Involvement of Lgals3/Galectin-3 in Choroidal Neovascularization and Subretinal Fibrosis Formation
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Laser-Induced CNV Model
2.3. Fundus Fluorescein Angiography and Optical Coherence Tomography
2.4. Assessment of CNV and Subretinal Fibrosis
2.5. Validation of Results
2.6. Western Blot Analyses
2.7. Cell Culture
2.8. RNA-Seq Analysis
2.9. Statistical Analysis
3. Results
3.1. Laser Irradiation Successfully Induced CNV and Subretinal Fibrosis
3.2. Increase in Galectin-3 from RPE Cells in Laser-Induced CNV Mice
3.3. Attenuation of CNV and Subretinal Fibrosis Formation by Silencing of Galectin-3
3.4. Comparing the Inhibitory Effects of Lgals3/Galectin-3 and Lucentis on CNV and the Formation of Subretinal Fibrosis
3.5. Hypoxia Upregulates Galectin-3 Expression in RPE Cells via Hif-1a
3.6. Bioinformatics Analysis of Differentially Expressed Genes and Pathways in RPE Cells by CNV Induction
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wong, W.L.; Su, X.; Li, X.; Cheung, C.M.; Klein, R.; Cheng, C.Y.; Wong, T.Y. Global prevalence of age-related macular degeneration and disease burden projection for 2020 and 2040: A systematic review and meta-analysis. Lancet Glob. Health 2014, 2, e106–e116. [Google Scholar] [CrossRef] [PubMed]
- Tenbrock, L.; Wolf, J.; Boneva, S.; Schlecht, A.; Agostini, H.; Wieghofer, P.; Schlunck, G.; Lange, C. Subretinal fibrosis in neovascular age-related macular degeneration: Current concepts, therapeutic avenues, and future perspectives. Cell Tissue Res. 2022, 387, 361–375. [Google Scholar] [CrossRef] [PubMed]
- Oncel, D.; Oncel, D.; Mishra, K.; Oncel, M.; Arevalo, J.F. Current Management of Subretinal Hemorrhage in Neovascular Age-Related Macular Degeneration. Ophthalmologica 2023, 246, 295–305. [Google Scholar] [CrossRef] [PubMed]
- Mettu, P.S.; Allingham, M.J.; Cousins, S.W. Incomplete response to Anti-VEGF therapy in neovascular AMD: Exploring disease mechanisms and therapeutic opportunities. Prog. Retin. Eye Res. 2021, 82, 100906. [Google Scholar] [CrossRef]
- Sheridan, C.M.; Pate, S.; Hiscott, P.; Wong, D.; Pattwell, D.M.; Kent, D. Expression of hypoxia-inducible factor-1alpha and -2alpha in human choroidal neovascular membranes. Graefes Arch. Clin. Exp. Ophthalmol. 2009, 247, 1361–1367. [Google Scholar] [CrossRef]
- Mammadzada, P.; Corredoira, P.M.; Andre, H. The role of hypoxia-inducible factors in neovascular age-related macular degeneration: A gene therapy perspective. Cell Mol. Life Sci. 2020, 77, 819–833. [Google Scholar] [CrossRef]
- Khanani, A.M.; Russell, M.W.; Aziz, A.A.; Danzig, C.J.; Weng, C.Y.; Eichenbaum, D.A.; Singh, R.P. Angiopoietins as Potential Targets in Management of Retinal Disease. Clin. Ophthalmol. 2021, 15, 3747–3755. [Google Scholar] [CrossRef]
- Biasella, F.; Strunz, T.; Kiel, C.; On Behalf Of The International Amd Genomics Consortium, I.; Weber, B.H.F.; Friedrich, U. Vitronectin and Its Interaction with PAI-1 Suggests a Functional Link to Vascular Changes in AMD Pathobiology. Cells 2022, 11, 1766. [Google Scholar] [CrossRef]
- Yamada, K.; Sakurai, E.; Itaya, M.; Yamasaki, S.; Ogura, Y. Inhibition of laser-induced choroidal neovascularization by atorvastatin by downregulation of monocyte chemotactic protein-1 synthesis in mice. Investig. Ophthalmol. Vis. Sci. 2007, 48, 1839–1843. [Google Scholar] [CrossRef]
