Novel Pathogenic Variants in the Gene Encoding Stereocilin (STRC) Causing Non-Syndromic Moderate Hearing Loss in Spanish and Argentinean Subjects
Abstract
:1. Introduction
2. Materials and Methods
2.1. Human Subjects
2.2. DNA Purification, Genotyping and MLPA
2.3. Sanger DNA Sequencing
2.4. Targeted Massively Parallel DNA Sequencing
2.5. Assessment of Pathogenicity of DNA Variants
3. Results
3.1. Haplotype Analysis and PCR-Based Detection of Deletions Involving STRC
3.2. Screening through Massively Parallel DNA Sequencing
3.3. Genotype–Phenotype Correlations
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Petit, C.; Bonnet, C.; Safieddine, S. Deafness: From genetic architecture to gene therapy. Nat. Rev. Genet. 2023, 24, 665–686. [Google Scholar] [CrossRef] [PubMed]
- Van Camp, G.; Smith, R.J. Hereditary Hearing Loss Homepage. Available online: https://hereditaryhearingloss.org (accessed on 26 September 2023).
- Verpy, E.; Masmoudi, S.; Zwaenepoel, I.; Leibovici, M.; Hutchin, T.P.; del Castillo, I.; Nouaille, S.; Blanchard, S.; Lainé, S.; Popot, J.L.; et al. Mutations in a new gene encoding a protein of the hair bundle cause non-syndromic deafness at the DFNB16 locus. Nat. Genet. 2001, 29, 345–349. [Google Scholar] [CrossRef] [PubMed]
- Han, S.; Zhang, D.; Guo, Y.; Fu, Z.; Guan, G. Prevalence and Characteristics of STRC Gene Mutations (DFNB16): A Systematic Review and Meta-Analysis. Front. Genet. 2021, 12, 707845. [Google Scholar] [CrossRef]
- del Castillo, I.; Morín, M.; Domínguez Ruiz, M.; Moreno Pelayo, M.A. Genetic etiology of non-syndromic hearing loss in Europe. Hum. Genet. 2022, 141, 683–696. [Google Scholar] [CrossRef]
- Verpy, E.; Weil, D.; Leibovici, M.; Goodyear, R.J.; Hamard, G.; Houdon, C.; Lefèvre, G.M.; Hardelin, J.P.; Richardson, G.P.; Avan, P.; et al. Stereocilin-deficient mice reveal the origin of cochlear waveform distortions. Nature 2008, 456, 255–258. [Google Scholar] [CrossRef]
- Verpy, E.; Leibovici, M.; Michalski, N.; Goodyear, R.J.; Houdon, C.; Weil, D.; Richardson, G.P.; Petit, C. Stereocilin connects outer hair cell stereocilia to one another and to the tectorial membrane. J. Comp. Neurol. 2011, 519, 194–210. [Google Scholar] [CrossRef]
- Avan, P.; Le Gal, S.; Michel, V.; Dupont, T.; Hardelin, J.P.; Petit, C.; Verpy, E. Otogelin, otogelin-like, and stereocilin form links connecting outer hair cell stereocilia to each other and the tectorial membrane. Proc. Natl. Acad. Sci. USA 2019, 116, 25948–25957. [Google Scholar] [CrossRef]
- Zhang, Y.; Malekpour, M.; Al-Madani, N.; Kahrizi, K.; Zanganeh, M.; Lohr, N.J.; Mohseni, M.; Mojahedi, F.; Daneshi, A.; Najmabadi, H.; et al. Sensorineural deafness and male infertility: A contiguous gene deletion syndrome. J. Med. Genet. 2007, 44, 233–240. [Google Scholar] [CrossRef]
- Dib, C.; Faure, S.; Fizames, C.; Samson, D.; Drouot, N.; Vignal, A.; Millasseau, P.; Marc, S.; Hazan, J.; Lathrop, M.; et al. A comprehensive genetic map of the human genome based on 5,264 microsatellites. Nature 1996, 380, 152–154. [Google Scholar] [CrossRef]
- Ensembl. Available online: https://www.ensembl.org/Homo_sapiens (accessed on 27 September 2023).
