Neurosecretory Protein GM–Expressing Neurons Participate in Lipid Storage and Inflammation in Newly Developed Cre Driver Male Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Production of Plasmid Enabling Cre-Dependent Overexpression of Npgm
2.3. Preparation of AAV-Based Vectors
2.4. Stereotaxic Surgery
2.5. Cre-Dependent Overexpression of Npgm
2.6. Stimulation of NPGM Neurons in the Hypothalamus
2.7. Ablation of NPGM Neurons
2.8. Quantitative Reverse Transcriptase PCR (qRT-PCR)
2.9. Flow Cytometry
2.10. Immunohistochemistry
2.11. Plasma and Hepatic Biochemical Analysis
2.12. OGTT and ITT
2.13. Statistical Analysis
3. Results
3.1. Generation of NPGM-Cre Mice
3.2. Cre-Dependent Overexpression of Npgm
3.3. Acute and Chronic Activation of NPGM Neurons in the Hypothalamus
3.4. Ablation of NPGM Neurons
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Engin, A. The Definition and Prevalence of Obesity and Metabolic Syndrome. Adv. Exp. Med. Biol. 2017, 960, 1–17. [Google Scholar] [CrossRef] [Scilit]
- Grundy, S.M. Obesity, Metabolic Syndrome, and Cardiovascular Disease. J. Clin. Endocrinol. Metab. 2004, 89, 2595–2600. [Google Scholar] [CrossRef] [Scilit]
- Powell-Wiley, T.M.; Poirier, P.; Burke, L.E.; Després, J.-P.; Gordon-Larsen, P.; Lavie, C.J.; Lear, S.A.; Ndumele, C.E.; Neeland, I.J.; Sanders, P.; et al. Obesity and Cardiovascular Disease: A Scientific Statement from the American Heart Association. Circulation 2021, 143, e984–e1010. [Google Scholar] [CrossRef] [Scilit]
- Leggio, M.; Lombardi, M.; Caldarone, E.; Severi, P.; D’Emidio, S.; Armeni, M.; Bravi, V.; Bendini, M.G.; Mazza, A. The Relationship between Obesity and Hypertension: An Updated Comprehensive Overview on Vicious Twins. Hypertens. Res. 2017, 40, 947–963. [Google Scholar] [CrossRef] [Scilit]
- Kawai, T.; Autieri, M.V.; Scalia, R. Adipose Tissue Inflammation and Metabolic Dysfunction in Obesity. Am. J. Physiol. Cell Physiol. 2021, 320, C375–C391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jung, U.; Choi, M.-S. Obesity and Its Metabolic Complications: The Role of Adipokines and the Relationship between Obesity, Inflammation, Insulin Resistance, Dyslipidemia and Nonalcoholic Fatty Liver Disease. Int. J. Mol. Sci. 2014, 15, 6184–6223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fujisaka, S.; Usui, I.; Bukhari, A.; Ikutani, M.; Oya, T.; Kanatani, Y.; Tsuneyama, K.; Nagai, Y.; Takatsu, K.; Urakaze, M.; et al. Regulatory Mechanisms for Adipose Tissue M1 and M2 Macrophages in Diet-Induced Obese Mice. Diabetes 2009, 58, 2574–2582. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nawaz, A.; Aminuddin, A.; Kado, T.; Takikawa, A.; Yamamoto, S.; Tsuneyama, K.; Igarashi, Y.; Ikutani, M.; Nishida, Y.; Nagai, Y.; et al. CD206+ M2-like Macrophages Regulate Systemic Glucose Metabolism by Inhibiting Proliferation of Adipocyte Progenitors. Nat. Commun. 