Landscape of Interactions between Stromal and Myeloid Cells in Ileal Crohn’s Disease; Indications of an Important Role for Fibroblast-Derived CCL-2
Abstract
1. Introduction
2. Materials and Methods
2.1. Single-Cell RNA Sequencing Data Acquisition, Preprocessing, and Cell Clustering
2.2. Cluster Refinement and Cell Type Annotation
2.3. Differential Gene Expression within Populations
2.4. Intercellular Communication Analysis with CellChat
2.5. Network Inference and Analysis with the NicheNet Algorithm
2.6. CCL2 RNA Sequencing
2.7. Stromal Cell Isolation and Culture
2.8. Tissue Culture
2.9. Differentiation of the H1 Embryonic Cell Line to Human Intestinal Organoids
2.10. Primary Human Colonoids
2.11. Cytokine Treatments
2.12. RNA Extraction
2.13. cDNA Synthesis and qRT-PCR
2.14. Enzyme-Linked Immunosorbent Assay (ELISA)
2.15. In Vitro Statistics
3. Results
3.1. Myeloid and Stromal Cell Clusters in Inflamed and Non-Inflamed CD Ileum
3.2. Distinct Functions of Stromal and Myeloid Cell Subsets during Homeostasis and Inflammation Outlined by their Transcriptional Profile
3.3. Communication Pathways between Myeloid and Stromal Cells
3.4. Interactions between Stromal and Myeloid Cells Regulate Pathogenic Chemokines and Cytokines
3.5. CCL2 Is Upregulated in Ileal CD and Produced by Stromal Cells in Response to Proinflammatory Stimuli
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Neurath, M.F. Cytokines in inflammatory bowel disease. Nat. Rev. Immunol. 2014, 14, 329–342. [Google Scholar] [CrossRef] [PubMed]
- Valatas, V.; Kitamura, K.; Ward, S.G.; Kolios, G. Editorial: Stromal and immune cell interactions in intestinal inflammation and fibrosis. Front. Immunol. 2023, 14, 1152140. [Google Scholar] [CrossRef] [PubMed]
- Roulis, M.; Flavell, R.A. Fibroblasts and myofibroblasts of the intestinal lamina propria in physiology and disease. Differentiation 2016, 92, 116–131. [Google Scholar] [CrossRef] [PubMed]
- Henderson, N.C.; Rieder, F.; Wynn, T.A. Fibrosis: From mechanisms to medicines. Nature 2020, 587, 555–566. [Google Scholar] [CrossRef] [PubMed]
- Sun, H.; Tan, J.; Chen, H.; Wu, N.; Su, B. Immune niches orchestrated by intestinal mesenchymal stromal cells lining the crypt-villus. Front. Immunol. 2022, 13, 1057932. [Google Scholar] [CrossRef] [PubMed]
- Smillie, C.S.; Biton, M.; Ordovas-Montanes, J.; Sullivan, K.M.; Burgin, G.; Graham, D.B.; Herbst, R.H.; Rogel, N.; Slyper, M.; Waldman, J.; et al. Intra- and Inter-cellular Rewiring of the Human Colon during Ulcerative Colitis. Cell 2019, 178, 714–730.e722. [Google Scholar] [CrossRef] [PubMed]
- Drygiannakis, I.; Kolios, G.; Filidou, E.; Bamias, G.; Valatas, V. Intestinal Stromal Cells in the Turmoil of Inflammation and Defective Connective Tissue Remodeling in Inflammatory Bowel Disease. Inflamm. Bowel Dis. 2024, izae066. [Google Scholar] [CrossRef]
- Shaw, T.N.; Houston, S.A.; Wemyss, K.; Bridgeman, H.M.; Barbera, T.A.; Zangerle-Murray, T.; Strangward, P.; Ridley, A.J.; Wang, P.; Tamoutounour, S. Tissue-resident macrophages in the intestine are long lived and defined by Tim-4 and CD4 expression. J. Exp. Med. 2018, 215, 1507–1518. [Google Scholar] [CrossRef] [PubMed]
