Enriched Environment Induces Sex-Specific Changes in the Adult Neurogenesis, Cytokine and miRNA Expression in Rat Hippocampus
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Enriched Environment Protocol
2.2. Behavior Phenotyping
2.3. Brain Dissection
2.4. Real-Time Polymerase Chain Reaction
miRNA Extraction and Analysis
2.5. Immunohistochemistry
2.6. Statistical Analysis
3. Results
3.1. EE Rats Showed a Decrease in Activity and Some Signs of Anxiety, but Performed Better Than SH Animals in the Barnes Maze
3.2. The Expression Levels of Neurogenesis Markers, Syn1 and IL-10 Increased Only in EE Females
3.3. Expression Levels of IL-10Ra, JAK, STAT3 and STAT5a Increased Only in EE Females
3.4. Hippocampal microRNA Expression Profiles Change Differently in Females and Males after EE
3.5. The Number of KI67+ Cells Decreases, While the Number of DCX+ Cells Increases in the Dentate Gyrus of EE Females, with No Such Changes in EE Males
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Krech, D.; Rosenzweig, M.R.; Bennett, E.L. Effects of environmental complexity and training on brain chemistry. J. Comp. Physiol. Psychol. 1960, 53, 509–519. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rosenzweig, M.R.; Krech, D.; Bennett, E.L.; Diamond, M.C. Effects of environmental complexity and training on brain chemistry and anatomy: A replication and extension. J. Comp. Physiol. Psychol. 1962, 55, 429–437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferchmin, P.A.; Bennett, E.L.; Rosenzweig, M.R. Direct contact with enriched environment is required to alter cerebral weights in rats. J. Comp. Physiol. Psychol. 1975, 88, 360–367. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rosenzweig, M.R.; Bennett, E.L.; Hebert, M.; Morimoto, H. Social grouping cannot account for cerebral effects of enriched environments. Brain Res. 1978, 153, 563–576. [Google Scholar] [CrossRef] [Scilit]
- Ormond, J.; O’keefe, J. Hippocampal place cells have goal-oriented vector fields during navigation. Nature 2022, 607, 741–746. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuhn, H.G.; Toda, T.; Gage, F.H. Adult Hippocampal Neurogenesis: A Coming-of-Age Story. J. Neurosci. 2018, 38, 10401–10410. [Google Scholar] [CrossRef] [Scilit]
- Toda, T.; Gage, F.H. Review: Adult neurogenesis contributes to hippocampal plasticity. Cell Tissue Res. 2018, 373, 693–709. [Google Scholar] [CrossRef] [Scilit]
- Lever, C.; Burton, S.; Jeewajee, A.; Wills, T.; Cacucci, F.; Burgess, N.; O'Keefe, J. Environmental novelty elicits a later theta phase of firing in CA1 but not subiculum. Hippocampus 2010, 20, 229–234. [Google Scholar] [CrossRef] [Scilit]
- Wu, Y.; Liu, T.; Wang, X.; Meng, Z.-X.; Chen, Y.-Z.; Li, Y.-P.; Zhou, H.-Y.; Yang, M.; Zhao, T.-T.; Gong, Y.-L. Enriched environment enhances histone acetylation of NMDA receptor in the hippocampus and improves cognitive dysfunction in aged mice. Neural Regen. Res. 2020, 15, 2327–2334. [Google Scholar] [CrossRef] [Scilit]
- Cordier, J.M.; Aguggia, J.P.; Danelon, V.; Mir, F.R.; Rivarola, M.A.; Mascó, D. Postweaning Enriched Environment Enhances Cognitive Function and Brain-Derived Neurotrophic Factor Signaling in the Hippocampus in Maternally Separated Rats. Neuroscience 2021, 453, 138–147. [Google Scholar] [CrossRef] [Scilit]
- Grońska-Pęski, M.; Gonçalves, J.T.; Hébert, J.M. Enriched Environment Promotes Adult Hippocampal Neurogenesis through FGFRs. J. Neurosci. 2021, 41, 2899–2910. [Google Scholar] [CrossRef] [Scilit]