2017, 8, 1–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luquet, S.; Perez, F.A.; Hnasko, T.S.; Palmiter, R.D. NPY/AgRP Neurons Are Essential for Feeding in Adult Mice but Can Be Ablated in Neonates. Science 2005, 310, 683–685. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, L.; Okamoto, S.; Shiuchi, T.; Toda, C.; Takagi, K.; Sato, T.; Saito, K.; Yokota, S.; Minokoshi, Y. Sympathetic Nerve Activity Maintains an Anti-Inflammatory State in Adipose Tissue in Male Mice by Inhibiting TNF-α Gene Expression in Macrophages. Endocrinology 2015, 156, 3680–3694. [Google Scholar] [CrossRef] [Scilit]
- Krashes, M.J.; Koda, S.; Ye, C.; Rogan, S.C.; Adams, A.C.; Cusher, D.S.; Maratos-Flier, E.; Roth, B.L.; Lowell, B.B. Rapid, Reversible Activation of AgRP Neurons Drives Feeding Behavior in Mice. J. Clin. Invest. 2011, 121, 1424–1428. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, C.; Jiang, Z.; Xu, Y.; Cai, Z.-L.; Jiang, Q.; Xu, Y.; Xue, M.; Arenkiel, B.R.; Wu, Q.; Shu, G.; et al. Profound and Redundant Functions of Arcuate Neurons in Obesity Development. Nat. Metab. 2020, 2, 763–774. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yaswen, L.; Diehl, N.; Brennan, M.B.; Hochgeschwender, U. Obesity in the Mouse Model of Pro-Opiomelanocortin Deficiency Responds to Peripheral Melanocortin. Nat. Med. 1999, 5, 1066–1070. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cone, R.D. Anatomy and Regulation of the Central Melanocortin System. Nat. Neurosci. 2005, 8, 571–578. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Xu, Y.; Jiang, Y.; Jiang, Z.; Otiz-Guzman, J.; Morrill, J.C.; Cai, J.; Mao, Z.; Xu, Y.; Arenkiel, B.R.; et al. The Melanocortin Action Is Biased toward Protection from Weight Loss in Mice. Nat. Commun. 2023, 14, 2200. [Google Scholar] [CrossRef] [Scilit]
- Rashid, M.; Kondoh, K.; Palfalvi, G.; Nakajima, K.-I.; Minokoshi, Y. Inhibition of High-Fat Diet-Induced Inflammatory Responses in Adipose Tissue by SF1-Expressing Neurons of the Ventromedial Hypothalamus. Cell Rep. 2023, 42, 112627. [Google Scholar] [CrossRef] [Scilit]
- Okamoto, S.; Sato, T.; Tateyama, M.; Kageyama, H.; Maejima, Y.; Nakata, M.; Hirako, S.; Matsuo, T.; Kyaw, S.; Shiuchi, T.; et al. Activation of AMPK-Regulated CRH Neurons in the PVH Is Sufficient and Necessary to Induce Dietary Preference for Carbohydrate over Fat. Cell Rep. 2018, 22, 706–721. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, C.; Xu, Y.; Jiang, Z.; Tian, J.B.; Cassidy, R.M.; Cai, Z.-L.; Shu, G.; Xu, Y.; Xue, M.; Arenkiel, B.R.; et al. Disrupted Hypothalamic CRH Neuron Responsiveness Contributes to Diet-Induced Obesity. EMBO Rep. 2020, 21, e49210. [Google Scholar] [CrossRef] [Scilit]
- Ukena, K.; Iwakoshi-Ukena, E.; Taniuchi, S.; Bessho, Y.; Maejima, S.; Masuda, K.; Shikano, K.; Kondo, K.; Furumitsu, M.; Tachibana, T. Identification of a cDNA Encoding a Novel Small Secretory Protein, Neurosecretory Protein GL, in the Chicken Hypothalamic Infundibulum. Biochem. Biophys. Res. Commun. 2014, 446, 298–303. [Google Scholar] [CrossRef] [Scilit]