- Morín, M.; Borreguero, L.; Booth, K.T.; Lachgar, M.; Huygen, P.; Villamar, M.; Mayo, F.; Barrio, L.C.; Santos Serrão de Castro, L.; Morales, C.; et al. Insights into the pathophysiology of DFNA10 hearing loss associated with novel EYA4 variants. Sci. Rep. 2020, 10, 6213. [Google Scholar] [CrossRef]
- Richards, S.; Aziz, N.; Bale, S.; Bick, D.; Das, S.; Gastier-Foster, J.; Grody, W.W.; Hegde, M.; Lyon, E.; Spector, E.; et al. ACMG Laboratory Quality Assurance Committee. Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. 2015, 17, 405–424. [Google Scholar] [CrossRef]
- VarSome: The Human Genomic Variant Search Engine. Available online: https://varsome.com/ (accessed on 29 September 2023).
- Oza, A.M.; DiStefano, M.T.; Hemphill, S.E.; Cushman, B.J.; Grant, A.R.; Siegert, R.K.; Shen, J.; Chapin, A.; Boczek, N.J.; Schimmenti, L.A.; et al. ClinGen Hearing Loss Clinical DomainWorking Group. Expert specification of the ACMG/AMP variant interpretation guidelines for genetic hearing loss. Hum. Mutat. 2018, 39, 1593–1613. [Google Scholar] [CrossRef]
- Schrauwen, I.; Sommen, M.; Corneveaux, J.J.; Reiman, R.A.; Hackett, N.J.; Claes, C.; Claes, K.; Bitner-Glindzicz, M.; Coucke, P.; Van Camp, G.; et al. A sensitive and specific diagnostic test for hearing loss using a microdroplet PCR-based approach and next-generation sequencing. Am. J. Med. Genet. A 2013, 161, 145–152. [Google Scholar] [CrossRef] [PubMed]
- Francey, L.J.; Conlin, L.K.; Kadesch, H.E.; Clark, D.; Berrodin, D.; Sun, Y.; Glessner, J.; Hakonarson, H.; Jalas, C.; Landau, C.; et al. Genome-wide SNP genotyping identifies the Stereocilin (STRC) gene as a major contributor to pediatric bilateral sensorineural hearing impairment. Am. J. Med. Genet. A 2012, 158A, 298–308. [Google Scholar] [CrossRef] [PubMed]
- Mandelker, D.; Amr, S.S.; Pugh, T.; Gowrisankar, S.; Shakhbatyan, R.; Duffy, E.; Bowser, M.; Harrison, B.; Lafferty, K.; Mahanta, L.; et al. Comprehensive diagnostic testing for stereocilin: An approach for analyzing medically important genes with high homology. J. Mol. Diagn. 2014, 16, 639–647. [Google Scholar] [CrossRef] [PubMed]
- Vona, B.; Hofrichter, M.A.H.; Neuner, C.; Schröder, J.; Gehrig, A.; Hennermann, J.B.; Kraus, F.; Shehata-Dieler, W.; Klopocki, E.; Nanda, I.; et al. DFNB16 is a frequent cause of congenital hearing impairment: Implementation of STRC mutation analysis in routine diagnostics. Clin. Genet. 2015, 87, 49–55. [Google Scholar] [CrossRef] [PubMed]
- Moteki, H.; Azaiez, H.; Sloan-Heggen, C.M.; Booth, K.; Nishio, S.Y.; Wakui, K.; Yamaguchi, T.; Kolbe, D.L.; Iwasa, Y.I.; Shearer, A.E.; et al. Detection and Confirmation of Deafness-Causing Copy Number Variations in the STRC Gene by Massively Parallel Sequencing and Comparative Genomic Hybridization. Ann. Otol. Rhinol. Laryngol. 2016, 125, 918–923. [Google Scholar] [CrossRef]