- Jurgens, H.A.; Johnson, R.W. Environmental enrichment attenuates hippocampal neuroinflammation and improves cognitive function during influenza infection. Brain Behav. Immun. 2012, 26, 1006–1016. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meng, Z.-X.; Wang, X.; Zhou, H.-Y.; Huai, Y.-P.; Jin, X.; Yan, P.; Tang, X.-J.; Wang, J.-Y.; Shi, N.; Niu, M. An enriched environment reduces hippocampal inflammatory response and improves cognitive function in a mouse model of stroke. Neural Regen. Res. 2022, 17, 2497–2503. [Google Scholar] [CrossRef] [Scilit]
- Wu, Y.; Mitra, R. Prefrontal-hippocampus plasticity reinstated by an enriched environment during stress. Neurosci. Res. 2021, 170, 360–363. [Google Scholar] [CrossRef] [Scilit]
- Harland, B.C.; Dalrymple-Alford, J.C. Enriched Environment Procedures for Rodents: Creating a Standardized Protocol for Diverse Enrichment to Improve Consistency across Research Studies. Bio-Protocol 2020, 10, e3637. [Google Scholar] [CrossRef] [Scilit]
- Rosenzweig, M. Modification of Brain Circuits through Experience. In Neural Plasticity and Memory; CRC Press/Taylor & Francis: Boca Raton, FL, USA, 2007; pp. 67–94. [Google Scholar] [CrossRef] [Scilit]
- van de Weerd, H.A.; Baumans, V.; Koolhaas, J.M.; van Zutphen, L.F. Strain specific behavioural response to environmental enrichment in the mouse. J. Exp. Anim. Sci. 1994, 36, 117–127. [Google Scholar]
- Fuss, J.; Ben Abdallah, N.M.-B.; Vogt, M.A.; Touma, C.; Pacifici, P.G.; Palme, R.; Witzemann, V.; Hellweg, R.; Gass, P. Voluntary exercise induces anxiety-like behavior in adult C57BL/6J mice correlating with hippocampal neurogenesis. Hippocampus 2009, 20, 364–376. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Monček, F.; Duncko, R.; Johansson, B.B.; Ježová, D. Effect of Environmental Enrichment on Stress Related Systems in Rats. J. Neuroendocr. 2004, 16, 423–431. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leschik, J.; Lutz, B.; Gentile, A. Stress-Related Dysfunction of Adult Hippocampal Neurogenesis—An Attempt for Understanding Resilience? Int. J. Mol. Sci. 2021, 22, 7339. [Google Scholar] [CrossRef] [Scilit]
- Yagi, S.; Galea, L.A.M. Sex differences in hippocampal cognition and neurogenesis. Neuropsychopharmacology 2019, 44, 200–213. [Google Scholar] [CrossRef] [Scilit]
- Pitts, M.W. Barnes Maze Procedure for Spatial Learning and Memory in Mice. Bio-Protocol 2018, 8, e2744. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Milligan, E.D.; Sloane, E.M.; Langer, S.J.; Hughes, T.S.; Jekich, B.M.; Frank, M.G.; Mahoney, J.H.; Levkoff, L.H.; Maier, S.F.; Cruz, P.E.; et al. Repeated intrathecal injections of plasmid DNA encoding interleukin-10 produce prolonged reversal of neuropathic pain. Pain 2006, 126, 294–308. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mohammadian, J.; Najafi, M.; Miladi-Gorji, H. Effect of enriched environment during adolescence on spatial learning and memory, and voluntary consumption of morphine in maternally separated rats in adulthood. Dev. Psychobiol. 2019, 61, 615–625. [Google Scholar] [CrossRef] [Scilit]
- Kaptan, Z.; Dar, K.A.; Kapucu, A.; Bulut, H.; Üzüm, G. Effect of enriched environment and predictable chronic stress on spatial memory in adolescent rats: Predominant expression of BDNF, nNOS, and interestingly malondialdehyde in the right hippocampus. Brain Res. 2019, 1721, 146326. [Google Scholar] [CrossRef] [Scilit]
- Ramos, J.M. Rapid decay of spatial memory acquired in rats with ventral hippocampus lesions. Behav. Brain Res. 2022, 431, 113962. [Google Scholar] [CrossRef] [Scilit]
- Spellman, T.; Rigotti, M.; Ahmari, S.E.; Fusi, S.; Gogos, J.A.; Gordon, J.A. Hippocampal–prefrontal input supports spatial encoding in working memory. Nature 2015, 522, 309–314. [Google Scholar] [CrossRef] [Scilit]