- Iwakoshi-Ukena, E.; Shikano, K.; Kondo, K.; Taniuchi, S.; Furumitsu, M.; Ochi, Y.; Sasaki, T.; Okamoto, S.; Bentley, G.E.; Kriegsfeld, L.J.; et al. Neurosecretory Protein GL Stimulates Food Intake, de Novo Lipogenesis, and Onset of Obesity. eLife 2017, 6, e28527. [Google Scholar] [CrossRef] [Scilit]
- Matsuura, D.; Shikano, K.; Saito, T.; Iwakoshi-Ukena, E.; Furumitsu, M.; Ochi, Y.; Sato, M.; Bentley, G.E.; Kriegsfeld, L.J.; Ukena, K. Neurosecretory Protein GL, a Hypothalamic Small Secretory Protein, Participates in Energy Homeostasis in Male Mice. Endocrinology 2017, 158, 1120–1129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ukena, K. Avian and Murine Neurosecretory Protein GL Participates in the Regulation of Feeding and Energy Metabolism. Gen. Comp. Endocrinol. 2018, 260, 164–170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Narimatsu, Y.; Iwakoshi-Ukena, E.; Fukumura, K.; Shikano, K.; Furumitsu, M.; Morishita, M.; Bentley, G.E.; Kriegsfeld, L.J.; Ukena, K. Hypothalamic Overexpression of Neurosecretory Protein GL Leads to Obesity in Male C57BL/6J Mice. Neuroendocrinology 2022, 112, 606–620. [Google Scholar] [CrossRef] [Scilit]
- Shikano, K.; Bessho, Y.; Kato, M.; Iwakoshi-Ukena, E.; Taniuchi, S.; Furumitsu, M.; Tachibana, T.; Bentley, G.E.; Kriegsfeld, L.J.; Ukena, K. Localization and Function of Neurosecretory Protein GM, a Novel Small Secretory Protein, in the Chicken Hypothalamus. Sci. Rep. 2018, 8, 704. [Google Scholar] [CrossRef] [Scilit]
- Kato, M.; Iwakoshi-Ukena, E.; Furumitsu, M.; Ukena, K. A Novel Hypothalamic Factor, Neurosecretory Protein GM, Causes Fat Deposition in Chicks. Front. Physiol. 2021, 12, 747473. [Google Scholar] [CrossRef] [Scilit]
- Campbell, J.N.; Macosko, E.Z.; Fenselau, H.; Pers, T.H.; Lyubetskaya, A.; Tenen, D.; Goldman, M.; Verstegen, A.M.J.; Resch, J.M.; McCarroll, S.A.; et al. A Molecular Census of Arcuate Hypothalamus and Median Eminence Cell Types. Nat. Neurosci. 2017, 20, 484–496. [Google Scholar] [CrossRef] [Scilit]
- Martinez, T.F.; Lyons-Abbott, S.; Bookout, A.L.; De Souza, E.V.; Donaldson, C.; Vaughan, J.M.; Lau, C.; Abramov, A.; Baquero, A.F.; Baquero, K.; et al. Profiling Mouse Brown and White Adipocytes to Identify Metabolically Relevant Small ORFs and Functional Microproteins. Cell Metab. 2023, 35, 166–183.e11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Truett, G.E.; Heeger, P.; Mynatt, R.L.; Truett, A.A.; Walker, J.A.; Warman, M.L. Preparation of PCR-Quality Mouse Genomic DNA with Hot Sodium Hydroxide and Tris (HotSHOT). Biotechniques 2000, 29, 52–54. [Google Scholar] [CrossRef] [Scilit]
- Narimatsu, Y.; Iwakoshi-Ukena, E.; Naito, M.; Moriwaki, S.; Furumitsu, M.; Ukena, K. Neurosecretory Protein GL Accelerates Liver Steatosis in Mice Fed Medium-Fat/Medium-Fructose Diet. Int. J. Mol. Sci. 2022, 23, 2071. [Google Scholar] [CrossRef] [Scilit]
