. PLoS ONE 2014, 9, e113651. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Zhu, N.; Yan, T.; Shi, Y.N.; Chen, J.; Zhang, C.J.; Xie, X.J.; Liao, D.F.; Qin, L. The crosstalk: Exosomes and lipid metabolism. Cell Commun. Signal 2020, 18, 119. [Google Scholar] [CrossRef]
- Luci, C.; Bourinet, M.; Leclere, P.S.; Anty, R.; Gual, P. Chronic Inflammation in Non-Alcoholic Steatohepatitis: Molecular Mechanisms and Therapeutic Strategies. Front. Endocrinol. 2020, 11, 597648. [Google Scholar] [CrossRef]
- Li, Y.; Luan, Y.; Li, J.; Song, H.; Li, Y.; Qi, H.; Sun, B.; Zhang, P.; Wu, X.; Liu, X.; et al. Exosomal miR-199a-5p promotes hepatic lipid accumulation by modulating MST1 expression and fatty acid metabolism. Hepatol. Int. 2020, 14, 1057–1074. [Google Scholar] [CrossRef] [PubMed]
- Gu, H.; Yang, K.; Shen, Z.; Jia, K.; Liu, P.; Pan, M.; Sun, C. ER stress-induced adipocytes secrete-aldo-keto reductase 1B7-containing exosomes that cause nonalcoholic steatohepatitis in mice. Free Radic. Biol. Med. 2021, 163, 220–233. [Google Scholar] [CrossRef]
- Hou, J.; Zhang, J.; Cui, P.; Zhou, Y.; Liu, C.; Wu, X.; Ji, Y.; Wang, S.; Cheng, B.; Ye, H.; et al. TREM2 sustains macrophage-hepatocyte metabolic coordination in nonalcoholic fatty liver disease and sepsis. J. Clin. Investig. 2021, 131, e135197. [Google Scholar] [CrossRef]
- Kakazu, E.; Mauer, A.S.; Yin, M.; Malhi, H. Hepatocytes release ceramide-enriched pro-inflammatory extracellular vesicles in an IRE1alpha-dependent manner. J. Lipid Res. 2016, 57, 233–245. [Google Scholar] [CrossRef] [PubMed]
- Hirsova, P.; Ibrahim, S.H.; Krishnan, A.; Verma, V.K.; Bronk, S.F.; Werneburg, N.W.; Charlton, M.R.; Shah, V.H.; Malhi, H.; Gores, G.J. Lipid-Induced Signaling Causes Release of Inflammatory Extracellular Vesicles from Hepatocytes. Gastroenterology 2016, 150, 956–967. [Google Scholar] [CrossRef] [PubMed]
- Dasgupta, D.; Nakao, Y.; Mauer, A.S.; Thompson, J.M.; Sehrawat, T.S.; Liao, C.Y.; Krishnan, A.; Lucien, F.; Guo, Q.; Liu, M.; et al. IRE1A Stimulates Hepatocyte-Derived Extracellular Vesicles That Promote Inflammation in Mice with Steatohepatitis. Gastroenterology 2020, 159, 1487–1503.e17. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.L.; Pan, Q.; Cao, H.X.; Xin, F.Z.; Zhao, Z.H.; Yang, R.X.; Zeng, J.; Zhou, H.; Fan, J.G. Lipotoxic Hepatocyte-Derived Exosomal MicroRNA 192-5p Activates Macrophages Through Rictor/Akt/Forkhead Box Transcription Factor O1 Signaling in Nonalcoholic Fatty Liver Disease. Hepatology 2020, 72, 454–469. [Google Scholar] [CrossRef]
- Zhao, Z.; Zhong, L.; Li, P.; He, K.; Qiu, C.; Zhao, L.; Gong, J. Cholesterol impairs hepatocyte lysosomal function causing M1 polarization of macrophages via exosomal miR-122-5p. Exp. Cell Res. 2020, 387, 111738. [Google Scholar] [CrossRef]
- Povero, D.; Panera, N.; Eguchi, A.; Johnson, C.D.; Papouchado, B.G.; de Araujo Horcel, L.; Pinatel, E.M.; Alisi, A.; Nobili, V.; Feldstein, A.E. Lipid-induced hepatocyte-derived extracellular vesicles regulate hepatic stellate cell via microRNAs targeting PPAR-gamma. Cell Mol. Gastroenterol. Hepatol. 2015, 1, 646–663.e4. [Google Scholar] [CrossRef]