- Ambati, J.; Anand, A.; Fernandez, S.; Sakurai, E.; Lynn, B.C.; Kuziel, W.A.; Rollins, B.J.; Ambati, B.K. An animal model of age-related macular degeneration in senescent Ccl-2- or Ccr-2-deficient mice. Nat. Med. 2003, 9, 1390–1397. [Google Scholar] [CrossRef]
- Wu, D.; Kanda, A.; Liu, Y.; Kase, S.; Noda, K.; Ishida, S. Galectin-1 promotes choroidal neovascularization and subretinal fibrosis mediated via epithelial-mesenchymal transition. FASEB J. 2019, 33, 2498–2513. [Google Scholar] [CrossRef]
- Verkerke, H.; Dias-Baruffi, M.; Cummings, R.D.; Arthur, C.M.; Stowell, S.R. Galectins: An Ancient Family of Carbohydrate Binding Proteins with Modern Functions. Methods Mol. Biol. 2022, 2442, 1–40. [Google Scholar] [PubMed]
- Johannes, L.; Jacob, R.; Leffler, H. Galectins at a glance. J. Cell Sci. 2018, 131, jcs208884. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Pritchard, D.M.; Yu, L.G. Galectin-3 promotes secretion of proteases that decrease epithelium integrity in human colon cancer cells. Cell Death Dis. 2023, 14, 268. [Google Scholar] [CrossRef]
- Gao, Z.; Liu, Z.; Wang, R.; Zheng, Y.; Li, H.; Yang, L. Galectin-3 Is a Potential Mediator for Atherosclerosis. J. Immunol. Res. 2020, 2020, 5284728. [Google Scholar] [CrossRef] [PubMed]
- Blanda, V.; Bracale, U.M.; Di Taranto, M.D.; Fortunato, G. Galectin-3 in Cardiovascular Diseases. Int. J. Mol. Sci. 2020, 21, 9232. [Google Scholar] [CrossRef] [PubMed]
- Perez-Moreno, E.; Oyanadel, C.; de la Pena, A.; Hernandez, R.; Perez-Molina, F.; Metz, C.; Gonzalez, A.; Soza, A. Galectins in epithelial-mesenchymal transition: Roles and mechanisms contributing to tissue repair, fibrosis and cancer metastasis. Biol. Res. 2024, 57, 14. [Google Scholar] [CrossRef]
- Saravanan, C.; Liu, F.T.; Gipson, I.K.; Panjwani, N. Galectin-3 promotes lamellipodia formation in epithelial cells by interacting with complex N-glycans on alpha3beta1 integrin. J. Cell Sci. 2009, 122, 3684–3693. [Google Scholar] [CrossRef]
- Andrade, F.E.C.; Correa, M.P.; Gimenes, A.D.; Dos Santos, M.S.; Campos, M.; Chammas, R.; Gomes, J.A.P.; Gil, C.D. Galectin-3: Role in ocular allergy and potential as a predictive biomarker. Br. J. Ophthalmol. 2018, 102, 1003–1010. [Google Scholar] [CrossRef]
- Esposito, N.J.; Mazzoni, F.; Vargas, J.A.; Finnemann, S.C. Diurnal Photoreceptor Outer Segment Renewal in Mice Is Independent of Galectin-3. Investig. Ophthalmol. Vis. Sci. 2021, 62, 7. [Google Scholar] [CrossRef]
- Pitts, K.M.; Neeson, C.E.; Hall, N.E.; Lin, J.B.; Falah, H.K.; Wang, S.L.; Lo, K.T.; Song, C.E.; Margeta, M.A.; Sola-Del Valle, D.A. Neurodegeneration Markers Galectin-3 and Apolipoprotein E Are Elevated in the Aqueous Humor of Eyes With Glaucoma. Transl. Vis. Sci. Technol. 2022, 11, 1. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Zhao, C.; Meng, J.; Li, N.; Xu, Z.; Liu, X.; Hou, S. Galectin-3 regulates microglial activation and promotes inflammation through TLR4/MyD88/NF-kB in experimental autoimmune uveitis. Clin. Immunol. 2022, 236, 108939. [Google Scholar] [CrossRef] [PubMed]
- Canning, P.; Glenn, J.V.; Hsu, D.K.; Liu, F.T.; Gardiner, T.A.; Stitt, A.W. Inhibition of advanced glycation and absence of galectin-3 prevent blood-retinal barrier dysfunction during short-term diabetes. Exp. Diabetes Res. 2007, 2007, 51837. [Google Scholar] [CrossRef] [PubMed]