- Snyder, J.; Hong, N.; McDonald, R.; Wojtowicz, J. A role for adult neurogenesis in spatial long-term memory. Neuroscience 2005, 130, 843–852. [Google Scholar] [CrossRef] [Scilit]
- Wojtowicz, J.M.; Askew, M.L.; Winocur, G. The effects of running and of inhibiting adult neurogenesis on learning and memory in rats. Eur. J. Neurosci. 2008, 27, 1494–1502. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Madsen, T.; Kristjansen, P.; Bolwig, T.; Wörtwein, G. Arrested neuronal proliferation and impaired hippocampal function following fractionated brain irradiation in the adult rat. Neuroscience 2003, 119, 635–642. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guitar, N.A.; Sherry, D.F. Decreased Neurogenesis Increases Spatial Reversal Errors in Chickadees (Poecile atricapillus). Dev. Neurobiol. 2018, 78, 1206–1217. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Epp, J.; Spritzer, M.; Galea, L. Hippocampus-dependent learning promotes survival of new neurons in the dentate gyrus at a specific time during cell maturation. Neuroscience 2007, 149, 273–285. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Safari, S.; Ahmadi, N.; Mohammadkhani, R.; Ghahremani, R.; Khajvand-Abedeni, M.; Shahidi, S.; Komaki, A.; Salehi, I.; Karimi, S.A. Sex differences in spatial learning and memory and hippocampal long-term potentiation at perforant pathway-dentate gyrus (PP-DG) synapses in Wistar rats. Behav. Brain Funct. 2021, 17, 9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, W.; Liu, B.; Li, X.; Wang, P.; Wang, B. Sex Differences in Spatial Memory. Neuroscience 2020, 443, 140–147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goode, L.K.; Fusilier, A.R.; Remiszewski, N.; Reeves, J.M.; Abiraman, K.; Defenderfer, M.; Paul, J.R.; McMahon, L.L.; Gamble, K.L. Examination of Diurnal Variation and Sex Differences in Hippocampal Neurophysiology and Spatial Memory. Eneuro 2022, 9, 1–17. [Google Scholar] [CrossRef] [Scilit]
- Vinogradova, A.V.; Smirnova, P.A.; Yakovchuk, Z.Y.; Tuchina, O.P. Ihe role of physical activity in the processes of neurogenesis in the hippocampus. Mol. Med. 2022, 20, 22–27. [Google Scholar] [CrossRef] [Scilit]
- van Praag, H.; Kempermann, G.; Gage, F.H. Running increases cell proliferation and neurogenesis in the adult mouse dentate gyrus. Nat. Neurosci. 1999, 2, 266–270. [Google Scholar] [CrossRef] [Scilit]
- Inoue, K.; Okamoto, M.; Shibato, J.; Lee, M.C.; Matsui, T.; Rakwal, R.; Soya, H. Long-Term Mild, rather than Intense, Exercise Enhances Adult Hippocampal Neurogenesis and Greatly Changes the Transcriptomic Profile of the Hippocampus. PLoS ONE 2015, 10, e0128720. [Google Scholar] [CrossRef] [Scilit]
- Kobilo, T.; Liu, Q.-R.; Gandhi, K.; Mughal, M.; Shaham, Y.; van Praag, H. Running is the neurogenic and neurotrophic stimulus in environmental enrichment. Learn. Mem. 2011, 18, 605–609. [Google Scholar] [CrossRef] [Scilit]
- Kempermann, G. Environmental enrichment, new neurons and the neurobiology of individuality. Nat. Rev. Neurosci. 2019, 20, 235–245. [Google Scholar] [CrossRef] [Scilit]
- Braun, K.; Häberle, B.M.; Wittmann, M.-T.; Lie, D.C. Enriched environment ameliorates adult hippocampal neurogenesis deficits in Tcf4 haploinsufficient mice. BMC Neurosci. 2020, 21, 50. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kurilova, E.; Sidorova, M.; Tuchina, O. Single Prolonged Stress Decreases the Level of Adult Hippocampal Neurogenesis in C57BL/6, but Not in House Mice. Curr. Issues Mol. Biol. 2023, 45, 524–537. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shalaginova, I.G.; Tuchina, O.P.; Sidorova, M.V.; Levina, A.S.; Khlebaeva, D.A.-A.; Vaido, A.I.; Dyuzhikova, N.A. Effects of psychogenic stress on some peripheral and central inflammatory markers in rats with the different level of excitability of the nervous system. PLoS ONE 2021, 16, e0255380. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patlay, N.I.; Sotnikov, E.B.; Tuchina, O.P. The role of microglial cytokines in the modulation of neurogenesis in the adult brain. Int. J. Appl. Fundam. Res. 2020, 5, 15–23. [Google Scholar] [CrossRef] [Scilit]