- Fukumura, K.; Narimatsu, Y.; Moriwaki, S.; Iwakoshi-Ukena, E.; Furumitsu, M.; Ukena, K. Overexpression of the Gene Encoding Neurosecretory Protein GL Precursor Prevents Excessive Fat Accumulation in the Adipose Tissue of Mice Fed a Long-Term High-Fat Diet. Molecules 2021, 26, 6006. [Google Scholar] [CrossRef] [Scilit]
- Narimatsu, Y.; Matsuura, D.; Iwakoshi-Ukena, E.; Furumitsu, M.; Ukena, K. Neurosecretory Protein GL Promotes Normotopic Fat Accumulation in Male ICR Mice. Int. J. Mol. Sci. 2022, 23, 6488. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sugasawa, T.; Ono, S.; Yonamine, M.; Fujita, S.I.; Matsumoto, Y.; Aoki, K.; Nakano, T.; Tamai, S.; Yoshida, Y.; Kawakami, Y.; et al. One Week of Cdahfd Induces Steatohepatitis and Mitochondrial Dysfunction with Oxidative Stress in Liver. Int. J. Mol. Sci. 2021, 22, 5851. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al Rijjal, D.; Wheeler, M.B. A Protocol for Studying Glucose Homeostasis and Islet Function in Mice. STAR Protoc. 2022, 3, 101171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagy, C.; Einwallner, E. Study of In Vivo Glucose Metabolism in High-Fat Diet-Fed Mice Using Oral Glucose Tolerance Test (OGTT) and Insulin Tolerance Test (ITT). J. Vis. Exp. 2018, 131, e56672. [Google Scholar] [CrossRef] [Scilit]
- Chen, H.; Liu, J.; Shi, G.-P.; Zhang, X. Protocol for in Vivo and Ex Vivo Assessment of Hyperglycemia and Islet Function in Diabetic Mice. STAR Protoc. 2023, 4, 102133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sullivan, P.W.; Ghushchyan, V.H.; Ben-Joseph, R. The Impact of Obesity on Diabetes, Hyperlipidemia and Hypertension in the United States. Qual. Life Res. 2008, 17, 1063–1071. [Google Scholar] [CrossRef] [Scilit]
- Monteiro, R.; Azevedo, I. Chronic Inflammation in Obesity and the Metabolic Syndrome. Mediat. Inflamm. 2010, 2010, 289645. [Google Scholar] [CrossRef] [Scilit]
- Yang, C.F.; Chiang, M.C.; Gray, D.C.; Prabhakaran, M.; Alvarado, M.; Juntti, S.A.; Unger, E.K.; Wells, J.A.; Shah, N.M. Sexually Dimorphic Neurons in the Ventromedial Hypothalamus Govern Mating in Both Sexes and Aggression in Males. Cell 2013, 153, 896–909. [Google Scholar] [CrossRef] [Scilit]
- Wu, H.; Ballantyne, C.M. Metabolic Inflammation and Insulin Resistance in Obesity. Circ. Res. 2020, 126, 1549–1564. [Google Scholar] [CrossRef] [Scilit]
- Bamshad, M.; Aoki, V.T.; Adkison, M.G.; Warren, W.S.; Bartness, T.J. Central Nervous System Origins of the Sympathetic Nervous System Outflow to White Adipose Tissue. Am. J. Physiol. 1998, 275, R291–R299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bartness, T.J.; Song, C.K. Thematic Review Series: Adipocyte Biology. Sympathetic and Sensory Innervation of White Adipose Tissue. J. Lipid Res. 2007, 48, 1655–1672. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Masuda, K.; Furumitsu, M.; Taniuchi, S.; Iwakoshi-Ukena, E.; Ukena, K. Production and Characterization of Neurosecretory Protein GM Using Escherichia Coli and Chinese Hamster Ovary Cells. FEBS Open Bio 2015, 5, 844–851. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Page, C.E.; Shepard, R.; Heslin, K.; Coutellier, L. Prefrontal Parvalbumin Cells Are Sensitive to Stress and Mediate Anxiety-Related Behaviors in Female Mice. Sci. Rep. 2019, 9, 19772. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ewbank, S.N.; Campos, C.A.; Chen, J.Y.; Bowen, A.J.; Padilla, S.L.; Dempsey, J.L.; Cui, J.Y.; Palmiter, R.D. Chronic Gq Signaling in AgRP Neurons Does Not Cause Obesity. Proc. Natl. Acad. Sci. USA 2020, 117, 20874–20880. [Google Scholar] [CrossRef] [Scilit]
- Pozhidayeva, D.Y.; Farris, S.P.; Goeke, C.M.; Firsick, E.J.; Townsley, K.G.; Guizzetti, M.; Ozburn, A.R. Chronic Chemogenetic Stimulation of the Nucleus Accumbens Produces Lasting Reductions in Binge Drinking and Ameliorates Alcohol-Related Morphological and Transcriptional Changes. Brain Sci. 2020, 10, 109. [Google Scholar] [CrossRef] [Scilit]
- Xu, J.-J.; Gao, P.; Wu, Y.; Yin, S.-Q.; Zhu, L.; Xu, S.-H.; Tang, D.; Cheung, C.-W.; Jiao, Y.-F.; Yu, W.-F.; et al. G Protein-Coupled Estrogen Receptor in the Rostral Ventromedial Medulla Contributes to the Chronification of Postoperative Pain. CNS Neurosci. Ther. 2021, 27, 1313–1326. [Google Scholar] [CrossRef] [Scilit]
- Takahashi, T.M.; Sunagawa, G.A.; Soya, S.; Abe, M.; Sakurai, K.; Ishikawa, K.; Yanagisawa, M.; Hama, H.; Hasegawa, E.; Miyawaki, A.; et al. A Discrete Neuronal Circuit Induces a Hibernation-like State in Rodents. Nature 2020, 583, 109–114. [Google Scholar] [CrossRef] [Scilit]
- Bikson, M.; Nitsche, M.; Claes, M.; De Groef, L.; Moons, L. The DREADDful Hurdles and Opportunities of the Chronic Chemogenetic Toolbox. Cells 2022, 11, 1110. [Google Scholar] [CrossRef] [Scilit]
- Poyraz, F.C.; Holzner, E.; Bailey, M.R.; Meszaros, J.; Kenney, L.; Kheirbek, M.A.; Balsam, P.D.; Kellendonk, C. Decreasing Striatopallidal Pathway Function Enhances Motivation by Energizing the Initiation of Goal-Directed Action. J. Neurosci. 2016, 36, 5988–6001. [Google Scholar] [CrossRef] [Scilit]
- Manvich, D.F.; Webster, K.A.; Foster, S.L.; Farrell, M.S.; Ritchie, J.C.; Porter, J.H.; Weinshenker, D. The DREADD Agonist Clozapine N-Oxide (CNO) Is Reverse-Metabolized to Clozapine and Produces Clozapine-like Interoceptive Stimulus Effects in Rats and Mice. Sci. Rep. 2018, 8, 3840. [Google Scholar] [CrossRef] [Scilit]
- MacLaren, D.A.A.; Browne, R.W.; Shaw, J.K.; Krishnan Radhakrishnan, S.; Khare, P.; España, R.A.; Clark, S.D. Clozapine N-Oxide Administration Produces Behavioral Effects in Long-Evans Rats: Implications for Designing DREADD Experiments. eNeuro 2016, 3, ENEURO.0219-16.2016. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weisberg, S.P.; McCann, D.; Desai, M.; Rosenbaum, M.; Leibel, R.L.; Ferrante, A.W. Obesity Is Associated with Macrophage Accumulation in Adipose Tissue. J. Clin. Invest. 2003, 112, 1796–1808. [Google Scholar] [CrossRef]