- An, E.; Lu, X.; Flippin, J.; Devaney, J.M.; Halligan, B.; Hoffman, E.P.; Strunnikova, N.; Csaky, K.; Hathout, Y. Secreted proteome profiling in human RPE cell cultures derived from donors with age related macular degeneration and age matched healthy donors. J. Proteome Res. 2006, 5, 2599–2610. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Kanda, A.; Wu, D.; Ishizuka, E.T.; Kase, S.; Noda, K.; Ichihara, A.; Ishida, S. Suppression of Choroidal Neovascularization and Fibrosis by a Novel RNAi Therapeutic Agent against (Pro)renin Receptor. Mol. Ther. Nucleic Acids 2019, 17, 113–125. [Google Scholar] [CrossRef]
- Chang, Y.H.; Hsing, C.H.; Chiu, C.J.; Wu, Y.R.; Hsu, S.M.; Hsu, Y.H. Protective role of IL-17-producing gammadelta T cells in a laser-induced choroidal neovascularization mouse model. J. Neuroinflamm. 2023, 20, 279. [Google Scholar] [CrossRef]
- Liu, Y.; Wu, D.; Fu, Q.; Hao, S.; Gu, Y.; Zhao, W.; Chen, S.; Sheng, F.; Xu, Y.; Chen, Z.; et al. CHAC1 as a Novel Contributor of Ferroptosis in Retinal Pigment Epithelial Cells with Oxidative Damage. Int. J. Mol. Sci. 2023, 24, 1582. [Google Scholar] [CrossRef]
- Suzuki, M.; Tsujikawa, M.; Itabe, H.; Du, Z.J.; Xie, P.; Matsumura, N.; Fu, X.; Zhang, R.; Sonoda, K.H.; Egashira, K.; et al. Chronic photo-oxidative stress and subsequent MCP-1 activation as causative factors for age-related macular degeneration. J. Cell Sci. 2012, 125 Pt 10, 2407–2415. [Google Scholar] [CrossRef]
- Rosenfeld, P.J.; Brown, D.M.; Heier, J.S.; Boyer, D.S.; Kaiser, P.K.; Chung, C.Y.; Kim, R.Y.; Group, M.S. Ranibizumab for neovascular age-related macular degeneration. N. Engl. J. Med. 2006, 355, 1419–1431. [Google Scholar] [CrossRef]
- Corrado, C.; Fontana, S. Hypoxia and HIF Signaling: One Axis with Divergent Effects. Int. J. Mol. Sci. 2020, 21, 5611. [Google Scholar] [CrossRef]
- Kukurba, K.R.; Montgomery, S.B. RNA Sequencing and Analysis. Cold Spring Harb. Protoc. 2015, 2015, 951–969. [Google Scholar] [CrossRef] [PubMed]
- Bonsack, F.; Sukumari-Ramesh, S. Differential Cellular Expression of Galectin-1 and Galectin-3 After Intracerebral Hemorrhage. Front. Cell Neurosci. 2019, 13, 157. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Z.Y.; Chang, T.F.; Lin, Z.B.; Jing, Y.T.; Wen, L.S.; Niu, Y.L.; Bai, Q.; Guo, C.M.; Sun, J.X.; Wang, Y.S.; et al. Microglial Galectin3 enhances endothelial metabolism and promotes pathological angiogenesis via Notch inhibition by competitively binding to Jag1. Cell Death Dis. 2023, 14, 380. [Google Scholar] [CrossRef]
- Andrade, F.E.C.; Correia-Silva, R.D.; Covre, J.L.; Lice, I.; Gomes, J.A.P.; Gil, C.D. Effects of galectin-3 protein on UVA-induced damage in retinal pigment epithelial cells. Photochem. Photobiol. Sci. 2023, 22, 21–32. [Google Scholar] [CrossRef]
- Abreu, C.A.; De Lima, S.V.; Mendonca, H.R.; Goulart, C.O.; Martinez, A.M. Absence of galectin-3 promotes neuroprotection in retinal ganglion cells after optic nerve injury. Histol. Histopathol. 2017, 32, 253–262. [Google Scholar]
- Sedlar, A.; Travnickova, M.; Bojarova, P.; Vlachova, M.; Slamova, K.; Kren, V.; Bacakova, L. Interaction between Galectin-3 and Integrins Mediates Cell-Matrix Adhesion in Endothelial Cells and Mesenchymal Stem Cells. Int. J. Mol. Sci. 2021, 22, 5144. [Google Scholar] [CrossRef]
- Markowska, A.I.; Jefferies, K.C.; Panjwani, N. Galectin-3 protein modulates cell surface expression and activation of vascular endothelial growth factor receptor 2 in human endothelial cells. J. Biol. Chem. 2011, 286, 29913–29921. [Google Scholar] [CrossRef]