- Leal, G.; Bramham, C.R.; Duarte, C.B. BDNF and Hippocampal Synaptic Plasticity. Vitam Horm. 2017, 104, 153–195. [Google Scholar] [CrossRef] [Scilit]
- Ropelle, E.R.; Flores, M.B.; Cintra, D.; Rocha, G.; Pauli, J.R.; Morari, J.; De Souza, C.T.; Moraes, J.C.; Prada, P.D.O.; Guadagnini, D.; et al. IL-6 and IL-10 Anti-Inflammatory Activity Links Exercise to Hypothalamic Insulin and Leptin Sensitivity through IKKβ and ER Stress Inhibition. PLoS Biol. 2010, 8, e1000465. [Google Scholar] [CrossRef] [Scilit]
- Lobo-Silva, D.; Carriche, G.M.; Gil Castro, A.; Roque, S.; Saraiva, M. Balancing the immune response in the brain: IL-10 and its regulation. J. Neuroinflammation 2016, 13, 297. [Google Scholar] [CrossRef] [Scilit]
- Perez-Asensio, F.J.; Perpiñá, U.; Planas, A.M.; Pozas, E. Interleukin-10 regulates progenitor differentiation and modulates neurogenesis on adult brain. J. Cell Sci. 2013, 126, 4208–4219. [Google Scholar] [CrossRef] [Scilit]
- Pereira, L.; Font-Nieves, M.; Haute, C.V.D.; Baekelandt, V.; Planas, A.M.; Pozas, E. IL-10 regulates adult neurogenesis by modulating ERK and STAT3 activity. Front. Cell. Neurosci. 2015, 9, 57. [Google Scholar] [CrossRef] [Scilit]
- de León-Guerrero, S.D.; Salazar-León, J.; Meza-Sosa, K.F.; Valle-Garcia, D.; Aguilar-León, D.; Pedraza-Alva, G.; Pérez-Martínez, L. An enriched environment re-establishes metabolic homeostasis by reducing obesity-induced inflammation. Dis. Model. Mech. 2022, 15, dmm048936. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Yuan, M.; Yang, S.; Chen, X.; Wu, J.; Wen, M.; Yan, K.; Bi, X. Enriched environment improves post-stroke cognitive impairment and inhibits neuroinflammation and oxidative stress by activating Nrf2-ARE pathway. Int. J. Neurosci. 2021, 131, 641–649. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lang, M.-F.; Shi, Y. Dynamic Roles of microRNAs in Neurogenesis. Front. Neurosci. 2012, 6, 71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Petri, R.; Pircs, K.; Jönsson, M.E.; Åkerblom, M.; Brattås, P.L.; Klussendorf, T.; Jakobsson, J. let-7 regulates radial migration of new-born neurons through positive regulation of autophagy. EMBO J. 2017, 36, 1379–1391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Chevigny, A.; Coré, N.; Follert, P.; Gaudin, M.; Barbry, P.; Béclin, C.; Cremer, H. miR-7a regulation of Pax6 controls spatial origin of forebrain dopaminergic neurons. Nat. Neurosci. 2012, 15, 1120–1126. [Google Scholar] [CrossRef] [Scilit]
- Cho, K.J.; Song, J.; Oh, Y.; Lee, J.E. MicroRNA-Let-7a regulates the function of microglia in inflammation. Mol. Cell. Neurosci. 2015, 68, 167–176. [Google Scholar] [CrossRef] [Scilit]
- Chafin, C.B.; Regna, N.L.; Caudell, D.L.; Reilly, C.M. MicroRNA-let-7a promotes E2F-mediated cell proliferation and NFκB activation in vitro. Cell. Mol. Immunol. 2014, 11, 79–83. [Google Scholar] [CrossRef] [Scilit]
- Yan, T.; Wang, X.; Wei, G.; Li, H.; Hao, L.; Liu, Y.; Yu, X.; Zhu, W.; Liu, P.; Zhu, Y.; et al. Exosomal miR-10b-5p mediates cell communication of gastric cancer cells and fibroblasts and facilitates cell proliferation. J. Cancer 2021, 12, 2140–2150. [Google Scholar] [CrossRef] [Scilit]