- Bain, C.C.; Bravo-Blas, A.; Scott, C.L.; Gomez Perdiguero, E.; Geissmann, F.; Henri, S.; Malissen, B.; Osborne, L.C.; Artis, D.; Mowat, A.M. Constant replenishment from circulating monocytes maintains the macrophage pool in the intestine of adult mice. Nat. Immunol. 2014, 15, 929–937. [Google Scholar] [CrossRef]
- Rivollier, A.; He, J.; Kole, A.; Valatas, V.; Kelsall, B.L. Inflammation switches the differentiation program of Ly6Chi monocytes from antiinflammatory macrophages to inflammatory dendritic cells in the colon. J. Exp. Med. 2012, 209, 139–155. [Google Scholar] [CrossRef]
- Vannucchi, M.G. Telocytes and macrophages in the gut: From morphology to function, do the two cell types interact with each other? Which helps which? Int. J. Mol. Sci. 2022, 23, 8435. [Google Scholar] [CrossRef] [PubMed]
- Desalegn, G.; Pabst, O. Inflammation triggers immediate rather than progressive changes in monocyte differentiation in the small intestine. Nat. Commun. 2019, 10, 3229. [Google Scholar] [CrossRef] [PubMed]
- Gren, S.T.; Grip, O. Role of Monocytes and Intestinal Macrophages in Crohn’s Disease and Ulcerative Colitis. Inflamm. Bowel Dis. 2016, 22, 1992–1998. [Google Scholar] [CrossRef] [PubMed]
- Cao, Q.; Lin, Y.; Yue, C.; Wang, Y.; Quan, F.; Cui, X.; Bi, R.; Tang, X.; Yang, Y.; Wang, C.; et al. IL-6 deficiency promotes colitis by recruiting Ly6C(hi) monocytes into inflamed colon tissues in a CCL2-CCR2-dependent manner. Eur. J. Pharmacol. 2021, 904, 174165. [Google Scholar] [CrossRef]
- Tsai, C.F.; Chen, J.H.; Yeh, W.L. Pulmonary fibroblasts-secreted CXCL10 polarizes alveolar macrophages under pro-inflammatory stimuli. Toxicol. Appl. Pharmacol. 2019, 380, 114698. [Google Scholar] [CrossRef] [PubMed]
- Stadler, M.; Pudelko, K.; Biermeier, A.; Walterskirchen, N.; Gaigneaux, A.; Weindorfer, C.; Harrer, N.; Klett, H.; Hengstschläger, M.; Schüler, J.; et al. Stromal fibroblasts shape the myeloid phenotype in normal colon and colorectal cancer and induce CD163 and CCL2 expression in macrophages. Cancer Lett. 2021, 520, 184–200. [Google Scholar] [CrossRef] [PubMed]
- Wei, K.; Nguyen, H.N.; Brenner, M.B. Fibroblast pathology in inflammatory diseases. J. Clin. Investig. 2021, 131, e149538. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Shi, Y.; Cao, G. The Application of Single-Cell RNA Sequencing in the Inflammatory Tumor Microenvironment. Biomolecules 2023, 13, 344. [Google Scholar] [CrossRef] [PubMed]
- Jaeger, N.; Gamini, R.; Cella, M.; Schettini, J.L.; Bugatti, M.; Zhao, S.; Rosadini, C.V.; Esaulova, E.; Di Luccia, B.; Kinnett, B.; et al. Single-cell analyses of Crohn’s disease tissues reveal intestinal intraepithelial T cells heterogeneity and altered subset distributions. Nat. Commun. 2021, 12, 1921. [Google Scholar] [CrossRef]
- Edgar, R.; Domrachev, M.; Lash, A.E. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 2002, 30, 207–210. [Google Scholar] [CrossRef]