- Chen, W.S.; Cao, Z.; Leffler, H.; Nilsson, U.J.; Panjwani, N. Galectin-3 Inhibition by a Small-Molecule Inhibitor Reduces Both Pathological Corneal Neovascularization and Fibrosis. Investig. Ophthalmol. Vis. Sci. 2017, 58, 9–20. [Google Scholar] [CrossRef] [PubMed]
- Yuan, X.; Gu, X.; Crabb, J.S.; Yue, X.; Shadrach, K.; Hollyfield, J.G.; Crabb, J.W. Quantitative proteomics: Comparison of the macular Bruch membrane/choroid complex from age-related macular degeneration and normal eyes. Mol. Cell Proteom. 2010, 9, 1031–1046. [Google Scholar] [CrossRef]
- Xie, P.; Kamei, M.; Suzuki, M.; Matsumura, N.; Nishida, K.; Sakimoto, S.; Sakaguchi, H.; Nishida, K. Suppression and regression of choroidal neovascularization in mice by a novel CCR2 antagonist, INCB3344. PLoS ONE 2011, 6, e28933. [Google Scholar] [CrossRef]
- Tan, W.; Zou, J.; Yoshida, S.; Jiang, B.; Zhou, Y. The Role of Inflammation in Age-Related Macular Degeneration. Int. J. Biol. Sci. 2020, 16, 2989–3001. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Revilla, J.; Boza-Serrano, A.; Espinosa-Oliva, A.M.; Soto, M.S.; Deierborg, T.; Ruiz, R.; de Pablos, R.M.; Burguillos, M.A.; Venero, J.L. Galectin-3, a rising star in modulating microglia activation under conditions of neurodegeneration. Cell Death Dis. 2022, 13, 628. [Google Scholar] [CrossRef] [PubMed]
- Kauppinen, A.; Paterno, J.J.; Blasiak, J.; Salminen, A.; Kaarniranta, K. Inflammation and its role in age-related macular degeneration. Cell Mol. Life Sci. 2016, 73, 1765–1786. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Cui, X.; Han, Y.; Park, K.S.; Gao, X.; Zhang, X.; Yuan, Z.; Hu, Y.; Hsu, C.W.; Li, X.; et al. Hypoxic drive caused type 3 neovascularization in a preclinical model of exudative age-related macular degeneration. Hum. Mol. Genet. 2019, 28, 3475–3485. [Google Scholar] [CrossRef]
- Gu, X.; Meng, H.; Wang, J.; Wang, R.; Cao, M.; Liu, S.; Chen, H.; Xu, Y. Hypoxia contributes to galectin-3 expression in renal carcinoma cells. Eur. J. Pharmacol. 2021, 890, 173637. [Google Scholar] [CrossRef]
- Dumic, J.; Dabelic, S.; Flogel, M. Galectin-3: An open-ended story. Biochim. Biophys. Acta 2006, 1760, 616–635. [Google Scholar] [CrossRef]







| Primer, 5′-3′ | ||
|---|---|---|
| Gene | Forward | Reverse |
| Lgals3 | AACACGAAGCAGGACAATAACTGG | GCAGTAGGTGAGCATCGTTGAC |
| Hif-1a | TGCTCATCAGTTGCCACTTC | TGGGCCATTTCTGTGTGTAA |
| Ccl2 | TTGGCTCAGCCAGATGCA | CCTACTCATTGGGATCATCTTGC |
| Gapdh | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, D.; Liu, Y.; Luo, X.; Chen, Z.; Fu, Q.; Yao, K. Involvement of Lgals3/Galectin-3 in Choroidal Neovascularization and Subretinal Fibrosis Formation. Biomedicines 2024, 12, 2649. https://doi.org/10.3390/biomedicines12112649
Wu D, Liu Y, Luo X, Chen Z, Fu Q, Yao K. Involvement of Lgals3/Galectin-3 in Choroidal Neovascularization and Subretinal Fibrosis Formation. Biomedicines. 2024; 12(11):2649. https://doi.org/10.3390/biomedicines12112649
Chicago/Turabian StyleWu, Di, Ye Liu, Xiaogang Luo, Zhiqing Chen, Qiuli Fu, and Ke Yao. 2024. "Involvement of Lgals3/Galectin-3 in Choroidal Neovascularization and Subretinal Fibrosis Formation" Biomedicines 12, no. 11: 2649. https://doi.org/10.3390/biomedicines12112649
APA StyleWu, D., Liu, Y., Luo, X., Chen, Z., Fu, Q., & Yao, K. (2024). Involvement of Lgals3/Galectin-3 in Choroidal Neovascularization and Subretinal Fibrosis Formation. Biomedicines, 12(11), 2649. https://doi.org/10.3390/biomedicines12112649