- Povero, D.; Eguchi, A.; Niesman, I.R.; Andronikou, N.; de Mollerat du Jeu, X.; Mulya, A.; Berk, M.; Lazic, M.; Thapaliya, S.; Parola, M.; et al. Lipid-induced toxicity stimulates hepatocytes to release angiogenic microparticles that require Vanin-1 for uptake by endothelial cells. Sci. Signal 2013, 6, ra88. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Chen, R.; Kemper, S.; Brigstock, D.R. Extracellular Vesicles from Hepatocytes Are Therapeutic for Toxin-Mediated Fibrosis and Gene Expression in the Liver. Front. Cell Dev. Biol. 2019, 7, 368. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Chen, R.; Kemper, S.; Brigstock, D.R. Production, Exacerbating Effect, and EV-Mediated Transcription of Hepatic CCN2 in NASH: Implications for Diagnosis and Therapy of NASH Fibrosis. Int. J. Mol. Sci. 2023, 24, 12823. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Chen, R.; Kemper, S.; Brigstock, D.R. Dynamic Changes in Function and Proteomic Composition of Extracellular Vesicles from Hepatic Stellate Cells during Cellular Activation. Cells 2020, 9, 290. [Google Scholar] [CrossRef] [PubMed]
- Sticht, C.; De La Torre, C.; Parveen, A.; Gretz, N. miRWalk: An online resource for prediction of microRNA binding sites. PLoS ONE 2018, 13, e0206239. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; He, Y.; Mackowiak, B.; Gao, B. MicroRNAs as regulators, biomarkers and therapeutic targets in liver diseases. Gut 2021, 70, 784–795. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.; Yang, X.; Wang, S.; Wu, Y.; Zheng, L.; Tang, Y.; Gao, Y.; Niu, J. Human umbilical cord mesenchymal stromal cell-derived exosomes protect against MCD-induced NASH in a mouse model. Stem Cell Res. Ther. 2022, 13, 517. [Google Scholar] [CrossRef]
- Watanabe, T.; Tsuchiya, A.; Takeuchi, S.; Nojiri, S.; Yoshida, T.; Ogawa, M.; Itoh, M.; Takamura, M.; Suganami, T.; Ogawa, Y.; et al. Development of a non-alcoholic steatohepatitis model with rapid accumulation of fibrosis, and its treatment using mesenchymal stem cells and their small extracellular vesicles. Regen. Ther. 2020, 14, 252–261. [Google Scholar] [CrossRef]
- Cheng, L.; Yu, P.; Li, F.; Jiang, X.; Jiao, X.; Shen, Y.; Lai, X. Human umbilical cord-derived mesenchymal stem cell-exosomal miR-627-5p ameliorates non-alcoholic fatty liver disease by repressing FTO expression. Hum. Cell 2021, 34, 1697–1708. [Google Scholar] [CrossRef]
- El-Derany, M.O.; AbdelHamid, S.G. Upregulation of miR-96-5p by bone marrow mesenchymal stem cells and their exosomes alleviate non-alcoholic steatohepatitis: Emphasis on caspase-2 signaling inhibition. Biochem. Pharmacol. 2021, 190, 114624. [Google Scholar] [CrossRef] [PubMed]
- Du, X.; Li, H.; Han, X.; Ma, W. Mesenchymal stem cells-derived exosomal miR-24-3p ameliorates non-alcohol fatty liver disease by targeting Keap-1. Biochem. Biophys. Res. Commun. 2022, 637, 331–340. [Google Scholar] [CrossRef] [PubMed]
- Kang, Y.; Song, Y.; Luo, Y.; Song, J.; Li, C.; Yang, S.; Guo, J.; Yu, J.; Zhang, X. Exosomes derived from human umbilical cord mesenchymal stem cells ameliorate experimental non-alcoholic steatohepatitis via Nrf2/NQO-1 pathway. Free Radic. Biol. Med. 2022, 192, 25–36. [Google Scholar] [CrossRef] [PubMed]
- Niu, Q.; Wang, T.; Wang, Z.; Wang, F.; Huang, D.; Sun, H.; Liu, H. Adipose-derived mesenchymal stem cell-secreted extracellular vesicles alleviate non-alcoholic fatty liver disease via delivering miR-223-3p. Adipocyte 2022, 11, 572–587. [Google Scholar] [CrossRef]
- Yang, F.; Wu, Y.; Chen, Y.; Xi, J.; Chu, Y.; Jin, J.; Yan, Y. Human umbilical cord mesenchymal stem cell-derived exosomes ameliorate liver steatosis by promoting fatty acid oxidation and reducing fatty acid synthesis. JHEP Rep. 2023, 5, 100746. [Google Scholar] [CrossRef] [PubMed]