- Hoss, A.G.; Labadorf, A.; Latourelle, J.C.; Kartha, V.K.; Hadzi, T.C.; Gusella, J.F.; MacDonald, M.E.; Chen, J.-F.; Akbarian, S.; Weng, Z.; et al. miR-10b-5p expression in Huntington’s disease brain relates to age of onset and the extent of striatal involvement. BMC Med. Genom. 2015, 8, 10. [Google Scholar] [CrossRef] [Scilit]
- Li, B.; Yang, C.; Zhu, Z.; Chen, H.; Qi, B. Hypoxic glioma-derived extracellular vesicles harboring MicroRNA-10b-5p enhance M2 polarization of macrophages to promote the development of glioma. CNS Neurosci. Ther. 2022, 28, 1733–1747. [Google Scholar] [CrossRef] [Scilit]
- Xu, W.; Li, X.; Chen, L.; Luo, X.; Shen, S.; Wang, J. Dexmedetomidine pretreatment alleviates ropivacaine-induced neurotoxicity via the miR-10b-5p/BDNF axis. BMC Anesthesiol. 2022, 22, 304. [Google Scholar] [CrossRef] [Scilit]
- Ke, X.; Huang, Y.; Fu, Q.; Lane, R.H.; Majnik, A. Adverse Maternal Environment Alters MicroRNA-10b-5p Expression and Its Epigenetic Profile Concurrently with Impaired Hippocampal Neurogenesis in Male Mouse Hippocampus. Dev. Neurosci. 2021, 43, 95–105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Budde, H.; Schmitt, S.; Fitzner, D.; Opitz, L.; Salinas-Riester, G.; Simons, M. Control of oligodendroglial cell number by the miR-17-92 cluster. Development 2010, 137, 2127–2132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rajman, M.; Schratt, G. MicroRNAs in neural development: From master regulators to fine-tuners. Development 2017, 144, 2310–2322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cho, J.A.; Park, H.; Lim, E.H.; Lee, K.W. MicroRNA expression profiling in neurogenesis of adipose tissue-derived stem cells. J. Genet. 2011, 90, 81–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, D.; Li, T.; Wang, Y.; Tang, Y.; Cui, H.; Tang, Y.; Zhang, X.; Chen, D.; Shen, N.; Le, W. miR-132 regulates the differentiation of dopamine neurons by directly targeting Nurr1 expression. J. Cell Sci. 2012, 125, 1673–1682. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marler, K.J.; Suetterlin, P.; Dopplapudi, A.; Rubikaite, A.; Adnan, J.; Maiorano, N.A.; Lowe, A.S.; Thompson, I.D.; Pathania, M.; Bordey, A.; et al. BDNF Promotes Axon Branching of Retinal Ganglion Cells via miRNA-132 and p250GAP. J. Neurosci. 2014, 34, 969–979. [Google Scholar] [CrossRef] [Scilit]
- Magill, S.T.; Cambronne, X.A.; Luikart, B.W.; Lioy, D.T.; Leighton, B.H.; Westbrook, G.L.; Mandel, G.; Goodman, R.H. microRNA-132 regulates dendritic growth and arborization of newborn neurons in the adult hippocampus. Proc. Natl. Acad. Sci. USA 2010, 107, 20382–20387. [Google Scholar] [CrossRef] [Scilit]
- Remenyi, J.; Bosch, M.W.M.V.D.; Palygin, O.; Mistry, R.B.; McKenzie, C.; Macdonald, A.; Hutvagner, G.; Arthur, J.S.C.; Frenguelli, B.G.; Pankratov, Y. miR-132/212 Knockout Mice Reveal Roles for These miRNAs in Regulating Cortical Synaptic Transmission and Plasticity. PLoS ONE 2013, 8, e62509. [Google Scholar] [CrossRef] [Scilit]
- Mellios, N.; Sugihara, H.; Castro, J.; Banerjee, A.; Le, C.; Kumar, A.; Crawford, B.; Strathmann, J.; Tropea, D.; Levine, S.; et al. miR-132, an experience-dependent microRNA, is essential for visual cortex plasticity. Nat. Neurosci. 2011, 14, 1240–1242. [Google Scholar] [CrossRef] [Scilit]
- Hansen, K.F.; Karelina, K.; Sakamoto, K.; Wayman, G.A.; Impey, S.; Obrietan, K. miRNA-132: A dynamic regulator of cognitive capacity. Anat. Embryol. 2013, 218, 817–831. [Google Scholar] [CrossRef] [Scilit]
