Melatonin Modulation of Radiation-Induced Molecular Changes in MCF-7 Human Breast Cancer Cells
Abstract
:1. Introduction
1.1. Radiotherapy in Cancer: Current Deficits in Breast Cancer Management
1.2. Multifunctional Role of Melatonin in Anti-Cancer Protection
1.3. Melatonin as an Effective Radiosensitizer in Cancer Cells and a Radioprotector of Non-Tumor Tissues
1.4. Focus of the Current Study: Melatonin as a Helper in Anti-Cancer Radiation Therapy
2. Materials and Methods
2.1. Cells and Culture Conditions
2.2. Ionizing Radiation
2.3. Cell Proliferation Assay
2.4. Total RNA Extraction and cDNA Synthesis
2.5. RT2 Profiler TM PCR Gene Expression Array
2.6. Conversion of Mature microRNA into cDNA
2.7. Breast Cancer Pathway-Focused microRNA PCR Array
2.8. Analysis of Specific Gene Expression
2.9. Analysis of Specific microRNA Expression
2.10. Phosphokinase Screening
2.11. Western Blot Analysis
2.12. Chick Chorioallantoic Membrane (CAM) Model of Angiogenesis
2.13. Statistical Analysis
3. Results
3.1. Effects of Melatonin and Ionizing Radiation on the Proliferation of MCF-7 Cells
3.2. Effects of Ionizing Radiation and Melatonin on the Expression of Cancer-Related Genes
3.3. Effects of Ionizing Radiation and Melatonin on the Expression of Cancer-Related miRNAs
3.4. Effects of Ionizing Radiation and Melatonin on Kinase Intracellular Regulators
3.5. Influence of Melatonin and Radiation on Newly Formed Blood Vessels in an In Vivo Angiogenesis Assay
4. Discussion
4.1. Current Deficits in Radiation Therapy
4.2. Usefulness of Radiosensitizers
4.3. Melatonin as a Radiosensitizer in Breast Cancer
4.4. Melatonin Enhances the Anti-Proliferative Effects of Ionizing Radiation in MCF-7 Cells
4.5. The Protective Role of Melatonin Based on the Regulation of Gene Expression Altered by Ionizing Radiation
4.6. The Protective Role of Melatonin Is Also Based on the Regulation of miRNA Expression Altered by Ionizing Radiation
4.7. Melatonin Regulates Kinase Intracellular Regulators in Radiated MCF-7 Cells
4.8. Melatonin and Radiation Cooperate in the Inhibition of the Formation of New Blood Vessels In Vivo
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Nair, C.K.K.; Parida, D.K.; Nomura, T. Radioprotectors in Radiotherapy. J. Radiat. Res. 2001, 42, 21–37. [Google Scholar] [CrossRef] [PubMed]
- Alonso-González, C.; González, A.; Menéndez-Menéndez, J.; Martínez-Campa, C.; Cos, S. Melatonin as a Radio-Sensitizer in Cancer. Biomedicines 2020, 8, 247. [Google Scholar] [CrossRef] [PubMed]
- Shinomiya, N. New concepts in radiation-induced apoptosis: ‘premitotic apoptosis’ and ‘postmitotic apoptosis’. J. Cell. Mol. Med. 2001, 5, 240–253. [Google Scholar] [CrossRef] [PubMed]
- González, A.; Alonso-González, C.; González-González, A.; Menéndez-Menéndez, J.; Cos, S.; Martínez-Campa, C. Melatonin as an Adjuvant to Antiangiogenic Cancer Treatments. Cancers 2021, 13, 3263. [Google Scholar] [CrossRef]
- Jackson, R.K.; Liew, L.P.; Hay, M.P. Overcoming Radioresistance: Small Molecule Radiosensitisers and Hypoxia-activated Prodrugs. Clin. Oncol. 2019, 31, 290–302. [Google Scholar] [CrossRef]