- Safran, M.; Masoud, R.; Sultan, M.; Tachlytski, I.; Chai Gadot, C.; Pery, R.; Balint-Lahat, N.; Pappo, O.; Buzaglo, N.; Ben-Ari, Z. Extracellular Vesicular Transmission of miR-423-5p from HepG2 Cells Inhibits the Differentiation of Hepatic Stellate Cells. Cells 2022, 11, 1715. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Chen, R.; Kemper, S.; Cong, M.; You, H.; Brigstock, D.R. Therapeutic effects of serum extracellular vesicles in liver fibrosis. J. Extracell. Vesicles 2018, 7, 1461505. [Google Scholar] [CrossRef]
- Ma, N.; Wang, X.; Qiao, Y.; Li, F.; Hui, Y.; Zou, C.; Jin, J.; Lv, G.; Peng, Y.; Wang, L.; et al. Coexpression of an intronic microRNA and its host gene reveals a potential role for miR-483-5p as an IGF2 partner. Mol. Cell Endocrinol. 2011, 333, 96–101. [Google Scholar] [CrossRef]
- Maubach, G.; Lim, M.C.; Chen, J.; Yang, H.; Zhuo, L. miR studies in in vitro and in vivo activated hepatic stellate cells. World J. Gastroenterol. 2011, 17, 2748–2773. [Google Scholar] [CrossRef]
- Li, F.; Ma, N.; Zhao, R.; Wu, G.; Zhang, Y.; Qiao, Y.; Han, D.; Xu, Y.; Xiang, Y.; Yan, B.; et al. Overexpression of miR-483-5p/3p cooperate to inhibit mouse liver fibrosis by suppressing the TGF-beta stimulated HSCs in transgenic mice. J. Cell Mol. Med. 2014, 18, 966–974. [Google Scholar] [CrossRef]
- Li, F.; Ma, N.; Zhao, R.; Wu, G.; Zhang, Y.; Qiao, Y.; Han, D.; Xu, Y.; Xiang, Y.; Yan, B.; et al. Inverse relationship between the level of miR 148a-3p and both TGF-beta1 and FIB-4 in hepatocellular carcinoma. Biochem. Biophys. Rep. 2021, 27, 101082. [Google Scholar] [CrossRef]
- Nojima, H.; Freeman, C.M.; Schuster, R.M.; Japtok, L.; Kleuser, B.; Edwards, M.J.; Gulbins, E.; Lentsch, A.B. Hepatocyte exosomes mediate liver repair and regeneration via sphingosine-1-phosphate. J. Hepatol. 2016, 64, 60–68. [Google Scholar] [CrossRef]
- Chen, L.; Chen, R.; Kemper, S.; Brigstock, D.R. Pathways of production and delivery of hepatocyte exosomes. J. Cell Commun. Signal 2018, 12, 343–357. [Google Scholar] [CrossRef]
- Nagashima, S.; Jirintai, S.; Takahashi, M.; Kobayashi, T.; Tanggis; Nishizawa, T.; Kouki, T.; Yashiro, T.; Okamoto, H. Hepatitis E virus egress depends on the exosomal pathway, with secretory exosomes derived from multivesicular bodies. J. Gen. Virol. 2014, 95, 2166–2175. [Google Scholar] [CrossRef]
- Ramakrishnaiah, V.; Thumann, C.; Fofana, I.; Habersetzer, F.; Pan, Q.; de Ruiter, P.E.; Willemsen, R.; Demmers, J.A.; Stalin Raj, V.; Jenster, G.; et al. Exosome-mediated transmission of hepatitis C virus between human hepatoma Huh7.5 cells. Proc. Natl. Acad. Sci. USA 2013, 110, 13109–13113. [Google Scholar] [CrossRef]
- Tamai, K.; Shiina, M.; Tanaka, N.; Nakano, T.; Yamamoto, A.; Kondo, Y.; Kakazu, E.; Inoue, J.; Fukushima, K.; Sano, K.; et al. Regulation of hepatitis C virus secretion by the Hrs-dependent exosomal pathway. Virology 2012, 422, 377–385. [Google Scholar] [CrossRef] [PubMed]
- Cobb, D.A.; Kim, O.K.; Golden-Mason, L.; Rosen, H.R.; Hahn, Y.S. Hepatocyte-derived exosomes promote T follicular regulatory cell expansion during hepatitis C virus infection. Hepatology 2018, 67, 71–85. [Google Scholar] [CrossRef] [PubMed]
- Devhare, P.B.; Sasaki, R.; Shrivastava, S.; Di Bisceglie, A.M.; Ray, R.; Ray, R.B. Exosome-Mediated Intercellular Communication between Hepatitis C Virus-Infected Hepatocytes and Hepatic Stellate Cells. J. Virol. 2017, 91, 10–1128. [Google Scholar] [CrossRef] [PubMed]