- Martin, J.C.; Chang, C.; Boschetti, G.; Ungaro, R.; Giri, M.; Grout, J.A.; Gettler, K.; Chuang, L.S.; Nayar, S.; Greenstein, A.J.; et al. Single-Cell Analysis of Crohn’s Disease Lesions Identifies a Pathogenic Cellular Module Associated with Resistance to Anti-TNF Therapy. Cell 2019, 178, 1493–1508.e1420. [Google Scholar] [CrossRef]
- Ihaka, R.; Gentleman, R. R: A language for data analysis and graphics. J. Comput. Graph. Stat. 1996, 5, 299–314. [Google Scholar] [CrossRef]
- Hao, Y.; Hao, S.; Andersen-Nissen, E.; Mauck, W.M., 3rd; Zheng, S.; Butler, A.; Lee, M.J.; Wilk, A.J.; Darby, C.; Zager, M.; et al. Integrated analysis of multimodal single-cell data. Cell 2021, 184, 3573–3587.e3529. [Google Scholar] [CrossRef]
- Hafemeister, C.; Satija, R. Normalization and variance stabilization of single-cell RNA-seq data using regularized negative binomial regression. Genome Biol. 2019, 20, 296. [Google Scholar] [CrossRef]
- Aran, D.; Looney, A.P.; Liu, L.; Wu, E.; Fong, V.; Hsu, A.; Chak, S.; Naikawadi, R.P.; Wolters, P.J.; Abate, A.R.; et al. Reference-based analysis of lung single-cell sequencing reveals a transitional profibrotic macrophage. Nat. Immunol. 2019, 20, 163–172. [Google Scholar] [CrossRef]
- Elmentaite, R.; Kumasaka, N.; Roberts, K.; Fleming, A.; Dann, E.; King, H.W.; Kleshchevnikov, V.; Dabrowska, M.; Pritchard, S.; Bolt, L.; et al. Cells of the human intestinal tract mapped across space and time. Nature 2021, 597, 250–255. [Google Scholar] [CrossRef]
- Jin, S.; Guerrero-Juarez, C.F. Inference and analysis of cell-cell communication using CellChat. Nat. Commun. 2021, 12, 1088. [Google Scholar] [CrossRef]
- Browaeys, R.; Saelens, W. NicheNet: Modeling intercellular communication by linking ligands to target genes. Nat. Methods 2020, 17, 159–162. [Google Scholar] [CrossRef]
- Dovrolis, N.; Filidou, E.; Tarapatzi, G.; Kokkotis, G.; Spathakis, M.; Kandilogiannakis, L.; Drygiannakis, I.; Valatas, V.; Arvanitidis, K.; Karakasiliotis, I.; et al. Co-expression of fibrotic genes in inflammatory bowel disease; A localized event? Front. Immunol. 2022, 13, 1058237. [Google Scholar] [CrossRef]
- Soneson, C.; Love, M.I.; Robinson, M.D. Differential analyses for RNA-seq: Transcript-level estimates improve gene-level inferences. F1000Research 2015, 4, 1521. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Tarapatzi, G.; Filidou, E.; Kandilogiannakis, L.; Spathakis, M.; Gaitanidou, M.; Arvanitidis, K.; Drygiannakis, I.; Valatas, V.; Kotzampassi, K.; Manolopoulos, V.G.; et al. The Probiotic Strains Bifidοbacterium lactis, Lactobacillus acidophilus, Lactiplantibacillus plantarum and Saccharomyces boulardii Regulate Wound Healing and Chemokine Responses in Human Intestinal Subepithelial Myofibroblasts. Pharmaceuticals 2022, 15, 1293. [Google Scholar] [CrossRef] [PubMed]
- Bamias, G.; Filidou, E.; Goukos, D.; Valatas, V.; Arvanitidis, K.; Panagopoulou, M.; Kouklakis, G.; Daikos, G.L.; Ladas, S.D.; Kolios, G. Crohn’s disease-associated mucosal factors regulate the expression of TNF-like cytokine 1A and its receptors in primary subepithelial intestinal myofibroblasts and intestinal epithelial cells. Transl. Res. 2017, 180, 118–130.e112. [Google Scholar] [CrossRef]