- Reiter, R.J.; Rosales-Corral, S.A.; Tan, D.-X.; Acuna-Castroviejo, D.; Qin, L.; Yang, S.-F.; Xu, K. Melatonin, a Full Service Anti-Cancer Agent: Inhibition of Initiation, Progression and Metastasis. Int. J. Mol. Sci. 2017, 18, 843. [Google Scholar] [CrossRef] [Green Version]
- Menéndez-Menéndez, J.; Martínez-Campa, C. Melatonin: An Anti-Tumor Agent in Hormone-Dependent Cancers. Int. J. Endocrinol. 2018, 2018, 3271948. [Google Scholar] [CrossRef]
- Martínez-Campa, C.; Menéndez-Menéndez, J.; Alonso-González, C.; González, A.; Álvarez-García, V.; Cos, S. What is known about melatonin, chemotherapy and altered gene expression in breast cancer. Oncol. Lett. 2017, 13, 2003–2014. [Google Scholar] [CrossRef] [Green Version]
- Talib, W.; Alsayed, A.; Abuawad, A.; Daoud, S.; Mahmod, A. Melatonin in Cancer Treatment: Current Knowledge and Future Opportunities. Molecules 2021, 26, 2506. [Google Scholar] [CrossRef]
- Zhu, H.; Chen, Y.; Bai, L.-C.; Cao, X.-R.; Xu, R. Different Effects of Melatonin on X-Rays-Irradiated Cancer Cells in a Dose-Dependent Manner. Dose Response 2019, 17, 1559325819877271. [Google Scholar] [CrossRef]
- Alonso-González, C.; González, A.; Martínez-Campa, C.; Menéndez-Menéndez, J.; Gómez-Arozamena, J.; García-Vidal, A.; Cos, S. Melatonin enhancement of the radiosensitivity of human breast cancer cells is associated with the modulation of proteins involved in estrogen biosynthesis. Cancer Lett. 2015, 370, 145–152. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Q.; Sun, Z.; Du, L.; Xu, C.; Wang, Y.; Yang, B.; He, N.; Wang, J.; Ji, K.; Liu, Y.; et al. Melatonin Sensitizes Human Colorectal Cancer Cells to γ-ray Ionizing Radiation In Vitro and In Vivo. Int. J. Mol. Sci. 2018, 19, 3974. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alonso-Gonzalez, C.; González, A.; Martínez-Campa, C.M.; Gómez-Arozamena, J.; Cos, S. Melatonin sensitizes human breast cancer cells to ionizing radiation by downregulating proteins involved in double-strand DNA break repair. J. Pineal Res. 2015, 58, 189–197. [Google Scholar] [CrossRef] [PubMed]
- González-González, A.; Nieto, E.G.; Sánchez-Fernández, C.; Alonso-González, C.; Menéndez-Menéndez, J.; Gómez-Arozamena, J.; Cos, S.; Martínez-Campa, C. Melatonin Modulation of Radiation and Chemotherapeutics-induced Changes on Differentiation of Breast Fibroblasts. Int. J. Mol. Sci. 2019, 20, 3935. [Google Scholar] [CrossRef] [Green Version]
- González-González, A.; Rueda, N.; Alonso-González, C.; Menéndez-Menéndez, J.; Gómez-Arozamena, J.; Martínez-Campa, C.; Cos, S. Melatonin Enhances the Usefulness of Ionizing Radiation: Involving the Regulation of Different Steps of the Angiogenic Process. Front. Physiol. 2019, 10, 879. [Google Scholar] [CrossRef] [Green Version]
- Rodrigues, G.; Choy, H.; Bradley, J.; Rosenzweig, K.E.; Bogart, J.; Curran, W.J.; Gore, E.; Langer, C.; Louie, A.V.; Lutz, S.; et al. Definitive radiation therapy in locally advanced non-small cell lung cancer: Executive summary of an American Society for Radiation Oncology (ASTRO) evidence-based clinical practice guideline. Pr. Radiat. Oncol. 2015, 5, 141–148. [Google Scholar] [CrossRef]