- Ohashi, K.; Parker, J.L.; Ouchi, N.; Higuchi, A.; Vita, J.A.; Gokce, N.; Pedersen, A.A.; Kalthoff, C.; Tullin, S.; Sams, A.; et al. Adiponectin Promotes Macrophage Polarization toward an Anti-Inflammatory Phenotype. J. Biol. Chem. 2010, 285, 6153–6160. [Google Scholar] [CrossRef] [Scilit]
- Lumeng, C.N.; Bodzin, J.L.; Saltiel, A.R. Obesity Induces a Phenotypic Switch in Adipose Tissue Macrophage Polarization. J. Clin. Invest. 2007, 117, 175–184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tran, T.T.; Yamamoto, Y.; Gesta, S.; Kahn, C.R. Beneficial Effects of Subcutaneous Fat Transplantation on Metabolism. Cell Metab. 2008, 7, 410–420. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Strissel, K.J.; Stancheva, Z.; Miyoshi, H.; Perfield, J.W., 2nd; DeFuria, J.; Jick, Z.; Greenberg, A.S.; Obin, M.S. Adipocyte Death, Adipose Tissue Remodeling, and Obesity Complications. Diabetes 2007, 56, 2910–2918. [Google Scholar] [CrossRef] [Scilit]
- Murano, I.; Barbatelli, G.; Parisani, V.; Latini, C.; Muzzonigro, G.; Castellucci, M.; Cinti, S. Dead Adipocytes, Detected as Crown-like Structures, Are Prevalent in Visceral Fat Depots of Genetically Obese Mice. J. Lipid Res. 2008, 49, 1562–1568. [Google Scholar] [CrossRef] [Scilit]
- Qu, D.; Ludwig, D.S.; Gammeltoft, S.; Piper, M.; Pelleymounter, M.A.; Cullen, M.J.; Mathes, W.F.; Przypek, R.; Kanarek, R.; Maratos-Flier, E. A Role for Melanin-Concentrating Hormone in the Central Regulation of Feeding Behaviour. Nature 1996, 380, 243–247. [Google Scholar] [CrossRef] [Scilit]
- Shimada, M.; Tritos, N.A.; Lowell, B.B.; Flier, J.S.; Maratos-Flier, E. Mice Lacking Melanin-Concentrating Hormone Are Hypophagic and Lean. Nature 1998, 396, 670–674. [Google Scholar] [CrossRef] [Scilit]
- Lambert, P.D.; Couceyro, P.R.; McGirr, K.M.; Dall Vechia, S.E.; Smith, Y.; Kuhar, M.J. CART Peptides in the Central Control of Feeding and Interactions with Neuropeptide Y. Synapse 1998, 29, 293–298. [Google Scholar] [CrossRef] [Scilit]
- Yang, S.-C.; Shieh, K.-R.; Li, H.-Y. Cocaine- and Amphetamine-Regulated Transcript in the Nucleus Accumbens Participates in the Regulation of Feeding Behavior in Rats. Neuroscience 2005, 133, 841–851. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oh-I, S.; Shimizu, H.; Satoh, T.; Okada, S.; Adachi, S.; Inoue, K.; Eguchi, H.; Yamamoto, M.; Imaki, T.; Hashimoto, K.; et al. Identification of Nesfatin-1 as a Satiety Molecule in the Hypothalamus. Nature 2006, 443, 709–712. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Whiddon, B.B.; Palmiter, R.D. Ablation of Neurons Expressing Melanin-Concentrating Hormone (MCH) in Adult Mice Improves Glucose Tolerance Independent of MCH Signaling. J. Neurosci. 2013, 33, 2009–2016. [Google Scholar] [CrossRef] [Scilit]