- Kandilogiannakis, L.; Filidou, E.; Drygiannakis, I.; Tarapatzi, G.; Didaskalou, S.; Koffa, M.; Arvanitidis, K.; Bamias, G.; Valatas, V.; Paspaliaris, V.; et al. Development of a Human Intestinal Organoid Model for In Vitro Studies on Gut Inflammation and Fibrosis. Stem Cells Int. 2021, 2021, 9929461. [Google Scholar] [CrossRef]
- van den Elzen, P.; Garg, S.; León, L.; Brigl, M.; Leadbetter, E.A.; Gumperz, J.E.; Dascher, C.C.; Cheng, T.Y.; Sacks, F.M.; Illarionov, P.A.; et al. Apolipoprotein-mediated pathways of lipid antigen presentation. Nature 2005, 437, 906–910. [Google Scholar] [CrossRef] [PubMed]
- Jasso, G.J.; Jaiswal, A.; Varma, M.; Laszewski, T.; Grauel, A.; Omar, A.; Silva, N.; Dranoff, G.; Porter, J.A.; Mansfield, K.; et al. Colon stroma mediates an inflammation-driven fibroblastic response controlling matrix remodeling and healing. PLoS Biol. 2022, 20, e3001532. [Google Scholar] [CrossRef] [PubMed]
- Korbecki, J.; Kojder, K.; Simińska, D.; Bohatyrewicz, R.; Gutowska, I.; Chlubek, D.; Baranowska-Bosiacka, I. CC Chemokines in a Tumor: A Review of Pro-Cancer and Anti-Cancer Properties of the Ligands of Receptors CCR1, CCR2, CCR3, and CCR4. Int. J. Mol. Sci. 2020, 21, 8412. [Google Scholar] [CrossRef]
- Chalkidi, N.; Paraskeva, C.; Koliaraki, V. Fibroblasts in intestinal homeostasis, damage, and repair. Front. Immunol. 2022, 13, 924866. [Google Scholar] [CrossRef]
- Gentry, T.; Foster, S.; Winstead, L.; Deibert, E.; Fiordalisi, M.; Balber, A. Simultaneous isolation of human BM hematopoietic, endothelial and mesenchymal progenitor cells by flow sorting based on aldehyde dehydrogenase activity: Implications for cell therapy. Cytotherapy 2007, 9, 259–274. [Google Scholar] [CrossRef]
- Kinchen, J.; Chen, H.H.; Parikh, K.; Antanaviciute, A.; Jagielowicz, M.; Fawkner-Corbett, D.; Ashley, N.; Cubitt, L.; Mellado-Gomez, E.; Attar, M.; et al. Structural Remodeling of the Human Colonic Mesenchyme in Inflammatory Bowel Disease. Cell 2018, 175, 372–386.e317. [Google Scholar] [CrossRef]
- Zhang, X.; Li, L.; Jung, J.; Xiang, S.; Hollmann, C.; Choi, Y.S. The distinct roles of T cell-derived cytokines and a novel follicular dendritic cell-signaling molecule 8D6 in germinal center-B cell differentiation. J. Immunol. 2001, 167, 49–56. [Google Scholar] [CrossRef] [PubMed]
- Kitanaka, N.; Owada, Y.; Okuyama, R.; Sakagami, H.; Nourani, M.R.; Aiba, S.; Furukawa, H.; Watanabe, M.; Ono, M.; Ohteki, T.; et al. Epidermal-type fatty acid binding protein as a negative regulator of IL-12 production in dendritic cells. Biochem. Biophys. Res. Commun. 2006, 345, 459–466. [Google Scholar] [CrossRef]
- Li, J.; Geng, S.; Xie, X.; Liu, H.; Zheng, G.; Sun, X.; Zhao, G.; Wan, Y.; Wu, Y.; Chen, X.; et al. Caveolin-1-mediated negative signaling plays a critical role in the induction of regulatory dendritic cells by DNA and protein coimmunization. J. Immunol. 2012, 189, 2852–2859. [Google Scholar] [CrossRef]