- Klopp, A.; Smith, B.; Alektiar, K.; Cabrera, A.; Damato, A.L.; Erickson, B.; Fleming, G.; Gaffney, D.; Greven, K.; Lu, K.; et al. The role of postoperative radiation therapy for endometrial cancer: Executive Summary of an American Society for Radiation Oncology evidence-based guideline. Pr. Radiat. Oncol. 2014, 4, 137–144. [Google Scholar] [CrossRef] [Green Version]
- Valicenti, R.K.; Thompson, I.; Albertsen, P.; Davis, B.J.; Goldenberg, S.L.; Wolf, J.S.; Sartor, O.; Klein, E.; Hahn, C.; Michalski, J.; et al. Adjuvant and Salvage Radiation Therapy After Prostatectomy: American Society for Radiation Oncology/American Urological Association Guidelines. Int. J. Radiat. Oncol. Biol. Phys. 2013, 86, 822–828. [Google Scholar] [CrossRef]
- Al-Abedi, R.; Cagatay, S.T.; Mayah, A.; Brooks, S.A.; Kadhim, M. Ionising Radiation Promotes Invasive Potential of Breast Cancer Cells: The Role of Exosomes in the Process. Int. J. Mol. Sci. 2021, 22, 11570. [Google Scholar] [CrossRef]
- Allison, R.; Dicker, A. Minimizing morbidity in radiation oncology: A special issue from Future Oncology. Futur. Oncol. 2014, 10, 2303–2305. [Google Scholar] [CrossRef] [Green Version]
- Fernandez-Gil, B.I.; Guerra-Librero, A.; Shen, Y.-Q.; Florido, J.; Ruiz, L.M.; García-López, S.; Adan, C.; Rodríguez-Santana, C.; Acuña-Castroviejo, D.; Quiñones-Hinojosa, A.; et al. Melatonin Enhances Cisplatin and Radiation Cytotoxicity in Head and Neck Squamous Cell Carcinoma by Stimulating Mitochondrial ROS Generation, Apoptosis, and Autophagy. Oxidative Med. Cell. Longev. 2019, 2019, 7187128. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Beckta, J.M.; Ahmad, S.F.; Yang, H.; Valerie, K.; Beckta, J.M. Revisiting p53 for cancer-specific chemo- and radiotherapy: Ten years after. Cell Cycle 2014, 13, 710–713. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wei, X.; Xu, H.; Kufe, D. Human Mucin 1 Oncoprotein Represses Transcription of thep53Tumor Suppressor Gene. Cancer Res. 2007, 67, 1853–1858. [Google Scholar] [CrossRef] [Green Version]
- Detappe, A.; Mathieu, C.; Jin, C.; Agius, M.P.; Diringer, M.-C.; Tran, V.-L.; Pivot, X.; Lux, F.; Tillement, O.; Kufe, D.; et al. Anti-MUC1-C Antibody–Conjugated Nanoparticles Potentiate the Efficacy of Fractionated Radiation Therapy. Int. J. Radiat. Oncol. Biol. Phys. 2020, 108, 1380–1389. [Google Scholar] [CrossRef]
- Bhatt, A.; Patel, S.; Matossian, M.; Ucar, D.; Miele, L.; Burow, M.; Flaherty, P.; Cavanaugh, J. Molecular Mechanisms of Epithelial to Mesenchymal Transition Regulated by ERK5 Signaling. Biomolecules 2021, 11, 183. [Google Scholar] [CrossRef]
- Hu, Y.; Xu, K.; Yagüe, E. miR-218 targets survivin and regulates resistance to chemotherapeutics in breast cancer. Breast Cancer Res. Treat. 2015, 151, 269–280. [Google Scholar] [CrossRef] [Green Version]
- Murley, J.S.; Miller, R.C.; Weichselbaum, R.R.; Grdina, D.J. TP53 Mutational Status and ROS Effect the Expression of the Survivin-Associated Radio-Adaptive Response. Radiat. Res. 2017, 188, 659–670. [Google Scholar] [CrossRef]
