Bcl10 Regulates Lipopolysaccharide-Induced Pro-Fibrotic Signaling in Bronchial Fibroblasts from Severe Asthma Patients
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Treatment of Primary Human Bronchial Fibroblasts
2.2. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.3. Western Blotting
2.4. Immunohistochemistry
2.5. Paraffin Embedding and Immunocytochemistry of Human Bronchial Cells
2.6. Statistical Analysis
3. Results
3.1. Activation of Bcl10-Mediated NF-κB in Severe Asthmatic Fibroblasts
3.2. Increased Cytoplasmic Bcl10 Expression in Subepithelial Fibroblasts from Severe Asthma Patients
3.3. Subcellular Localization of Bcl10 in Bronchial Fibroblasts and Bronchial Epithelial Cells
3.4. Bcl10 Mediates LPS-Induced Pro-Fibrotic Cytokine Signaling in Bronchial Fibroblasts
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Minshall, E.M.; Leung, D.Y.; Martin, R.J.; Song, Y.L.; Cameron, L.; Ernst, P.; Hamid, Q. Eosinophil-associated TGF-beta1 mRNA expression and airways fibrosis in bronchial asthma. Am. J. Respir. Cell Mol. Biol. 1997, 17, 326–333. [Google Scholar] [CrossRef] [Scilit]
- Vallabhapurapu, S.; Karin, M. Regulation and function of NF-ĸB transcription factors in the immune system. Annu. Rev. Immunol. 2009, 27, 693–733. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gagliardo, R.; Chanez, P.; Mathieu, M.; Bruno, A.; Costanzo, G.; Gougat, C.; Vachier, I.; Bousquet, J.; Bonsignore, G.; Vignola, A.M. Persistent activation of nuclear factor-kappaB signaling pathway in severe uncontrolled asthma. Am. J. Respir. Crit. Care Med. 2003, 168, 1190–1198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, J.; Ma, Q. In Vivo Activation and Pro-Fibrotic Function of NF-κB in Fibroblastic Cells during Pulmonary Inflammation and Fibrosis Induced by Carbon Nanotubes. Front. Pharmacol. 2019, 10, 1140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McFarland, B.C.; Hong, S.W.; Rajbhandari, R.; Twitty, G.B.; Gray, G.K., Jr.; Yu, H.; Benveniste, E.N.; Nozell, S.E. NF-κB-induced IL-6 ensures STAT3 activation and tumor aggressiveness in glioblastoma. PLoS ONE 2013, 8, e78728. [Google Scholar] [CrossRef] [Scilit]
- Kunsch, C.; Rosen, C.A. NF-ĸB subunit-specific regulation of the interleukin-8 promoter. Mol. Cell. Biol. 1993, 13, 6137–6146. [Google Scholar]
- Rameshwar, P.; Narayanan, R.; Qian, J.; Denny, T.N.; Colon, C.; Gascon, P. NF-ĸB as a central mediator in the induction of TGF-beta in monocytes from patients with idiopathic myelofibrosis: An inflammatory response beyond the realm of homeostasis. J. Immunol. 2000, 165, 2271–2277. [Google Scholar] [CrossRef] [Scilit]
- Willis, T.G.; Jadayel, D.M.; Du, M.Q.; Peng, H.; Perry, A.R.; Abdul-Rauf, M.; Price, H.; Karran, L.; Majekodunmi, O.; Wlodarska, I.; et al. Bcl10 is involved in t(1;14)(p22;q32) of MALT B cell lymphoma and mutated in multiple tumor types. Cell 1999, 96, 35–45. [Google Scholar] [CrossRef] [Scilit]
- Lucas, P.C.; Yonezumi, M.; Inohara, N.; McAllister-Lucas, L.M.; Abazeed, M.E.; Chen, F.F.; Yamaoka, S.; Seto, M.; Nunez, G. Bcl10 and MALT1, independent targets of chromosomal translocation in malt lymphoma, cooperate in a novel NF-ĸB signaling pathway. J. Biol. Chem. 2001, 276, 19012–19019. [Google Scholar] [CrossRef] [Scilit]