- Kouwaki, T.; Fukushima, Y.; Daito, T.; Sanada, T.; Yamamoto, N.; Mifsud, E.J.; Leong, C.R.; Tsukiyama-Kohara, K.; Kohara, M.; Matsumoto, M.; et al. Extracellular Vesicles Including Exosomes Regulate Innate Immune Responses to Hepatitis B Virus Infection. Front. Immunol. 2016, 7, 335. [Google Scholar] [CrossRef] [PubMed]
- Verma, V.K.; Li, H.; Wang, R.; Hirsova, P.; Mushref, M.; Liu, Y.; Cao, S.; Contreras, P.C.; Malhi, H.; Kamath, P.S.; et al. Alcohol stimulates macrophage activation through caspase-dependent hepatocyte derived release of CD40L containing extracellular vesicles. J. Hepatol. 2016, 64, 651–660. [Google Scholar] [CrossRef]
- Momen-Heravi, F.; Bala, S.; Kodys, K.; Szabo, G. Exosomes derived from alcohol-treated hepatocytes horizontally transfer liver specific miR-122 and sensitize monocytes to LPS. Sci. Rep. 2015, 5, 9991. [Google Scholar] [CrossRef]
- Seo, W.; Eun, H.S.; Kim, S.Y.; Yi, H.S.; Lee, Y.S.; Park, S.H.; Jang, M.J.; Jo, E.; Kim, S.C.; Han, Y.M.; et al. Exosome-mediated activation of toll-like receptor 3 in stellate cells stimulates interleukin-17 production by gammadelta T cells in liver fibrosis. Hepatology 2016, 64, 616–631. [Google Scholar] [CrossRef]
- Lee, Y.S.; Kim, S.Y.; Ko, E.; Lee, J.H.; Yi, H.S.; Yoo, Y.J.; Je, J.; Suh, S.J.; Jung, Y.K.; Kim, J.H.; et al. Exosomes derived from palmitic acid-treated hepatocytes induce fibrotic activation of hepatic stellate cells. Sci. Rep. 2017, 7, 3710. [Google Scholar] [CrossRef] [PubMed]
Gene ID | Accession No. | Primer | Length (bp) | |
---|---|---|---|---|
Fwd Seq (5′-3′) | Rev Seq (5′-3′) | |||
CCN2 | NM_010217 | CACTCTGCCAGTGGAGTTCA | AAGATGTCATTGTCCCCAGG | 111 |
COL1A1 | NM_007742 | GCCCGAACCCCAAGGAAAAGAAGC | CTGGGAGGCCTCGGTGGACATTAG | 148 |
ACTA2 | NM_007392 | GGCTCTGGGCTCTGTAAGG | CTCTTGCTCTGGGCTTCATC | 148 |
COL3A1 | NM_009930 | GCCCACAGCCTTCTACACCT | GCCAGGGTCACCATTTCTC | 110 |
GAPDH | NM_002046 | TGCACCACCAACTGCTTAGC | GGCATGGACTGTGGTCATGAG | 87 |
TIMP1 | NM_001044384 | CCTATAGTGCTGGCTGTGGG | GCAAAGTGACGGCTCTGGTA | 136 |
MMP2 | NM_008610 | GCAGCTGTACAGACACTGGT | ACAGCTGTTGTAGGAGGTGC | 182 |
RELN | MMU24703 | TTACTCGCACCTTGCTGAAAT | CAGTTGCTGGTAGGAGTCAAAG | 73 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, X.; Chen, R.; Kemper, S.; Xu, Z.; Brigstock, D.R. Therapeutic Actions of Hepatocyte Extracellular Vesicles in a Murine Model of Diet-Induced Steatohepatitis with Fibrosis. Biomedicines 2025, 13, 274. https://doi.org/10.3390/biomedicines13020274
Li X, Chen R, Kemper S, Xu Z, Brigstock DR. Therapeutic Actions of Hepatocyte Extracellular Vesicles in a Murine Model of Diet-Induced Steatohepatitis with Fibrosis. Biomedicines. 2025; 13(2):274. https://doi.org/10.3390/biomedicines13020274
Chicago/Turabian StyleLi, Xinlei, Ruju Chen, Sherri Kemper, Zhaohui Xu, and David R. Brigstock. 2025. "Therapeutic Actions of Hepatocyte Extracellular Vesicles in a Murine Model of Diet-Induced Steatohepatitis with Fibrosis" Biomedicines 13, no. 2: 274. https://doi.org/10.3390/biomedicines13020274
APA StyleLi, X., Chen, R., Kemper, S., Xu, Z., & Brigstock, D. R. (2025). Therapeutic Actions of Hepatocyte Extracellular Vesicles in a Murine Model of Diet-Induced Steatohepatitis with Fibrosis. Biomedicines, 13(2), 274. https://doi.org/10.3390/biomedicines13020274