- Amr, S.S.; Murphy, E.; Duffy, E.; Niazi, R.; Balciuniene, J.; Luo, M.; Rehm, H.L.; Abou Tayoun, A.N. Allele-Specific Droplet Digital PCR Combined with a Next-Generation Sequencing-Based Algorithm for Diagnostic Copy Number Analysis in Genes with High Homology: Proof of Concept Using Stereocilin. Clin. Chem. 2018, 64, 705–714. [Google Scholar] [CrossRef]
- Nishio, S.Y.; Usami, S.I. Frequency of the STRC-CATSPER2 deletion in STRC-associated hearing loss patients. Sci. Rep. 2022, 12, 634. [Google Scholar] [CrossRef]
- Plevova, P.; Paprskarova, M.; Tvrda, P.; Turska, P.; Slavkovsky, R.; Mrazkova, E. STRC Deletion is a Frequent Cause of Slight to Moderate Congenital Hearing Impairment in the Czech Republic. Otol. Neurotol. 2017, 38, e393–e400. [Google Scholar] [CrossRef]
- Marková, S.P.; Brožková, D.Š.; Laššuthová, P.; Mészárosová, A.; Krůtová, M.; Neupauerová, J.; Rašková, D.; Trková, M.; Staněk, D.; Seeman, P. STRC Gene Mutations, Mainly Large Deletions, are a Very Important Cause of Early-Onset Hereditary Hearing Loss in the Czech Population. Genet. Test. Mol. Biomark. 2018, 22, 127–134. [Google Scholar] [CrossRef] [PubMed]
- Yokota, Y.; Moteki, H.; Nishio, S.Y.; Yamaguchi, T.; Wakui, K.; Kobayashi, Y.; Ohyama, K.; Miyazaki, H.; Matsuoka, R.; Abe, S.; et al. Frequency and clinical features of hearing loss caused by STRC deletions. Sci. Rep. 2019, 9, 4408. [Google Scholar] [CrossRef] [PubMed]
- Markova, T.G.; Alekseeva, N.N.; Mironovich, O.L.; Galeeva, N.M.; Lalayants, M.R.; Bliznetz, E.A.; Chibisova, S.S.; Polyakov, A.V.; Tavartkiladze, G.A. Clinical features of hearing loss caused by STRC gene deletions/mutations in Russian population. Int. J. Pediatr. Otorhinolaryngol. 2020, 138, 110247. [Google Scholar] [CrossRef] [PubMed]
- Simi, A.; Perry, J.; Schindler, E.; Oza, A.; Luo, M.; Hartman, T.; Krantz, I.D.; Germiller, J.A.; Kawai, K.; Kenna, M. Share Audiologic Phenotype and Progression in Pediatric STRC-Related Autosomal Recessive Hearing Loss. Laryngoscope 2021, 131, E2897–E2903. [Google Scholar] [CrossRef] [PubMed]
- Frykholm, C.; Klar, J.; Tomanovic, T.; Ameur, A.; Dahl, N. Stereocilin gene variants associated with episodic vertigo: Expansion of the DFNB16 phenotype. Eur. J. Hum. Genet. 2018, 26, 1871–1874. [Google Scholar] [CrossRef] [PubMed]
- Achard, S.; Campion, M.; Parodi, M.; MacAskill, M.; Hochet, B.; Simon, F.; Rouillon, I.; Jonard, L.; Serey-Gaut, M.; Denoyelle, F.; et al. Recurrent Benign Paroxysmal Positional Vertigo in DFNB16 Patients with Biallelic STRC Gene Deletions. Otol. Neurotol. 2023, 44, e241–e245. [Google Scholar] [CrossRef]
- Shubina-Oleinik, O.; Nist-Lund, C.; French, C.; Rockowitz, S.; Shearer, A.E.; Holt, J.R. Dual-vector gene therapy restores cochlear amplification and auditory sensitivity in a mouse model of DFNB16 hearing loss. Sci. Adv. 2021, 7, 7629. [Google Scholar] [CrossRef]
Assay | Amplicon Size (bp) | Primers (5′-3′) |
---|---|---|
PCR1 | 15,665 | Upper: AGTTTGTTTCTCCTGGGCGTCAT Lower: GAGCACTGTGAGAAATAGGGATCAAA |