- Mikulski, Z.; Johnson, R.; Shaked, I.; Kim, G.; Nowyhed, H.; Goodman, W.; Chodaczek, G.; Pizarro, T.T.; Cominelli, F.; Ley, K. SAMP1/YitFc mice develop ileitis via loss of CCL21 and defects in dendritic cell migration. Gastroenterology 2015, 148, 783–793.e785. [Google Scholar] [CrossRef] [PubMed]
- Jeimy, S.B.; Tasneem, S.; Cramer, E.M.; Hayward, C.P. Multimerin 1. Platelets 2008, 19, 83–95. [Google Scholar] [CrossRef]
- Adam, F.; Zheng, S.; Joshi, N.; Kelton, D.S.; Sandhu, A.; Suehiro, Y.; Jeimy, S.B.; Santos, A.V.; Massé, J.M.; Kelton, J.G.; et al. Analyses of cellular multimerin 1 receptors: In vitro evidence of binding mediated by alphaIIbbeta3 and alphavbeta3. Thromb. Haemost. 2005, 94, 1004–1011. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.; Tang, A.; Wang, X.; Chen, X.; Zhao, L.; Xiao, Z.; Shen, S. Inhibition of lncRNA NEAT1 suppresses the inflammatory response in IBD by modulating the intestinal epithelial barrier and by exosome-mediated polarization of macrophages. Int. J. Mol. Med. 2018, 42, 2903–2913. [Google Scholar] [CrossRef]
- Gren, S.T.; Janciauskiene, S.; Sandeep, S.; Jonigk, D.; Kvist, P.H.; Gerwien, J.G.; Håkansson, K.; Grip, O. The protease inhibitor cystatin C down-regulates the release of IL-β and TNF-α in lipopolysaccharide activated monocytes. J. Leukoc. Biol. 2016, 100, 811–822. [Google Scholar] [CrossRef]
- Mikuda, N.; Schmidt-Ullrich, R.; Kärgel, E.; Golusda, L.; Wolf, J.; Höpken, U.E.; Scheidereit, C.; Kühl, A.A.; Kolesnichenko, M. Deficiency in IκBα in the intestinal epithelium leads to spontaneous inflammation and mediates apoptosis in the gut. J. Pathol. 2020, 251, 160–174. [Google Scholar] [CrossRef]
- Lu, J.; Chatterjee, M.; Schmid, H.; Beck, S.; Gawaz, M. CXCL14 as an emerging immune and inflammatory modulator. J. Inflamm. 2016, 13, 1. [Google Scholar] [CrossRef]
- Ruiz-Villalba, A.; Romero, J.P.; Hernández, S.C.; Vilas-Zornoza, A.; Fortelny, N.; Castro-Labrador, L.; San Martin-Uriz, P.; Lorenzo-Vivas, E.; García-Olloqui, P.; Palacio, M.; et al. Single-Cell RNA Sequencing Analysis Reveals a Crucial Role for CTHRC1 (Collagen Triple Helix Repeat Containing 1) Cardiac Fibroblasts After Myocardial Infarction. Circulation 2020, 142, 1831–1847. [Google Scholar] [CrossRef]
- Adema, G.J.; Hartgers, F.; Verstraten, R.; de Vries, E.; Marland, G.; Menon, S.; Foster, J.; Xu, Y.; Nooyen, P.; McClanahan, T.; et al. A dendritic-cell-derived C-C chemokine that preferentially attracts naive T cells. Nature 1997, 387, 713–717. [Google Scholar] [CrossRef] [PubMed]
- Menzel, K.; Hausmann, M.; Obermeier, F.; Schreiter, K.; Dunger, N.; Bataille, F.; Falk, W.; Scholmerich, J.; Herfarth, H.; Rogler, G. Cathepsins B, L and D in inflammatory bowel disease macrophages and potential therapeutic effects of cathepsin inhibition in vivo. Clin. Exp. Immunol. 2006, 146, 169–180. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Patel, N.R.; Walter, L.; Ingersoll, S.; Sitaraman, S.V.; Garg, P. Constitutive expression of MMP9 in intestinal epithelium worsens murine acute colitis and is associated with increased levels of proinflammatory cytokine Kc. Am. J. Physiol. Gastrointest. Liver Physiol. 2013, 304, G793–G803. [Google Scholar] [CrossRef]