- Sugino, K.; Clark, E.; Schulmann, A.; Shima, Y.; Wang, L.; Hunt, D.L.; Hooks, B.M.; Tränkner, D.; Chandrashekar, J.; Picard, S.; et al. Mapping the Transcriptional Diversity of Genetically and Anatomically Defined Cell Populations in the Mouse Brain. eLife 2019, 8, e38619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Klop, B.; Elte, J.W.F.; Cabezas, M.C. Dyslipidemia in Obesity: Mechanisms and Potential Targets. Nutrients 2013, 5, 1218–1240. [Google Scholar] [CrossRef] [Scilit]
- Kato, M.; Iwakoshi-Ukena, E.; Narimatsu, Y.; Furumitsu, M.; Ukena, K. Expression of MRNAs Encoding Hypothalamic Small Proteins, Neurosecretory Protein GL and Neurosecretory Protein GM, in the Japanese Quail, Coturnix Japonica. bioRxiv 2023. [Google Scholar] [CrossRef] [Scilit]
- Carper, D.; Coué, M.; Laurens, C.; Langin, D.; Moro, C. Reappraisal of the Optimal Fasting Time for Insulin Tolerance Tests in Mice. Mol. Metab. 2020, 42, 101058. [Google Scholar] [CrossRef] [Scilit]
- Cardoso, F.; Klein Wolterink, R.G.J.; Godinho-Silva, C.; Domingues, R.G.; Ribeiro, H.; da Silva, J.A.; Mahú, I.; Domingos, A.I.; Veiga-Fernandes, H. Neuro-Mesenchymal Units Control ILC2 and Obesity via a Brain–Adipose Circuit. Nature 2021, 597, 410–414. [Google Scholar] [CrossRef] [Scilit]







| Gene | Sense Primer (5′ to 3′) | Antisense Primer (5′ to 3′) |
|---|---|---|
| Npgm | CTCTCTGACGCTGATAGACC | AGATACTGTAATGCCCAGGA |
| Actb | GGCACCACACCTTCTACAAT | AGGTCTCAAACATGATCTGG |
| Genotyping 1 | CGTTCTGCTGTTCAGTCTCACTG | GATTCCATTCTTCTATGCAACCCAT |
| Genotyping 2 | GCTGATGATCCGAATAACTACCTG | GATTCCATTCTTCTATGCAACCCAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Narimatsu, Y.; Kato, M.; Iwakoshi-Ukena, E.; Moriwaki, S.; Ogasawara, A.; Furumitsu, M.; Ukena, K. Neurosecretory Protein GM–Expressing Neurons Participate in Lipid Storage and Inflammation in Newly Developed Cre Driver Male Mice. Biomedicines 2023, 11, 3230. https://doi.org/10.3390/biomedicines11123230
Narimatsu Y, Kato M, Iwakoshi-Ukena E, Moriwaki S, Ogasawara A, Furumitsu M, Ukena K. Neurosecretory Protein GM–Expressing Neurons Participate in Lipid Storage and Inflammation in Newly Developed Cre Driver Male Mice. Biomedicines. 2023; 11(12):3230. https://doi.org/10.3390/biomedicines11123230
Chicago/Turabian StyleNarimatsu, Yuki, Masaki Kato, Eiko Iwakoshi-Ukena, Shogo Moriwaki, Ayano Ogasawara, Megumi Furumitsu, and Kazuyoshi Ukena. 2023. "Neurosecretory Protein GM–Expressing Neurons Participate in Lipid Storage and Inflammation in Newly Developed Cre Driver Male Mice" Biomedicines 11, no. 12: 3230. https://doi.org/10.3390/biomedicines11123230
APA StyleNarimatsu, Y., Kato, M., Iwakoshi-Ukena, E., Moriwaki, S., Ogasawara, A., Furumitsu, M., & Ukena, K. (2023). Neurosecretory Protein GM–Expressing Neurons Participate in Lipid Storage and Inflammation in Newly Developed Cre Driver Male Mice. Biomedicines, 11(12), 3230. https://doi.org/10.3390/biomedicines11123230