PCR2 | 6240 | Upper: GCCCAGCTCCACCTGAATCC Lower. TGTGAACGGCGTCTGGAGAGA |
Case | Type | Allele 1 | Allele 2 |
---|---|---|---|
HRC1 | F | Deletion—Type 1 | Deletion—Type 1 |
HRC2 | F | c.4483_4484del/p.(Phe1495Cysfs*9) | Deletion—Type 1 |
HRC3 | F | Deletion—Type 1 | Deletion—Type 1 |
HRC4 | F | Deletion—Type 1 | Deletion—Type 1 |
HRC5 | F | Deletion—Type 1 | Deletion—Type 1 |
HRC6 | F | Deletion—Type 1 | Deletion—Type 1 |
HRC7 | F | c.3823G > T/p.(Glu1275*) | c.4559C > G/p.(Pro1520Arg) [16] |
HRC8 | F | Deletion—Type 1 | Deletion—Type 1 |
HRC9 | F | c.1768T > C/p.(Cys590Arg) | Deletion—Type 1 |
HRC10 | F | Deletion—Type 2 | Deletion—Type 2 |
HRC11 | F | Deletion—Type 1 | Deletion—Type 1 |
HRC12 | S | Deletion—Type 1 | Deletion—Type 1 |
HRC13 | F | c.4096G > T/p.(Gly1366*) | Deletion—Type 1 |
HRC14 | F | —Deletion—Type 1 | Deletion—Type 1 |
HRC15 | S | Deletion—Type 1 | Deletion—Type 4 |
HRC16 | S | Deletion—Type 1 | Deletion—Type 1 |
HRC17 | S | Deletion—Type 1 | Deletion—Type 1 |
HRC18 | S | Deletion—Type 1 | Deletion—Type 1 |
IHT1 | F | c.1030C > T/p.(Arg344*) | Deletion—Type 3 |
IHT2 | S | Deletion—Type 1 | Deletion—Type 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Domínguez-Ruiz, M.; Ruiz-Palmero, L.; Buonfiglio, P.I.; García-Vaquero, I.; Gómez-Rosas, E.; Goñi, M.; Villamar, M.; Morín, M.; Moreno-Pelayo, M.A.; Elgoyhen, A.B.; et al. Novel Pathogenic Variants in the Gene Encoding Stereocilin (STRC) Causing Non-Syndromic Moderate Hearing Loss in Spanish and Argentinean Subjects. Biomedicines 2023, 11, 2943. https://doi.org/10.3390/biomedicines11112943
Domínguez-Ruiz M, Ruiz-Palmero L, Buonfiglio PI, García-Vaquero I, Gómez-Rosas E, Goñi M, Villamar M, Morín M, Moreno-Pelayo MA, Elgoyhen AB, et al. Novel Pathogenic Variants in the Gene Encoding Stereocilin (STRC) Causing Non-Syndromic Moderate Hearing Loss in Spanish and Argentinean Subjects. Biomedicines. 2023; 11(11):2943. https://doi.org/10.3390/biomedicines11112943
Chicago/Turabian StyleDomínguez-Ruiz, María, Laura Ruiz-Palmero, Paula I. Buonfiglio, Irene García-Vaquero, Elena Gómez-Rosas, Marina Goñi, Manuela Villamar, Matías Morín, Miguel A. Moreno-Pelayo, Ana B. Elgoyhen, and et al. 2023. "Novel Pathogenic Variants in the Gene Encoding Stereocilin (STRC) Causing Non-Syndromic Moderate Hearing Loss in Spanish and Argentinean Subjects" Biomedicines 11, no. 11: 2943. https://doi.org/10.3390/biomedicines11112943
APA StyleDomínguez-Ruiz, M., Ruiz-Palmero, L., Buonfiglio, P. I., García-Vaquero, I., Gómez-Rosas, E., Goñi, M., Villamar, M., Morín, M., Moreno-Pelayo, M. A., Elgoyhen, A. B., del Castillo, F. J., Dalamón, V., & del Castillo, I. (2023). Novel Pathogenic Variants in the Gene Encoding Stereocilin (STRC) Causing Non-Syndromic Moderate Hearing Loss in Spanish and Argentinean Subjects. Biomedicines, 11(11), 2943. https://doi.org/10.3390/biomedicines11112943