- Schratt, G.M.; Tuebing, F.; Nigh, E.A.; Kane, C.G.; Sabatini, M.E.; Kiebler, M.; Greenberg, M.E. A brain-specific microRNA regulates dendritic spine development. Nature 2006, 439, 283–289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, C.; Zhu, X.; Song, Q.; Wang, P.; Liu, Z.; Yu, S.Y. MiR-134 modulates chronic stress-induced structural plasticity and depression-like behaviors via downregulation of Limk1/cofilin signaling in rats. Neuropharmacology 2018, 131, 364–376. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Siemen, H.; Colas, D.; Heller, H.C.; Brüstle, O.; Pera, R.A.R. Pumilio-2 Function in the Mouse Nervous System. PLoS ONE 2011, 6, e25932. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pons-Espinal, M.; de Luca, E.; Marzi, M.J.; Beckervordersandforth, R.; Armirotti, A.; Nicassio, F.; Fabel, K.; Kempermann, G.; Tonelli, D.D.P. Synergic Functions of miRNAs Determine Neuronal Fate of Adult Neural Stem Cells. Stem Cell Rep. 2017, 8, 1046–1061. [Google Scholar] [CrossRef] [Scilit]
- Xu, B.; Hsu, P.-K.; Stark, K.L.; Karayiorgou, M.; Gogos, J.A. Derepression of a Neuronal Inhibitor due to miRNA Dysregulation in a Schizophrenia-Related Microdeletion. Cell 2013, 152, 262–275. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shih, R.-H.; Wang, C.-Y.; Yang, C.-M. NF-kappaB Signaling Pathways in Neurological Inflammation: A Mini Review. Front. Mol. Neurosci. 2015, 8, 77. [Google Scholar] [CrossRef] [Scilit]
- Deng, Z.-F.; Zheng, H.-L.; Chen, J.-G.; Luo, Y.; Xu, J.-F.; Zhao, G.; Lu, J.-J.; Li, H.-H.; Gao, S.-Q.; Zhang, D.-Z.; et al. miR-214-3p Targets β-Catenin to Regulate Depressive-like Behaviors Induced by Chronic Social Defeat Stress in Mice. Cereb. Cortex 2019, 29, 1509–1519. [Google Scholar] [CrossRef] [Scilit]
- Thiebes, K.P.; Nam, H.; Cambronne, X.A.; Shen, R.; Glasgow, S.M.; Cho, H.-H.; Kwon, J.-S.; Goodman, R.H.; Lee, J.W.; Lee, S.; et al. miR-218 is essential to establish motor neuron fate as a downstream effector of Isl1–Lhx3. Nat. Commun. 2015, 6, 8227. [Google Scholar] [CrossRef] [Scilit]
- Torres-Berrío, A.; Nouel, D.; Cuesta, S.; Parise, E.M.; Restrepo-Lozano, J.M.; Larochelle, P.; Nestler, E.J.; Flores, C. MiR-218: A molecular switch and potential biomarker of susceptibility to stress. Mol. Psychiatry 2020, 25, 951–964. [Google Scholar] [CrossRef] [Scilit]
- Cao, F.; Liu, T.; Sun, S.; Feng, S. The role of the miR-99b-5p/mTOR signaling pathway in neuroregeneration in mice following spinal cord injury. Mol. Med. Rep. 2017, 16, 9355–9360. [Google Scholar] [CrossRef] [Scilit]
- Shi, Y.; Bo, Z.; Pang, G.; Qu, X.; Bao, W.; Yang, L.; Ma, Y. MiR-99a-5p regulates proliferation, migration and invasion abilities of human oral carcinoma cells by targeting NOX4. Neoplasma 2017, 64, 666–673. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, Q.; Wang, Y.; Shi, X.; Assoni, A.; Coatti, G.; Valadares, M.C.; Beccari, M.; Gomes, J.; Pelatti, M.; Mitne-Neto, M.; et al. Propofol Inhibits Neurogenesis of Rat Neural Stem Cells by Upregulating MicroRNA-141-3p. Stem Cells Dev. 2017, 26, 189–196. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, C.-Z.; Yang, J.; Liu, Q.-H.; Wang, Y.-R.; Wang, W.-S. Up-regulated miR-192-5p expression rescues cognitive impairment and restores neural function in mice with depression via the Fbln2 -mediated TGF-β1 signaling pathway. FASEB J. 2019, 33, 606–618. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Niu, X.; Zhu, H.-L.; Liu, Q.; Yan, J.-F.; Li, M.-L. MiR-194-5p serves as a potential biomarker and regulates the proliferation and apoptosis of hippocampus neuron in children with temporal lobe epilepsy. J. Chin. Med. Assoc. 2021, 84, 510–516. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Li, Z.; Zuo, Q. miR-194-5p inhibits LPS-induced astrocytes activation by directly targeting neurexophilin 1. Mol. Cell. Biochem. 2020, 471, 203–213. [Google Scholar] [CrossRef] [Scilit]