- Wu, L.; Huang, K.; Li, Q.; Wu, H.; Gao, Y.; Xu, X.; Liu, X.; Han, L. Crosstalk between myofibroblasts and macrophages: A regulative factor of valvular fibrosis in calcific aortic valve disease. Cell Biol. Int. 2023, 47, 754–767. [Google Scholar] [CrossRef] [PubMed]
- Sikkema, A.H.; Stoffels, J.M.J.; Wang, P.; Basedow, F.J.; Bulsink, R.; Bajramovic, J.J.; Baron, W. Fibronectin aggregates promote features of a classically and alternatively activated phenotype in macrophages. J. Neuroinflamm. 2018, 15, 218. [Google Scholar] [CrossRef] [PubMed]
- Matías-Román, S.; Gálvez, B.G.; Genís, L.; Yáñez-Mó, M.; de la Rosa, G.; Sánchez-Mateos, P.; Sánchez-Madrid, F.; Arroyo, A.G. Membrane type 1-matrix metalloproteinase is involved in migration of human monocytes and is regulated through their interaction with fibronectin or endothelium. Blood 2005, 105, 3956–3964. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Xu, X.; Geng, J.; Wan, X.; Dai, H. The autocrine CXCR4/CXCL12 axis contributes to lung fibrosis through modulation of lung fibroblast activity. Exp. Ther. Med. 2020, 19, 1844–1854. [Google Scholar] [CrossRef] [PubMed]
- Puig, K.L.; Swigost, A.J.; Zhou, X.; Sens, M.A.; Combs, C.K. Amyloid precursor protein expression modulates intestine immune phenotype. J. Neuroimmune Pharmacol. 2012, 7, 215–230. [Google Scholar] [CrossRef]
- Mahiddine, K.; Mallavialle, A.; Bziouech, H.; Larbret, F.; Bernard, A.; Bernard, G. CD99 isoforms regulate CD1a expression in human monocyte-derived DCs through ATF-2/CREB-1 phosphorylation. Eur. J. Immunol. 2016, 46, 1460–1471. [Google Scholar] [CrossRef]
- Moonah, S.N.; Abhyankar, M.M.; Haque, R.; Petri, W.A., Jr. The macrophage migration inhibitory factor homolog of Entamoeba histolytica binds to and immunomodulates host macrophages. Infect. Immun. 2014, 82, 3523–3530. [Google Scholar] [CrossRef] [PubMed]
- Jankauskas, S.S.; Wong, D.W.L.; Bucala, R.; Djudjaj, S.; Boor, P. Evolving complexity of MIF signaling. Cell. Signal. 2019, 57, 76–88. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Zhao, X.-Y. Transcription Factors Associated With IL-15 Cytokine Signaling During NK Cell Development. Front. Immunol. 2021, 12, 610789. [Google Scholar] [CrossRef]
- Chen, D.; Tang, T.-X.; Deng, H.; Yang, X.-P.; Tang, Z.-H. Interleukin-7 Biology and Its Effects on Immune Cells: Mediator of Generation, Differentiation, Survival, and Homeostasis. Front. Immunol. 2021, 12, 747324. [Google Scholar] [CrossRef]
- Palone, F.; Vitali, R.; Cucchiara, S.; Mennini, M.; Armuzzi, A.; Pugliese, D.; D’Incà, R.; Barberio, B.; Stronati, L. Fecal HMGB1 Reveals Microscopic Inflammation in Adult and Pediatric Patients with Inflammatory Bowel Disease in Clinical and Endoscopic Remission. Inflamm. Bowel Dis. 2016, 22, 2886–2893. [Google Scholar] [CrossRef] [PubMed]
- Friedrich, M.; Pohin, M.; Jackson, M.A.; Korsunsky, I.; Bullers, S.J.; Rue-Albrecht, K.; Christoforidou, Z.; Sathananthan, D.; Thomas, T.; Ravindran, R.; et al. IL-1-driven stromal-neutrophil interactions define a subset of patients with inflammatory bowel disease that does not respond to therapies. Nat. Med. 2021, 27, 1970–1981. [Google Scholar] [CrossRef]
