Effects of Chitosan and N-Succinyl Chitosan on Metabolic Disorders Caused by Oral Administration of Olanzapine in Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Chitosan and Its Derivative
2.3. In Vivo Experiments
2.4. Determination of Glucose, Triglycerides, Total Cholesterol, High-Density Lipoprotein, and Low-Density Lipoprotein in Blood Serum
2.5. Determination of Chemokine Levels in Blood
2.6. Hypothalamic Isolation
2.7. Quantitative Polymerase Reaction
2.8. Open Field Test
2.9. Statistical Analysis
3. Results and Discussion
3.1. Chitosan and N-Succinyl Chitosan
3.2. Characterization of a Mouse Model of Oral Administration of Olanzapine
3.3. Lipid Metabolism
3.4. Chemokine Regulation
3.5. Expression of Appetite-Associated Genes in the Hypothalamus of Chitosan-Supplemented Olanzapine-Treated Mice
3.6. Animal Behavior Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sussman, N. Review of atypical antipsychotics and weight gain. J. Clin. Psychiatry 2001, 62, 5–12. [Google Scholar] [PubMed]
- Beasley, C.M.; Tollefson, G.D.; Tran, P.V. Safety of olanzapine. J. Clin. Psychiatry 1997, 58, 13–17. [Google Scholar] [PubMed]
- Meftah, A.M.; Deckler, E.; Citrome, L.; Kantrowitz, J.T. New discoveries for an old drug: A review of recent olanzapine research. Postgrad. Med. 2020, 132, 80–90. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.; Tian, Y.; Yu, J.; Zhang, R.; Zhang, X.; Guo, P. The pandanus tectorius fruit extract (PTF) modulates the gut microbiota and exerts anti-hyperlipidaemic effects. Phytomedicine 2019, 58, 152863. [Google Scholar] [CrossRef]
- Jiao, R.; Zhang, Z.; Yu, H.; Huang, Y.; Chen, Z.Y. Hypocholesterolemic activity of grape seed proanthocyanidin is mediated by enhancement of bile acid excretion and up-regulation of CYP7A1. J. Nutr. Biochem. 2010, 21, 1134–1139. [Google Scholar] [CrossRef]
- Suntar, I.; Khan, H.; Patel, S.; Celano, R.; Rastrelli, L. An overview on Citrus aurantium L.: Its functions as food ingredient and therapeutic agent. Oxidative Med. Cell. Longev. 2018, 2018, 7864269. [Google Scholar] [CrossRef]
- Wawrzyniak, N.; Skrypnik, K.; Suliburska, J. Dietary supplements in therapy to support weight reduction in obese patients. Acta Sci. Pol. Technol. Aliment. 2022, 21, 67–80. [Google Scholar] [CrossRef]
- Sumiyoshi, M.; Kimura, Y. Low molecular weight chitosan inhibits obesity induced by feeding a high-fat diet long-term in mice. J. Pharm. Pharmacol. 2010, 58, 201–207. [Google Scholar] [CrossRef]
- Huang, L.; Chen, J.; Cao, P.; Pan, H.; Ding, C.; Xiao, T.; Zhang, P.; Guo, J.; Su, Z. Anti-obese effect of glucosamine and chitosan oligosaccharide in high-fat diet-induced obese rats. Mar. Drugs 2015, 13, 2732–2756. [Google Scholar] [CrossRef]
- Liao, A.H.; Ma, W.C.; Wu, M.F. Evaluation of ultrasound combined with chitosan for the control of weight and local fat in mice. Ultrasound Med. Biol. 2013, 39, 1794–1803. [Google Scholar] [CrossRef]