- Ritter, V.; Krautter, F.; Klein, D.; Jendrossek, V.; Rudner, J. Bcl-2/Bcl-xL inhibitor ABT-263 overcomes hypoxia-driven radioresistence and improves radiotherapy. Cell Death Dis. 2021, 12, 694. [Google Scholar] [CrossRef]
- Lafontaine, J.; Cardin, G.; Malaquin, N.; Boisvert, J.-S.; Rodier, F.; Wong, P. Senolytic Targeting of Bcl-2 Anti-Apoptotic Family Increases Cell Death in Irradiated Sarcoma Cells. Cancers 2021, 13, 386. [Google Scholar] [CrossRef]
- Li, X.-F.; Ma, L.; Lu, J.; Kong, L.-X.; Long, X.-H.; Liao, S.-H.; Chi, B.-R. Effect of ionizing radiation on transcription of colorectal cancer MDR1 gene of HCT-8 cells. Asian Pac. J. Trop. Med. 2013, 6, 407–409. [Google Scholar] [CrossRef] [Green Version]
- Janaki Ramaiah, M.; Vaishnave, S. BMI1 and PTEN are key determinants of breast cancer therapy: A plausible therapeutic target in breast cancer. Gene 2018, 678, 302–311. [Google Scholar] [CrossRef]
- Xu, L.-M.; Yu, H.; Yuan, Y.-J.; Zhang, J.; Ma, Y.; Cao, X.-C.; Wang, J.; Zhao, L.-J.; Wang, P. Overcoming of Radioresistance in Non-small Cell Lung Cancer by microRNA-320a Through HIF1α-Suppression Mediated Methylation of PTEN. Front. Cell Dev. Biol. 2020, 8, 553733. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, M.; Lai, T.H.; Kim, W.; Kim, D.R. A Functional Network Model of the Metastasis Suppressor PEBP1/RKIP and Its Regulators in Breast Cancer Cells. Cancers 2021, 13, 6098. [Google Scholar] [CrossRef] [PubMed]
- Elledge, R.M.; Allred, D.C. Prognostic and predictive value of p53 and p21 in breast cancer. Breast Cancer Res. Treat. 1998, 52, 79–98. [Google Scholar] [CrossRef] [PubMed]
- Kong, X.; Yu, D.; Wang, Z.; Li, S. Relationship between p53 status and the bioeffect of ionizing radiation (Review). Oncol. Lett. 2021, 22, 661. [Google Scholar] [CrossRef]
- Troschel, F.M.; Palenta, H.; Borrmann, K.; Heshe, K.; Hua, S.H.; Yip, G.W.; Kiesel, L.; Eich, H.T.; Götte, M.; Greve, B. Knockdown of the prognostic cancer stem cell marker Musashi-1 decreases radio-resistance while enhancing apoptosis in hormone receptor-positive breast cancer cells via p21WAF1/CIP1. J. Cancer Res. Clin. Oncol. 2021, 147, 3299–3312. [Google Scholar] [CrossRef]
- Correia, C.; Lee, S.-H.; Meng, X.W.; Vincelette, N.D.; Knorr, K.L.; Ding, H.; Nowakowski, G.S.; Dai, H.; Kaufmann, S.H. Emerging understanding of Bcl-2 biology: Implications for neoplastic progression and treatment. Biochim. Biophys. Acta 2015, 1853, 1658–1671. [Google Scholar] [CrossRef] [Green Version]
- Pisani, C.; Ramella, M.; Boldorini, R.; Loi, G.; Billia, M.; Boccafoschi, F.; Volpe, A.; Krengli, M. Apoptotic and predictive factors by Bax, Caspases 3/9, Bcl-2, p53 and Ki-67 in prostate cancer after 12 Gy single-dose. Sci. Rep. 2020, 10, 7050. [Google Scholar] [CrossRef]
- Linn, P.; Kohno, S.; Sheng, J.; Kulathunga, N.; Yu, H.; Zhang, Z.; Voon, D.; Watanabe, Y.; Takahashi, C. Targeting RB1 Loss in Cancers. Cancers 2021, 13, 3737. [Google Scholar] [CrossRef]