- Okuda, H.; Hosomi, S.; Itani, S.; Kurimoto, N.; Kobayashi, Y.; Nakata, R.; Nishida, Y.; Ominami, M.; Nadatani, Y.; Fukunaga, S.; et al. Pretreatment serum monocyte chemoattractant protein-1 as a predictor of long-term outcome by ustekinumab in patients with Crohn’s disease. J. Gastroenterol. Hepatol. 2023, 38, 910–920. [Google Scholar] [CrossRef]
- Zigmond, E.; Varol, C.; Farache, J.; Elmaliah, E.; Satpathy, A.T.; Friedlander, G.; Mack, M.; Shpigel, N.; Boneca, I.G.; Murphy, K.M.; et al. Ly6C hi monocytes in the inflamed colon give rise to proinflammatory effector cells and migratory antigen-presenting cells. Immunity 2012, 37, 1076–1090. [Google Scholar] [CrossRef]
- Bernardo, D.; Marin, A.C.; Fernández-Tomé, S.; Montalban-Arques, A.; Carrasco, A.; Tristán, E.; Ortega-Moreno, L.; Mora-Gutiérrez, I.; Díaz-Guerra, A.; Caminero-Fernández, R.; et al. Human intestinal pro-inflammatory CD11c(high)CCR2(+)CX3CR1(+) macrophages, but not their tolerogenic CD11c(-)CCR2(-)CX3CR1(-) counterparts, are expanded in inflammatory bowel disease. Mucosal Immunol. 2018, 11, 1114–1126. [Google Scholar] [CrossRef]
- Kamada, N.; Hisamatsu, T.; Okamoto, S.; Chinen, H.; Kobayashi, T.; Sato, T.; Sakuraba, A.; Kitazume, M.T.; Sugita, A.; Koganei, K.; et al. Unique CD14 intestinal macrophages contribute to the pathogenesis of Crohn disease via IL-23/IFN-gamma axis. J. Clin. Investig. 2008, 118, 2269–2280. [Google Scholar] [CrossRef]
- Mysore, V.; Tahir, S.; Furuhashi, K.; Arora, J.; Rosetti, F.; Cullere, X.; Yazbeck, P.; Sekulic, M.; Lemieux, M.E.; Raychaudhuri, S.; et al. Monocytes transition to macrophages within the inflamed vasculature via monocyte CCR2 and endothelial TNFR2. J. Exp. Med. 2022, 219, e20210562. [Google Scholar] [CrossRef]
- Luque-Martin, R.; Angell, D.C.; Kalxdorf, M.; Bernard, S.; Thompson, W.; Eberl, H.C.; Ashby, C.; Freudenberg, J.; Sharp, C.; Van den Bossche, J.; et al. IFN-γ Drives Human Monocyte Differentiation into Highly Proinflammatory Macrophages That Resemble a Phenotype Relevant to Psoriasis. J. Immunol. 2021, 207, 555–568. [Google Scholar] [CrossRef]
- Qadri, M.; Almadani, S.; Jay, G.D.; Elsaid, K.A. Role of CD44 in Regulating TLR2 Activation of Human Macrophages and Downstream Expression of Proinflammatory Cytokines. J. Immunol. 2018, 200, 758–767. [Google Scholar] [CrossRef] [PubMed]
- Fei, D.; Meng, X.; Yu, W.; Yang, S.; Song, N.; Cao, Y.; Jin, S.; Dong, L.; Pan, S.; Zhao, M. Fibronectin (FN) cooperated with TLR2/TLR4 receptor to promote innate immune responses of macrophages via binding to integrin β1. Virulence 2018, 9, 1588–1600. [Google Scholar] [CrossRef]
- Xie, B.; Laouar, A.; Huberman, E. Fibronectin-mediated cell adhesion is required for induction of 92-kDa type IV collagenase/gelatinase (MMP-9) gene expression during macrophage differentiation. The signaling role of protein kinase C-beta. J. Biol. Chem. 1998, 273, 11576–11582. [Google Scholar] [CrossRef]