- Chiu, C.Y.; Yen, T.E.; Liu, S.H.; Chiang, M.T. Comparative effects and mechanisms of chitosan and its derivatives on hypercholesterolemia in high-fat diet-fed rats. Int. J. Mol. Sci. 2020, 21, 92. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.; Bansal, Y.; Medhi, B.; Kuhad, A. Antipsychotics-induced metabolic alterations: Recounting the mechanistic insights, therapeutic targets and pharmacological alternatives. Eur. J. Pharmacol. 2019, 844, 231–240. [Google Scholar] [CrossRef] [PubMed]
- Tang, D.; Wang, Y.; Kang, W.; Zhou, J.; Dong, R.; Feng, Q. Chitosan attenuates obesity by modifying the intestinal microbiota and increasing serum leptin levels in mice. J. Funct. Foods 2020, 64, 103659. [Google Scholar] [CrossRef]
- Shagdarova, B.; Konovalova, M.; Varlamov, V.; Svirshchevskaya, E. Anti-obesity effects of chitosan and its derivatives. Polymers 2023, 15, 3967. [Google Scholar] [CrossRef]
- Svirshchevskaya, E.V.; Zubareva, A.A.; Boyko, A.A.; Shustova, O.A.; Grechikhina, M.V.; Shagdarova, B.T.; Varlamov, V.P. Analysis of toxicity and biocompatibility of chitosan derivatives with different physico-chemical properties. Appl. Biochem. Microbiol. 2016, 52, 483–490. [Google Scholar] [CrossRef]
- Heck, A.M.; Yanovski, J.A.; Calis, K.A. Orlistat, a new lipase inhibitor for the management of obesity. Pharmacother. J. Hum. Pharmacol. Drug Ther. 2000, 20, 270–279. [Google Scholar] [CrossRef]
- Palomino, D.C.T.; Marti, L.C. Chemokines and immunity. Einstein 2015, 13, 469–473. [Google Scholar] [CrossRef]
- Reale, M.; Patruno, A.; De Lutiis, M.A.; Pesce, M.; Felaco, M.; Di Giannantonio, M.; Di Nicola, M.; Grilli, A. Dysregulation of chemo-cytokine production in schizophrenic patients versus healthy controls. BMC Neurosci. 2011, 12, 13. [Google Scholar] [CrossRef]
- Beumer, W.; Drexhage, R.C.; De Wit, H.; Versnel, M.A.; Drexhage, H.A.; Cohen, D. Increased level of serum cytokines, chemokines and adipokines in patients with schizophrenia is associated with disease and metabolic syndrome. Psychoneuroendocrinology 2012, 37, 1901–1911. [Google Scholar] [CrossRef]
- Dasdemir, S.; Kucukali, C.I.; Bireller, E.S.; Tuzun, E.; Cakmakoglu, B. Chemokine gene variants in schizophrenia. Nord. J. Psychiatry 2016, 70, 407–412. [Google Scholar] [CrossRef]
- Ermakov, E.A.; Mednova, I.A.; Boiko, A.S.; Buneva, V.N.; Ivanova, S.A. Chemokine dysregulation and neuroinflammation in schizophrenia: A systematic review. Int. J. Mol. Sci. 2023, 24, 2215. [Google Scholar] [CrossRef] [PubMed]
- Al Abadey, A.; Connor, B.; La Flamme, A.C.; Robichon, K. Clozapine reduces chemokine-mediated migration of lymphocytes by targeting NF-κB and AKT phosphorylation. Cell Signal. 2022, 99, 110449. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.L.; Tsai, T.C.; Wang, L.K.; Lin, Y.Y.; Tsai, Y.M.; Lee, M.C.; Tsai, F.M. Risperidone modulates the cytokine and chemokine release of dendritic cells and induces TNF-α-directed cell apoptosis in neutrophils. Int. Immunopharmacol. 2012, 12, 197–204. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.Y.; Zhou, D.F.; Cao, L.Y.; Zhang, P.Y.; Wu, G.Y.; Shen, Y.C. Changes in serum interleukin-2, -6, and -8 levels before and during treatment with risperidone and haloperidol. J. Clin. Psychiatry 2004, 65, 940–947. [Google Scholar] [CrossRef]