- Pesch, A.M.; Hirsh, N.H.; Michmerhuizen, A.R.; Jungles, K.M.; Wilder-Romans, K.; Chandler, B.C.; Liu, M.; Lerner, L.M.; Nino, C.A.; Ward, C.; et al. RB expression confers sensitivity to CDK4/6 inhibitor–mediated radiosensitization across breast cancer subtypes. JCI Insight 2022, 7, e154402. [Google Scholar] [CrossRef]
- Gray, M.; Turnbull, A.K.; Ward, C.; Meehan, J.; Martínez-Pérez, C.; Bonello, M.; Pang, L.Y.; Langdon, S.P.; Kunkler, I.H.; Murray, A.; et al. Development and characterisation of acquired radioresistant breast cancer cell lines. Radiat. Oncol. 2019, 14, 64. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, X.; Liang, Y.; Lian, C.; Peng, F.; Xiao, Y.; He, Y.; Ma, C.; Wang, Y.; Zhang, P.; Deng, Y.; et al. CST6 protein and peptides inhibit breast cancer bone metastasis by suppressing CTSB activity and osteoclastogenesis. Theranostics 2021, 11, 9821–9832. [Google Scholar] [CrossRef] [PubMed]
- Malpeli, G.; Innamorati, G.; Decimo, I.; Bencivenga, M.; Kamdje, A.H.N.; Perris, R.; Bassi, C. Methylation Dynamics of RASSF1A and Its Impact on Cancer. Cancers 2019, 11, 959. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, K.-H.; Huang, S.-F.; Chen, I.-H.; Liao, C.-T.; Wang, H.-M.; Hsieh, L.-L. Methylation of RASSF1A, RASSF2A, and HIN-1 Is Associated with Poor Outcome after Radiotherapy, but not Surgery, in Oral Squamous Cell Carcinoma. Clin. Cancer Res. 2009, 15, 4174–4180. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kang, J.; Kim, W.; Kwon, T.; Youn, H.; Kim, J.S.; Youn, B. Plasminogen activator inhibitor-1 enhances radioresistance and aggressiveness of non-small cell lung cancer cells. Oncotarget 2016, 7, 23961–23974. [Google Scholar] [CrossRef] [Green Version]
- Nantajit, D.; Chailapakul, P.; Bawornpatarapakorn, S.; Chamchod, S.; Laebua, K. Prognostic significance of uPA and uPAR expression in patients with cervical cancer undergoing radiotherapy. Oncol. Lett. 2021, 21, 423. [Google Scholar] [CrossRef]
- Nguyen, Y.T.-K.; Moon, J.Y.; Ediriweera, M.K.; Cho, S.K. Phenethyl Isothiocyanate Suppresses Stemness in the Chemo- and Radio-Resistant Triple-Negative Breast Cancer Cell Line MDA-MB-231/IR Via Downregulation of Metadherin. Cancers 2020, 12, 268. [Google Scholar] [CrossRef] [Green Version]
- Sharma, B.; Singh, V.J.; Chawla, P.A. Epidermal growth factor receptor inhibitors as potential anticancer agents: An update of recent progress. Bioorganic Chem. 2021, 116, 105393. [Google Scholar] [CrossRef]
- Kambach, D.M.; Sodi, V.L.; Lelkes, P.I.; Azizkhan-Clifford, J.; Reginato, M.J. ErbB2, FoxM1 and 14-3-3ζ prime breast cancer cells for invasion in response to ionizing radiation. Oncogene 2013, 33, 589–598. [Google Scholar] [CrossRef] [Green Version]
- Boudreau, A.; Tanner, K.; Wang, D.; Geyer, F.C.; Reis-Filho, J.S.; Bissell, M.J. 14-3-3σ stabilizes a complex of soluble actin and intermediate filament to enable breast tumor invasion. Proc. Natl. Acad. Sci. USA 2013, 110, E3937–E3944. [Google Scholar] [CrossRef] [Green Version]