- Gaide, O.; Martinon, F.; Micheau, O.; Bonnet, D.; Thome, M.; Tschopp, J. Carma1, a CARD-containing binding partner of Bcl10, induces Bcl10 phosphorylation and NF-ĸB activation. FEBS Lett. 2001, 496, 121–127. [Google Scholar] [CrossRef] [Scilit]
- Bhatt, D.; Ghosh, S. Regulation of the NF-ĸB-Mediated Transcription of Inflammatory Genes. Front. Immunol. 2014, 5, 71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ruland, J.; Hartjes, L. CARD-BCL-10-MALT1 signalling in protective and pathological immunity. Nat. Rev. Immunol. 2019, 19, 118–134. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Pappu, B.P.; Zeng, H.; Xue, L.; Morris, S.W.; Lin, X.; Wen, R.; Wang, D. B cell lymphoma 10 is essential for FcepsilonR-mediated degranulation and IL-6 production in mast cells. J. Immunol. 2007, 178, 49–57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Klemm, S.; Gutermuth, J.; Hultner, L.; Sparwasser, T.; Behrendt, H.; Peschel, C.; Mak, T.W.; Jakob, T.; Ruland, J. The Bcl10-Malt1 complex segregates Fc epsilon RI-mediated nuclear factor kappa B activation and cytokine production from mast cell degranulation. J. Exp. Med. 2006, 203, 337–347. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, D.; You, Y.; Lin, P.C.; Xue, L.; Morris, S.W.; Zeng, H.; Wen, R.; Lin, X. Bcl10 plays a critical role in NF-ĸB activation induced by G protein-coupled receptors. Proc. Natl. Acad. Sci. USA 2007, 104, 145–150. [Google Scholar] [CrossRef] [Scilit]
- McAllister-Lucas, L.M.; Ruland, J.; Siu, K.; Jin, X.; Gu, S.; Kim, D.S.; Kuffa, P.; Kohrt, D.; Mak, T.W.; Nunez, G.; et al. CARMA3/Bcl10/MALT1-dependent NF-ĸB activation mediates angiotensin II-responsive inflammatory signaling in nonimmune cells. Proc. Natl. Acad. Sci. USA 2007, 104, 139–144. [Google Scholar] [CrossRef] [Scilit]
- Marko, L.; Henke, N.; Park, J.K.; Spallek, B.; Qadri, F.; Balogh, A.; Apel, I.J.; Oravecz-Wilson, K.I.; Choi, M.; Przybyl, L.; et al. Bcl10 mediates angiotensin II-induced cardiac damage and electrical remodeling. Hypertension 2014, 64, 1032–1039. [Google Scholar] [CrossRef] [Scilit]
- Bhattacharyya, S.; Borthakur, A.; Pant, N.; Dudeja, P.K.; Tobacman, J.K. Bcl10 mediates LPS-induced activation of NF-ĸB and IL-8 in human intestinal epithelial cells. Am. J. Physiol. Gastrointest. Liver Physiol. 2007, 293, G429–G437. [Google Scholar] [CrossRef] [Scilit]
- Broide, D.H.; Lawrence, T.; Doherty, T.; Cho, J.Y.; Miller, M.; McElwain, K.; McElwain, S.; Karin, M. Allergen-induced peribronchial fibrosis and mucus production mediated by IĸB kinase beta-dependent genes in airway epithelium. Proc. Natl. Acad. Sci. USA 2005, 102, 17723–17728. [Google Scholar] [CrossRef] [Scilit]
- Schuliga, M. NF-ĸB Signaling in Chronic Inflammatory Airway Disease. Biomolecules 2015, 5, 1266–1283. [Google Scholar] [CrossRef] [Scilit]
- Panariti, A.; Baglole, C.J.; Sanchez, V.; Eidelman, D.H.; Hussain, S.; Olivenstein, R.; Martin, J.G.; Hamid, Q. Interleukin-17A and vascular remodelling in severe asthma; lack of evidence for a direct role. Clin. Exp. Allergy 2018, 48, 365–378. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bigler, J.; Boedigheimer, M.; Schofield, J.P.R.; Skipp, P.J.; Corfield, J.; Rowe, A.; Sousa, A.R.; Timour, M.; Twehues, L.; Hu, X.; et al. A Severe Asthma Disease Signature from Gene Expression Profiling of Peripheral Blood from U-BIOPRED Cohorts. Am. J. Respir. Crit. Care Med. 2017, 195, 1311–1320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poon, A.H.; Choy, D.F.; Chouiali, F.; Ramakrishnan, R.K.; Mahboub, B.; Audusseau, S.; Mogas, A.; Harris, J.M.; Arron, J.R.; Laprise, C.; et al. Increased Autophagy-Related 5 Gene Expression Is Associated with Collagen Expression in the Airways of Refractory Asthmatics. Front. Immunol. 2017, 8, 355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ichikawa, T.; Panariti, A.; Audusseau, S.; Mogas, A.K.; Olivenstein, R.; Chakir, J.; Laviolette, M.; Allakhverdi, Z.; Al Heialy, S.; Martin, J.G.; et al. Effect of bronchial thermoplasty on structural changes and inflammatory mediators in the airways of subjects with severe asthma. Respir. Med. 2019, 150, 165–172. [Google Scholar] [CrossRef] [Scilit]
- Shembade, N.; Harhaj, E.W. Regulation of NF-ĸB signaling by the A20 deubiquitinase. Cell. Mol. Immunol. 2012, 9, 123–130. [Google Scholar] [CrossRef] [Scilit]
- Ye, H.; Dogan, A.; Karran, L.; Willis, T.G.; Chen, L.; Wlodarska, I.; Dyer, M.J.; Isaacson, P.G.; Du, M.Q. BCL10 expression in normal and neoplastic lymphoid tissue. Nuclear localization in MALT lymphoma. Am. J. Pathol. 2000, 157, 1147–1154. [Google Scholar] [CrossRef] [Scilit]
- Cho, J.S.; Kang, J.H.; Um, J.Y.; Han, I.H.; Park, I.H.; Lee, H.M. Lipopolysaccharide induces pro-inflammatory cytokines and MMP production via TLR4 in nasal polyp-derived fibroblast and organ culture. PLoS ONE 2014, 9, e90683. [Google Scholar] [CrossRef] [Scilit]
- He, Z.; Zhu, Y.; Jiang, H. Toll-like receptor 4 mediates lipopolysaccharide-induced collagen secretion by phosphoinositide3-kinase-Akt pathway in fibroblasts during acute lung injury. J. Recept. Signal Transduct. Res. 2009, 29, 119–125. [Google Scholar] [CrossRef] [Scilit]
- Dong, W.; Liu, Y.; Peng, J.; Chen, L.; Zou, T.; Xiao, H.; Liu, Z.; Li, W.; Bu, Y.; Qi, Y. The IRAK-1-BCL10-MALT1-TRAF6-TAK1 cascade mediates signaling to NF-ĸB from Toll-like receptor 4. J. Biol. Chem. 2006, 281, 26029–26040. [Google Scholar] [CrossRef] [Scilit]
- Kawai, T.; Akira, S. Signaling to NF-ĸB by Toll-like receptors. Trends Mol. Med. 2007, 13, 460–469. [Google Scholar] [CrossRef] [Scilit]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.C. NF-κB signaling in inflammation. Signal Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yum, S.; Li, M.; Fang, Y.; Chen, Z.J. TBK1 recruitment to STING activates both IRF3 and NF-κB that mediate immune defense against tumors and viral infections. Proc. Natl. Acad. Sci. USA 2021, 118, e2100225118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tully, J.E.; Hoffman, S.M.; Lahue, K.G.; Nolin, J.D.; Anathy, V.; Lundblad, L.K.; Daphtary, N.; Aliyeva, M.; Black, K.E.; Dixon, A.E.; et al. Epithelial NF-ĸB orchestrates house dust mite-induced airway inflammation, hyperresponsiveness, and fibrotic remodeling. J. Immunol. 2013, 191, 5811–5821. [Google Scholar] [CrossRef] [Scilit]