- Kowalchuk, C.; Kanagasundaram, P.; Belsham, D.D.; Hahn, M.K. Antipsychotics differentially regulate insulin, energy sensing, and inflammation pathways in hypothalamic rat neurons. Psychoneuroendocrinology 2019, 104, 42–48. [Google Scholar] [CrossRef]
- Manu, P.; Dima, L.; Shulman, M.; Vancampfort, D.; De Hert, M.; Correll, C.U. Weight gain and obesity in schizophrenia: Epidemiology, pathobiology, and management. Acta Psychiatr. Scand. 2015, 132, 97–108. [Google Scholar] [CrossRef]
- Grimm, O.; Kaiser, S.; Plichta, M.M.; Tobler, P.N. Altered reward anticipation: Potential explanation for weight gain in schizophrenia? Neurosci. Biobehav. Rev. 2017, 75, 91–103. [Google Scholar] [CrossRef]
- Singh, R.; Bansal, Y.; Sodhi, R.K.; Singh, D.P.; Bishnoi, M.; Kondepudi, K.K.; Medhi, B.; Kuhad, A. Berberine attenuated olanzapine-induced metabolic alterations in mice: Targeting transient receptor potential vanilloid type 1 and 3 channels. Life Sci. 2020, 247, 117442. [Google Scholar] [CrossRef]
- Singh, R.; Bansal, Y.; Sodhi, R.K.; Khare, P.; Bishnoi, M.; Kondepudi, K.K.; Medhi, B.; Kuhad, A. Role of TRPV1/TRPV3 channels in olanzapine-induced metabolic alteration: Possible involvement in hypothalamic energy-sensing, appetite regulation, inflammation and mesolimbic pathway. Toxicol. Appl. Pharmacol. 2020, 402, 115124. [Google Scholar] [CrossRef]
- Reznik, A.M.; Arbuzov, A.L.; Murin, S.P.; Pavlichenko, A.V. Negative symptoms of schizophrenia: New prospects of cariprazine treatment. Consort. Psychiatr. 2020, 1, 43–51. [Google Scholar] [CrossRef]
- Shagdarova, B.T.; Ilyina, A.V.; Lopatin, S.A.; Kartashov, M.I.; Arslanova, L.R.; Dzhavakhiya, V.G.; Varlamov, V.P. Study of the protective activity of chitosan hydrolyzate against septoria leaf blotch of wheat and brown spot of tobacco. Appl. Biochem. Microbiol. 2018, 54, 71–75. [Google Scholar] [CrossRef]
- Yamaguchi, R.; Arai, Y.; Itoh, T.; Hirano, S. Preparation of partially N-succinylated chitosans and their cross-linked gels. Carbohydr. Res. 1981, 88, 172–175. [Google Scholar] [CrossRef]
- Rathore, V.K.; Parikh, J.K. Chitosan: Derivatives, Properties and Applications. In Advances in Chemical, Bio and Environmental Engineering. CHEMBIOEN 2021. Environmental Science and Engineering; Ratan, J.K., Sahu, D., Pandhare, N.N., Bhavanam, A., Eds.; Springer: Cham, Switzerland, 2022; pp. 759–770. [Google Scholar] [CrossRef]
- Tang, W.; Wang, J.; Hou, H.; Li, Y.; Wang, J.; Fu, J.; Lu, L.; Gao, D.; Liu, Z.; Zhao, F.; et al. Review: Application of chitosan and its derivatives in medical materials. Int. J. Biol. Macromol. 2023, 240, 124398. [Google Scholar] [CrossRef] [PubMed]
- Kaczmarek, M.B.; Struszczyk-Swita, K.; Li, X.; Szczęsna-Antczak, M.; Daroch, M. Enzymatic Modifications of Chitin, Chitosan, and Chitooligosaccharides. Front. Bioeng. Biotechnol. 2019, 7, 481174. [Google Scholar] [CrossRef] [PubMed]
- Bashir, S.; Teo, Y.Y.; Ramesh, S.; Ramesh, K.; Khan, A.A. N-succinyl chitosan preparation, characterization, properties and biomedical applications: A state of the art review. Rev. Chem. Eng. 2015, 31, 563–597. [Google Scholar] [CrossRef]