- Trattnig, C.; Üçal, M.; Tam-Amersdorfer, C.; Bucko, A.; Zefferer, U.; Grünbacher, G.; Absenger-Novak, M.; Öhlinger, K.A.; Kraitsy, K.; Hamberger, D.; et al. MicroRNA-451a overexpression induces accelerated neuronal differentiation of Ntera2/D1 cells and ablation affects neurogenesis in microRNA-451a-/- mice. PLoS ONE 2018, 13, e0207575. [Google Scholar] [CrossRef] [Scilit]
- Liu, W.; Liu, S.-Y.; He, Y.-B.; Huang, R.-L.; Deng, S.-Y.; Ni, G.-X.; Yu, B. MiR-451 suppresses proliferation, migration and promotes apoptosis of the human osteosarcoma by targeting macrophage migration inhibitory factor. Biomed. Pharmacother. 2017, 87, 621–627. [Google Scholar] [CrossRef] [Scilit]
- Sempere, L.F.; Freemantle, S.; Pitha-Rowe, I.; Moss, E.; Dmitrovsky, E.; Ambros, V. Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation. Genome Biol. 2004, 5, R13. [Google Scholar] [CrossRef] [Scilit]
- Chorghay, Z.; Káradóttir, R.T.; Ruthazer, E.S. White Matter Plasticity Keeps the Brain in Tune: Axons Conduct While Glia Wrap. Front. Cell. Neurosci. 2018, 12, 428. [Google Scholar] [CrossRef] [Scilit]
- Zheng, Z.; Huang, G.; Gao, T.; Huang, T.; Zou, M.; Zou, Y.; Duan, S. Epigenetic Changes Associated With Interleukin-10. Front. Immunol. 2020, 11, 1105. [Google Scholar] [CrossRef] [Scilit]
- Fan, C.; Li, Y.; Lan, T.; Wang, W.; Long, Y.; Yu, S.Y. Microglia secrete miR-146a-5p-containing exosomes to regulate neurogenesis in depression. Mol. Ther. 2022, 30, 1300–1314. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Gene | Accession No. | Forward (5′-3′) | Reverse (5′-3′) | Amplicon, bp |
|---|---|---|---|---|
| Ki-67 | NM_001271366.1 | GCACAGAGCCTTAGCAATAG | GGTGCTTCTACTGGACTTTG | 198 |
| DCX | NM_053379.3 | CTCAAGCCAGAGAGAACAAG | GCTTTCCATCAAGGGTATAGAG | 201 |
| Nestin | NM_001308239.1 | AGGAGTGGGAACTGAGGATAAG | TGAGCAACTGGGACCTCTAA | 201 |
| IL-10 [23] | NM_012854.2 | TAAGGGTTACTTGGGTTGCC | TATCCAGAGGGTCTTCAGC | 142 |
| IL-10RA | NM_057193.2 | CCCATGAACTTGTCCCTCTG | GAAACCTTATCCCCTGTCACTC | 129 |
| JAK1 | NM_053466.1 | GGACACTGGACAACCGAATAA | TTGTGGCAGAGAGGAGAGATA | 248 |
| STAT1 | NM_032612.3 | TTGAGCCCTACACGAAGAAAG | GGTGGACTTCAGACACAGAAA | 249 |
| STAT3 | NM_012747.2 | GGGCATCAATCCTGTGGTATAA | GGAATGTCAGGGTAGAGGTAGA | 613 |
| STAT5A | NM_017064.2 | AGGAAGGGAGGCAAGTTTATG | CCGCAGCCCATATTCACTAA | 182 |
| STAT5B | NM_022380.2 | CAGTTCAGTGTTGGTGGAAATG | CCAGTGAGGCTTGAGATGTT | 429 |
| IL-1β | NM_031512.2 | GCAATGGTCGGGACATAGTT | GTAAGTGGTTGCCTGTCAGAG | 242 |
| TNF-α | NM_012675.3 | GAACAGCAACTCCAGAACA | CACGAGCAGGAATGAGAAG | 243 |
| IFN-γ | NM_138880.3 | ATCTCTTTCTACCTCAGACTCTTTG | TTGCTTTACTGTTGCTGAAGAAG | 115 |
| BDNF | NM_001270638.1 | GAGACAAGAACACAGGAGGAAA | CCCAAGAGGTAAAGTGTAGAAGG | 106 |
| Syn1 | NM_019133.2 | CCTCTTCAAATGCCACCTACTA | GGTTTCTGGAGGAAGGAACTTA | 133 |
| GAPDH | NM_017008.4 | GCTGTGGGCAAGGTCATCC | CTTCACCACCTTCTTGATGTC | 144 |
| miRNA | Function | Fold Change/p-Value Based on Our Results (SNOR95) |
|---|---|---|
| Females | ||
| miR-let-7i-5p | Reduces proliferation and promotes both neuronal and astroglial differentiation [53]. | 1.56/0.006 |
| Crucial for the functional radial migration and maturation of olfactory bulb interneurons [54]. | ||
| miR-7a-5p | Inhibits Pax6 and promotes differentiation of dopaminergic neurons [55]. | 2.16/0.02 |
| Regulates the function of microglia in inflammation [56]. | ||
| Promotes E2F-mediated cell proliferation and NFκB activation in vitro [57]. | ||
| miR-10b-5p | Mediates cell communication of fibroblasts and facilitates cell proliferation [58]. | 1.55/0.02 |
| Biomarker in Huntingtons disease [59]. | ||
| Enhances M2 polarization of macrophages [60]. | ||
| Overexpression reduces BDNF expression and elevated apoptosis rate in vitro [61]. | ||
| Upregulation leads to decreased BDNF levels in mice [62]. | ||