- Edwards, M.R.; Bartlett, N.W.; Clarke, D.; Birrell, M.; Belvisi, M.; Johnston, S.L. Targeting the NF-ĸB pathway in asthma and chronic obstructive pulmonary disease. Pharmacol. Ther. 2009, 121, 1–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Q.; Siebert, R.; Yan, M.; Hinzmann, B.; Cui, X.; Xue, L.; Rakestraw, K.M.; Naeve, C.W.; Beckmann, G.; Weisenburger, D.D.; et al. Inactivating mutations and overexpression of BCL10, a caspase recruitment domain-containing gene, in MALT lymphoma with t(1;14)(p22;q32). Nat. Genet. 1999, 22, 63–68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ramakrishnan, R.K.; Bajbouj, K.; Hachim, M.Y.; Mogas, A.K.; Mahboub, B.; Olivenstein, R.; Hamoudi, R.; Halwani, R.; Hamid, Q. Enhanced mitophagy in bronchial fibroblasts from severe asthmatic patients. PLoS ONE 2020, 15, e0242695. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Torres, J.M.; Martinez-Barricarte, R.; Garcia-Gomez, S.; Mazariegos, M.S.; Itan, Y.; Boisson, B.; Rholvarez, R.; Jimenez-Reinoso, A.; del Pino, L.; Rodriguez-Pena, R.; et al. Inherited BCL10 deficiency impairs hematopoietic and nonhematopoietic immunity. J. Clin. Investig. 2014, 124, 5239–5248. [Google Scholar] [CrossRef] [Scilit]
- Yan, M.; Lee, J.; Schilbach, S.; Goddard, A.; Dixit, V. mE10, a novel caspase recruitment domain-containing proapoptotic molecule. J. Biol. Chem. 1999, 274, 10287–10292. [Google Scholar] [CrossRef] [Scilit]
- Tian, M.T.; Gonzalez, G.; Scheer, B.; DeFranco, A.L. Bcl10 can promote survival of antigen-stimulated B lymphocytes. Blood 2005, 106, 2105–2112. [Google Scholar] [CrossRef] [Scilit]
- Rueda, D.; Gaide, O.; Ho, L.; Lewkowicz, E.; Niedergang, F.; Hailfinger, S.; Rebeaud, F.; Guzzardi, M.; Conne, B.; Thelen, M.; et al. Bcl10 controls TCR- and FcgammaR-induced actin polymerization. J. Immunol. 2007, 178, 4373–4384. [Google Scholar] [CrossRef] [Scilit]
- Marion, S.; Mazzolini, J.; Herit, F.; Bourdoncle, P.; Kambou-Pene, N.; Hailfinger, S.; Sachse, M.; Ruland, J.; Benmerah, A.; Echard, A.; et al. The NF-ĸB signaling protein Bcl10 regulates actin dynamics by controlling AP1 and OCRL-bearing vesicles. Dev. Cell 2012, 23, 954–967. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Symons, M.H.; Mitchison, T.J. Control of actin polymerization in live and permeabilized fibroblasts. J. Cell Biol. 1991, 114, 503–513. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lam, D.; Ng, N.; Lee, S.; Batzer, G.; Horner, A.A. Airway house dust extract exposures modify allergen-induced airway hypersensitivity responses by TLR4-dependent and independent pathways. J. Immunol. 2008, 181, 2925–2932. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Chen, Q.; Chu, C.; You, H.; Jin, M.; Zhao, X.; Zhu, X.; Zhou, W.; Ji, W. Ovalbumin-induced experimental allergic asthma is Toll-like receptor 2 dependent. Allergy Asthma Proc. 2014, 35, e15–e20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Paik, Y.H.; Schwabe, R.F.; Bataller, R.; Russo, M.P.; Jobin, C.; Brenner, D.A. Toll-like receptor 4 mediates inflammatory signaling by bacterial lipopolysaccharide in human hepatic stellate cells. Hepatology 2003, 37, 1043–1055. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yokoyama, T.; Komori, A.; Nakamura, M.; Takii, Y.; Kamihira, T.; Shimoda, S.; Mori, T.; Fujiwara, S.; Koyabu, M.; Taniguchi, K.; et al. Human intrahepatic biliary epithelial cells function in innate immunity by producing IL-6 and IL-8 via the TLR4-NF-ĸB and -MAPK signaling pathways. Liver Int. 2006, 26, 467–476. [Google Scholar] [CrossRef] [Scilit]