- Baltzley, S.; Mohammad, A.; Malkawi, A.H.; Al-Ghananeem, A.M. Intranasal drug delivery of olanzapine-loaded chitosan nanoparticles. Ageing Int. 2014, 15, 1598–1602. [Google Scholar] [CrossRef]
- Veragten, A.; Contri, R.V.; Betti, A.H.; Herzfeldt, V.; Frank, L.A.; Pohlmann, A.R.; Rates, S.M.K.; Guterres, S.S. Chitosan-coated nanocapsules ameliorates the effect of olanzapine in prepulse inhibition of startle response (PPI) in rats following oral administration. React. Funct. Polym. 2020, 148, 104493. [Google Scholar] [CrossRef]
- Ma, X.; Xiao, W.; Li, H.; Pang, P.; Xue, F.; Wan, L.; Pei, L.; Yan, H. Metformin restores hippocampal neurogenesis and learning and memory via regulating gut microbiota in the obese mouse model. Brain. Behav. Immun. 2021, 95, 68–83. [Google Scholar] [CrossRef]
- Cope, M.B.; Nagy, T.R.; Fernández, J.R.; Geary, N.; Casey, D.E.; Allison, D.B. Antipsychotic drug-induced weight gain: Development of an animal model. Int. J. Obes. 2005, 29, 607–614. [Google Scholar] [CrossRef]
- Borén, J.; Taskinen, M.R.; Björnson, E.; Packard, C.J. Metabolism of triglyceride-rich lipoproteins in health and dyslipidaemia. Nat. Rev. Cardiol. 2022, 19, 577–592. [Google Scholar] [CrossRef]
- Sahebkar, A.; Simental-Mendía, L.E.; Reiner, Ž.; Kovanen, P.T.; Simental-Mendía, M.; Bianconi, V.; Pirro, M. Effect of orlistat on plasma lipids and body weight: A systematic review and meta-analysis of 33 randomized controlled trials. Pharmacol. Res. 2017, 122, 53–65. [Google Scholar] [CrossRef] [PubMed]
- Rakotoarivelo, V.; Variya, B.; Langlois, M.F.; Ramanathan, S. Chemokines in human obesity. Cytokine 2020, 127, 154953. [Google Scholar] [CrossRef] [PubMed]
- Lindberg, I.; Fricker, L.D. Obesity, POMC, and POMC-processing enzymes: Surprising results from animal models. Endocrinology 2021, 162, bqab155. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Deng, C.; Huang, X.F. The role of ghrelin signalling in second-generation antipsychotic-induced weight gain. Psychoneuroendocrinology 2013, 38, 2423–2438. [Google Scholar] [CrossRef] [PubMed]
- Rogge, G.; Jones, D.; Hubert, G.W.; Lin, Y.; Kuhar, M.J. CART peptides: Regulators of body weight, reward and other functions. Nat. Rev. Neurosci. 2008, 9, 747–758. [Google Scholar] [CrossRef]
- Nakhate, K.T.; Kokare, D.M.; Singru, P.S.; Subhedar, N.K. Central regulation of feeding behavior during social isolation of rat: Evidence for the role of endogenous CART system. Int. J. Obes. 2011, 35, 773–784. [Google Scholar] [CrossRef]
- Sikora, M.; Kopeć, B.; Piotrowska, K.; Pawlik, A. Role of allograft inflammatory factor-1 in pathogenesis of diseases. Immunol. Lett. 2020, 218, 1–4. [Google Scholar] [CrossRef]
- Lorente-Cebrián, S.; Decaunes, P.; Dungner, E.; Bouloumié, A.; Arner, P.; Dahlman, I. Allograft inflammatory factor 1 (AIF-1) is a new human adipokine involved in adipose inflammation in obese women. BMC Endocr. Disord. 2013, 13, 54. [Google Scholar] [CrossRef]
- Lin, S.; Storlien, L.H.; Huang, X.-F. Leptin receptor, NPY, POMC mRNA expression in the diet-induced obese mouse brain. Brain Res. 2000, 875, 89–95. [Google Scholar] [CrossRef]