| miR-18a-5p | Regulates oligodendrocyte differentiation [63]. | 2.28/0.02 |
| miR-20a-5p | Inhibits CCND1 and promotes neuronal differentiation [64]. Regulates oligodendrocyte differentiation [63]. | 1.99/0.02 |
| miR-103-3p | Regulates morphogenesis of new neurons during their differentiation [65]. | 1.54/0.02 |
| miR-132-3p | Inhibits Nurr1 and promotes differentiation of dopaminergic neurons [66]. Promotes axonal branching by inhibiting the translation of p250GAP [67]. | 1.88/0.009 |
| Regulates the dendritic growth and branching of young hippocampal neurons in vitro and in vivo [67,68,69]. | ||
| Involved in experience-dependent visual cortex plasticity [70]. | ||
| Moderate overexpression of miR-132 enhanced spatial memory and cognitive capacity in Barnes maze/novel object recognition task, while supra-physiological level of miR-132 impaired cognition [71]. | ||
| Expression changes in the hippocampus after training are essential for LTP [69]. | ||
| miR-134-5p | Inhibits dendritic development [72]. | 1.82/0.005 |
| Overexpression in the rat mPFC decreases dendritic spine density and synapse number [73]. | ||
| Activity-induced hippocampal dendritic growth and excitatory synapse number [74]. | ||
| miR-185-5p | Regulates neuronal differentiation of neural progenitors [75] and dendritic spine morphology [76]. | 1.77/0.01 |
| miR-203a-3p | Inhibits NF-κβ signaling pathway activation and microglia activation [77]. | 1.86/0.01 |
| miR-214-3p | Decreases amplitude of mEPSC, and number of dendritic spines in hippocampal neurons [78]. | 1.84/0.02 |
| miR-218a-5p | Promotes neuronal differentiation [79]. | 1.68/0.01 |
| Overexpression increases density of dendritic spines the mPFC [80]. | ||
| Males | ||
| miR-99a-5p | Regulates neurite growth in mouse model of spinal injury [81]. | 2.34/0.03 |
| Regulates proliferation, migration and invasion of human carcinoma cells [82]. | ||
| miR-141-3p | Inhibits neurogenesis [83]. | 1.95/0.02 |
| miR-192-5p | Enhances cognitive function in mice model of depression [84]. | 1.21/0.02 |
| miR-194-5p | Regulates proliferation and apoptosis of hippocampal neurons in children with temporal lobe epilepsy [85]. | 1.46/0.02 |
| Inhibits LPS-induced astrocytes activation [86]. | ||
| miR-451-5p | Overexpression induces accelerated neuronal differentiation [87]. | 0.16/0.04 |
| Targets macrophage migration [88]. | ||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vinogradova, A.; Sysova, M.; Smirnova, P.; Sidorova, M.; Turkin, A.; Kurilova, E.; Tuchina, O. Enriched Environment Induces Sex-Specific Changes in the Adult Neurogenesis, Cytokine and miRNA Expression in Rat Hippocampus. Biomedicines 2023, 11, 1341. https://doi.org/10.3390/biomedicines11051341
Vinogradova A, Sysova M, Smirnova P, Sidorova M, Turkin A, Kurilova E, Tuchina O. Enriched Environment Induces Sex-Specific Changes in the Adult Neurogenesis, Cytokine and miRNA Expression in Rat Hippocampus. Biomedicines. 2023; 11(5):1341. https://doi.org/10.3390/biomedicines11051341
Chicago/Turabian StyleVinogradova, Anna, Maria Sysova, Polina Smirnova, Maria Sidorova, Andrei Turkin, Ekaterina Kurilova, and Oksana Tuchina. 2023. "Enriched Environment Induces Sex-Specific Changes in the Adult Neurogenesis, Cytokine and miRNA Expression in Rat Hippocampus" Biomedicines 11, no. 5: 1341. https://doi.org/10.3390/biomedicines11051341
APA StyleVinogradova, A., Sysova, M., Smirnova, P., Sidorova, M., Turkin, A., Kurilova, E., & Tuchina, O. (2023). Enriched Environment Induces Sex-Specific Changes in the Adult Neurogenesis, Cytokine and miRNA Expression in Rat Hippocampus. Biomedicines, 11(5), 1341. https://doi.org/10.3390/biomedicines11051341