- Kenyon, N.J.; Ward, R.W.; McGrew, G.; Last, J.A. TGF-beta1 causes airway fibrosis and increased collagen I and III mRNA in mice. Thorax 2003, 58, 772–777. [Google Scholar] [CrossRef] [Scilit]
- Juhl, P.; Bondesen, S.; Hawkins, C.L.; Karsdal, M.A.; Bay-Jensen, A.C.; Davies, M.J.; Siebuhr, A.S. Dermal fibroblasts have different extracellular matrix profiles induced by TGF-β, PDGF and IL-6 in a model for skin fibrosis. Sci. Rep. 2020, 10, 17300. [Google Scholar] [CrossRef] [Scilit]
- Neveu, W.A.; Allard, J.L.; Raymond, D.M.; Bourassa, L.M.; Burns, S.M.; Bunn, J.Y.; Irvin, C.G.; Kaminsky, D.A.; Rincon, M. Elevation of IL-6 in the allergic asthmatic airway is independent of inflammation but associates with loss of central airway function. Respir. Res. 2010, 11, 28. [Google Scholar] [CrossRef] [Scilit]
- Peters, M.C.; Mauger, D.; Ross, K.R.; Phillips, B.; Gaston, B.; Cardet, J.C.; Israel, E.; Levy, B.D.; Phipatanakul, W.; Jarjour, N.N.; et al. Evidence for Exacerbation-Prone Asthma and Predictive Biomarkers of Exacerbation Frequency. Am. J. Respir. Crit. Care Med. 2020, 202, 973–982. [Google Scholar] [CrossRef] [Scilit]
- Kobayashi, T.; Tanaka, K.; Fujita, T.; Umezawa, H.; Amano, H.; Yoshioka, K.; Naito, Y.; Hatano, M.; Kimura, S.; Tatsumi, K.; et al. Bidirectional role of IL-6 signal in pathogenesis of lung fibrosis. Respir. Res. 2015, 16, 99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ordonez, C.L.; Shaughnessy, T.E.; Matthay, M.A.; Fahy, J.V. Increased neutrophil numbers and IL-8 levels in airway secretions in acute severe asthma: Clinical and biologic significance. Am. J. Respir. Crit. Care Med. 2000, 161 Pt 1, 1185–1190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shannon, J.; Ernst, P.; Yamauchi, Y.; Olivenstein, R.; Lemiere, C.; Foley, S.; Cicora, L.; Ludwig, M.; Hamid, Q.; Martin, J.G. Differences in airway cytokine profile in severe asthma compared to moderate asthma. Chest 2008, 133, 420–426. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fernando, R.I.; Castillo, M.D.; Litzinger, M.; Hamilton, D.H.; Palena, C. IL-8 signaling plays a critical role in the epithelial-mesenchymal transition of human carcinoma cells. Cancer Res. 2011, 71, 5296–5306. [Google Scholar] [CrossRef] [Scilit]
- Kristan, S.S.; Marc, M.M.; Kern, I.; Flezar, M.; Suskovic, S.; Kosnik, M.; Korosec, P. Airway angiogenesis in stable and exacerbated chronic obstructive pulmonary disease. Scand. J. Immunol. 2012, 75, 109–114. [Google Scholar] [CrossRef] [Scilit]
- Kuo, P.L.; Hsu, Y.L.; Huang, M.S.; Chiang, S.L.; Ko, Y.C. Bronchial epithelium-derived IL-8 and RANTES increased bronchial smooth muscle cell migration and proliferation by Kruppel-like factor 5 in areca nut-mediated airway remodeling. Toxicol. Sci. 2011, 121, 177–190. [Google Scholar] [CrossRef] [Scilit]
- Halwani, R.; Al-Muhsen, S.; Al-Jahdali, H.; Hamid, Q. Role of transforming growth factor-β in airway remodeling in asthma. Am. J. Respir. Cell Mol. Biol. 2011, 44, 127–133. [Google Scholar] [CrossRef] [Scilit]
- Michał, P.; Konrad, S.; Piotr, K. TGF-β gene polimorphisms as risk factors for asthma control among clinic patients. J. Inflamm. 2021, 18, 28. [Google Scholar] [CrossRef] [Scilit]
- Chakir, J.; Shannon, J.; Molet, S.; Fukakusa, M.; Elias, J.; Laviolette, M.; Boulet, L.P.; Hamid, Q. Airway remodeling-associated mediators in moderate to severe asthma: Effect of steroids on TGF-beta, IL-11, IL-17, and type I and type III collagen expression. J. Allergy Clin. Immunol. 2003, 111, 1293–1298. [Google Scholar] [CrossRef] [Scilit]