- Viana, T.G.; Almeida-Santos, A.F.; Aguiar, D.C.; Moreira, F.A. Effects of aripiprazole, an atypical antipsychotic, on the motor alterations induced by acute ethanol administration in mice. Basic Clin. Pharmacol. Toxicol. 2013, 112, 319–324. [Google Scholar] [CrossRef]
- Picada, J.N.; Dos Santos, B.D.J.N.; Celso, F.; Monteiro, J.D.; Da Rosa, K.M.; Camacho, L.R.; Vieira, L.R.; Freitas, T.M.; Da Silva, T.G.; Pontes, V.M.; et al. Neurobehavioral and genotoxic parameters of antipsychotic agent aripiprazole in mice. Acta Pharmacol. Sin. 2011, 32, 1225–1232. [Google Scholar] [CrossRef][Green Version]
- Wang, X.; Li, Y.; Wu, L.; Xiao, S.; Ji, Y.; Tan, Y.; Jiang, C.; Zhang, G. Dysregulation of the gut-brain-skin axis and key overlapping inflammatory and immune mechanisms of psoriasis and depression. Biomed. Pharmacother. 2021, 137, 111065. [Google Scholar] [CrossRef]






| Week | Olanzapine | Chitosan | N-Succinyl Chitosan | Orlistat | Peanut Oil, μL |
|---|---|---|---|---|---|
| 1 | 6 | 300 | 300 | 50 | 40 |
| 2 | 8 | 400 | 400 | 100 | 40 |
| 3 | 10 | 500 | 500 | 200 | 40 |
| 4–7 | 12 | 600 | 600 | 300 | 40 |
| № | Gene | Forward Primer | Reverse Primer |
|---|---|---|---|
| 1 | NPY | GTAACAAGCGAATGGGGCTG | TGATGTAGTGTCGCAGAGCG |
| 2 | AgRP | TGTGTAAGGCTGCACGAGTC | CATCCATTGGCTAGGTGCGA |
| 3 | POMC | CCATTAGGCTTGGAGCAGGT | GTGCGCGTTCTTGATGATGG |
| 4 | CART | TCCCTCTTTCCCCCAAAGGA | CACACCAACACCATTCGAGG |
| 5 | TRPV1 | AGGGCCAGACAGCATTACAC | GGAACTTCACAATGGCCAGC |
| 6 | TRPV3 | GCCAGGACCATCTTGGAGTT | CTTGTTTAAATCTGCTGTCCGTC |
| 7 | GFAP | GGCGAAGAAAACCGCATCAC | CTTGTGCTCCTGCTTCGAGT |
| 8 | AIF-1 | TCCGAGGAGACGTTCAGCTA | CGTGTGACATCCACCTCCAA |
| 9 | NF-kB1 | GAGGTCTCTGGGGGTACCAT | TTGCGGAAGGATGTCTCCAC |
| 10 | GAPDH | GGAGAGTGTTTCCTCGTCCC | ACTGTGCCGTTGAATTTGCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shagdarova, B.; Melnikova, V.; Kostenko, V.; Konovalova, M.; Zhuikov, V.; Varlamov, V.; Svirshchevskaya, E. Effects of Chitosan and N-Succinyl Chitosan on Metabolic Disorders Caused by Oral Administration of Olanzapine in Mice. Biomedicines 2024, 12, 2358. https://doi.org/10.3390/biomedicines12102358
Shagdarova B, Melnikova V, Kostenko V, Konovalova M, Zhuikov V, Varlamov V, Svirshchevskaya E. Effects of Chitosan and N-Succinyl Chitosan on Metabolic Disorders Caused by Oral Administration of Olanzapine in Mice. Biomedicines. 2024; 12(10):2358. https://doi.org/10.3390/biomedicines12102358
Chicago/Turabian StyleShagdarova, Balzhima, Viktoria Melnikova, Valentina Kostenko, Mariya Konovalova, Vsevolod Zhuikov, Valery Varlamov, and Elena Svirshchevskaya. 2024. "Effects of Chitosan and N-Succinyl Chitosan on Metabolic Disorders Caused by Oral Administration of Olanzapine in Mice" Biomedicines 12, no. 10: 2358. https://doi.org/10.3390/biomedicines12102358
APA StyleShagdarova, B., Melnikova, V., Kostenko, V., Konovalova, M., Zhuikov, V., Varlamov, V., & Svirshchevskaya, E. (2024). Effects of Chitosan and N-Succinyl Chitosan on Metabolic Disorders Caused by Oral Administration of Olanzapine in Mice. Biomedicines, 12(10), 2358. https://doi.org/10.3390/biomedicines12102358