- Sumaiya, K.; Langford, D.; Natarajaseenivasan, K.; Shanmughapriya, S. Macrophage migration inhibitory factor (MIF): A multifaceted cytokine regulated by genetic and physiological strategies. Pharmacol. Ther. 2022, 233, 108024. [Google Scholar] [CrossRef] [PubMed]
- Song, Z.; Li, X.; Xie, J.; Han, F.; Wang, N.; Hou, Y.; Yao, J. Associations of inflammatory cytokines with inflammatory bowel disease: A Mendelian randomization study. Front. Immunol. 2024, 14, 1327879. [Google Scholar] [CrossRef]
- Lechuga, S.; Braga-Neto, M.B.; Naydenov, N.G.; Rieder, F.; Ivanov, A.I. Understanding disruption of the gut barrier during inflammation: Should we abandon traditional epithelial cell lines and switch to intestinal organoids? Front. Immunol. 2023, 14, 1108289. [Google Scholar] [CrossRef]













| Patient | Age | Sex | Age of Onset | Disease Location | Disease Behavior | Endoscopic Score (SES-CD) |
|---|---|---|---|---|---|---|
| 1 | 40 | M | A2 | L3 | B2 | 5 |
| 2 | 46 | F | A3 | L3 | B1 | 10 |
| 3 | 32 | M | A2 | L3 | B1 | 8 |
| 4 | 72 | M | A3 | L1 | B1 | 7 |
| Patient | Age | Sex | Age of Onset | Disease Location | Disease Behavior | Endoscopic Score (SES-CD) |
|---|---|---|---|---|---|---|
| 1 | 52 | M | A2 | L3 | B2 | 10 |
| 2 | 80 | M | A2 | L2 | B1 | 8 |
| 3 | 43 | M | A3 | L2 | B1 | 9 |
| Gene | Forward Primer | Reverse Primer | Tm (°C) |
|---|---|---|---|
| CCL2 | AGGAAGATCTCAGTGCAGAGG | AGTCTTCGGAGTTTGGGTTTG | 60 |
| GAPDH | GACATCAAGAAGGTGGTGAA | TGTCATACCAGGAAATGAGC | 60 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dovrolis, N.; Valatas, V.; Drygiannakis, I.; Filidou, E.; Spathakis, M.; Kandilogiannakis, L.; Tarapatzi, G.; Arvanitidis, K.; Bamias, G.; Vradelis, S.; et al. Landscape of Interactions between Stromal and Myeloid Cells in Ileal Crohn’s Disease; Indications of an Important Role for Fibroblast-Derived CCL-2. Biomedicines 2024, 12, 1674. https://doi.org/10.3390/biomedicines12081674
Dovrolis N, Valatas V, Drygiannakis I, Filidou E, Spathakis M, Kandilogiannakis L, Tarapatzi G, Arvanitidis K, Bamias G, Vradelis S, et al. Landscape of Interactions between Stromal and Myeloid Cells in Ileal Crohn’s Disease; Indications of an Important Role for Fibroblast-Derived CCL-2. Biomedicines. 2024; 12(8):1674. https://doi.org/10.3390/biomedicines12081674
Chicago/Turabian StyleDovrolis, Nikolas, Vassilis Valatas, Ioannis Drygiannakis, Eirini Filidou, Michail Spathakis, Leonidas Kandilogiannakis, Gesthimani Tarapatzi, Konstantinos Arvanitidis, Giorgos Bamias, Stergios Vradelis, and et al. 2024. "Landscape of Interactions between Stromal and Myeloid Cells in Ileal Crohn’s Disease; Indications of an Important Role for Fibroblast-Derived CCL-2" Biomedicines 12, no. 8: 1674. https://doi.org/10.3390/biomedicines12081674
APA StyleDovrolis, N., Valatas, V., Drygiannakis, I., Filidou, E., Spathakis, M., Kandilogiannakis, L., Tarapatzi, G., Arvanitidis, K., Bamias, G., Vradelis, S., Manolopoulos, V. G., Paspaliaris, V., & Kolios, G. (2024). Landscape of Interactions between Stromal and Myeloid Cells in Ileal Crohn’s Disease; Indications of an Important Role for Fibroblast-Derived CCL-2. Biomedicines, 12(8), 1674. https://doi.org/10.3390/biomedicines12081674