- Klemm, S.; Zimmermann, S.; Peschel, C.; Mak, T.W.; Ruland, J. Bcl10 and Malt1 control lysophosphatidic acid-induced NF-ĸB activation and cytokine production. Proc. Natl. Acad. Sci. USA 2007, 104, 134–138. [Google Scholar] [CrossRef] [Scilit]
- Barnes, P.J. Corticosteroid effects on cell signalling. Eur. Respir. J. 2006, 27, 413–426. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Athari, S.S. Targeting cell signaling in allergic asthma. Signal Transduct. Target. Ther. 2019, 4, 45. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Gene Name | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
|---|---|---|
| TLR4 | GCAGTTTCTGAGCAGTCGTGC | CGTCTCCAGAAGATGTGCCGC |
| BCL10 | GAAGTGAAGAAGGACGCCTTAG | AGATGATCAAAATGTCTCTCAGC |
| MALT1 | CTCCGCCTCAGTTGCCTAGA | CAACCTTTTTCACCCATTAACTTCA |
| CARMA3/CARD10 | GGAGCCTCAGACCCTACAGTT | GCAGGTCTAGCAGGTTACGG |
| IκBα | CTGGGCATCGTGGAGCTTTTGG | TCTGTTGACATCAGCCCCACAC |
| A20 | AATGGCTTCCACAGACACACC | CAAAGGGGCGAAATTGGAACC |
| RELA | GCCGAGTGAACCGAAACTCTGG | TTGTCGGTGCACATCAGCTTGC |
| IL-6 | GAAAGCAGCAAAGAGGCAC | GCACAGCTCTGGCTTGTTCC |
| IL-8 | CCACACTGCGCCAACACAG | CTTCTCCACAACCCTCTGC |
| TGF-β1 | AAATTGAGGGCTTTCGCCTTA | GAACCCGTTGATGTCCACTTG |
| COL1A1 | GATTGACCCCAACCAAGGCTG | GCCGAACCAGACATGCCTC |
| COL5A1 | GTCGATCCTAACCAAGGATGC | GAACCAGGAGCCCGGGTTTTC |
| FN1 | CTGGGAACACTTACCGAGTGGG | CCACCAGTCTCATGTGGTCTCC |
| TBK1 | AGCGGCAGAGTTAGGTGAAA | CCAGTGATCCACCTGGAGAT |
| IRF3 | TCTGCCCTCAACCGCAAAGAAG | TACTGCCTCCATTGGTGTC |
| IRF7 | GCTGGACGTGACCATCATGTA | GGGCCGTATAGGAACGTGC |
| IFNβ1 | CCTGTGGCAATTGAATGGGAGGC | AGATGGTCAATGCGGCGTCCTC |
| 18S | TGACTCAACACGGGAAACC | TCGCTCCACCAACTAAGAAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ramakrishnan, R.K.; Bajbouj, K.; Guimei, M.; Rawat, S.S.; Kalaji, Z.; Hachim, M.Y.; Mahboub, B.; Ibrahim, S.M.; Hamoudi, R.; Halwani, R.; et al. Bcl10 Regulates Lipopolysaccharide-Induced Pro-Fibrotic Signaling in Bronchial Fibroblasts from Severe Asthma Patients. Biomedicines 2022, 10, 1716. https://doi.org/10.3390/biomedicines10071716
Ramakrishnan RK, Bajbouj K, Guimei M, Rawat SS, Kalaji Z, Hachim MY, Mahboub B, Ibrahim SM, Hamoudi R, Halwani R, et al. Bcl10 Regulates Lipopolysaccharide-Induced Pro-Fibrotic Signaling in Bronchial Fibroblasts from Severe Asthma Patients. Biomedicines. 2022; 10(7):1716. https://doi.org/10.3390/biomedicines10071716
Chicago/Turabian StyleRamakrishnan, Rakhee K., Khuloud Bajbouj, Maha Guimei, Surendra Singh Rawat, Zaina Kalaji, Mahmood Y. Hachim, Bassam Mahboub, Saleh M. Ibrahim, Rifat Hamoudi, Rabih Halwani, and et al. 2022. "Bcl10 Regulates Lipopolysaccharide-Induced Pro-Fibrotic Signaling in Bronchial Fibroblasts from Severe Asthma Patients" Biomedicines 10, no. 7: 1716. https://doi.org/10.3390/biomedicines10071716
APA StyleRamakrishnan, R. K., Bajbouj, K., Guimei, M., Rawat, S. S., Kalaji, Z., Hachim, M. Y., Mahboub, B., Ibrahim, S. M., Hamoudi, R., Halwani, R., & Hamid, Q. (2022). Bcl10 Regulates Lipopolysaccharide-Induced Pro-Fibrotic Signaling in Bronchial Fibroblasts from Severe Asthma Patients. Biomedicines, 10(7), 1716. https://doi.org/10.3390/biomedicines10071716