- Menéndez-Menéndez, J.; Hermida-Prado, F.; Granda-Díaz, R.; González, A.; García-Pedrero, J.M.; Del-Río-Ibisate, N.; Cos, S.; Alonso-González, C.; Martínez-Campa, C. Deciphering the Molecular Basis of Melatonin Protective Effects on Breast Cells Treated with Doxorubicin: TWIST1 a Transcription Factor Involved in EMT and Metastasis, a Novel Target of Melatonin. Cancers 2019, 11, 1011. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cicenas, J.; Urban, P.; Vuaroqueaux, V.; Labuhn, M.; Küng, W.; Wight, E.; Mayhew, M.; Eppenberger, U.; Eppenberger-Castori, S. Increased level of phosphorylated akt measured by chemiluminescence-linked immunosorbent assay is a predictor of poor prognosis in primary breast cancer overexpressing ErbB-2. Breast Cancer Res. 2005, 7, R394–R401. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, W.; Sun, M.; Li, S.; Chen, Z.; Geng, D. Transcription factor ATF 3 mediates the radioresistance of breast cancer. J. Cell. Mol. Med. 2018, 22, 4664–4675. [Google Scholar] [CrossRef] [Green Version]
- Aziz, M.H.; Shen, H.; Maki, C.G. Glucocorticoid Receptor Activation Inhibits p53-induced Apoptosis of MCF10Amyc Cells via Induction of Protein Kinase Cε. J. Biol. Chem. 2012, 287, 29825–29836. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bernardino-Sgherri, J.; Siberchicot, C.; Auvré, F.; Busso, D.; Brocas, C.; El Masri, G.; Lioutsko, A.; Ferri, F.; Radicella, J.P.; Romeo, P.-H.; et al. Tumor resistance to radiotherapy is triggered by an ATM/TAK1-dependent-increased expression of the cellular prion protein. Oncogene 2021, 40, 3460–3469. [Google Scholar] [CrossRef] [PubMed]
- Hattrup, C.L.; Fernandez-Rodriguez, J.; Schroeder, J.A.; Hansson, G.C.; Gendler, S.J. MUC1 can interact with adenomatous polyposis coli in breast cancer. Biochem. Biophys. Res. Commun. 2004, 316, 364–369. [Google Scholar] [CrossRef]
- Ouellette, M.M.; Zhou, S.; Yan, Y. Cell Signaling Pathways That Promote Radioresistance of Cancer Cells. Diagnostics 2022, 12, 656. [Google Scholar] [CrossRef]
- Lovitt, C.J.; Shelper, T.B.; Avery, V.M. Doxorubicin resistance in breast cancer cells is mediated by extracellular matrix proteins. BMC Cancer 2018, 18, 41. [Google Scholar] [CrossRef] [Green Version]
- Liverani, C.; De Vita, A.; Spadazzi, C.; Miserocchi, G.; Cocchi, C.; Bongiovanni, A.; De Lucia, A.; La Manna, F.; Fabbri, F.; Tebaldi, M.; et al. Lineage-specific mechanisms and drivers of breast cancer chemoresistance revealed by 3D biomimetic culture. Mol. Oncol. 2021, 16, 921–939. [Google Scholar] [CrossRef]
- Abba, M.C.; Nunez, M.I.; Colussi, A.G.; Croce, M.V.; Segal-Eiras, A.; Aldaz, C.M. GATA3 protein as a MUC1 transcriptional regulator in breast cancer cells. Breast Cancer Res. 2006, 8, R64. [Google Scholar] [CrossRef] [Green Version]
- Nurzadeh, M.; Naemi, M.; Hasani, S.S. A comprehensive review on oncogenic miRNAs in breast cancer. J. Genet. 2021, 100, 15. [Google Scholar] [CrossRef]
- Gruszka, R.; Zakrzewska, M. The Oncogenic Relevance of miR-17-92 Cluster and Its Paralogous miR-106b-25 and miR-106a-363 Clusters in Brain Tumors. Int. J. Mol. Sci. 2018, 19, 879. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tehler, D.E.; Høyland-Kroghsbo, N.M.; Lund, A.H. The miR-10 microRNA precursor family. RNA Biol. 2011, 8, 728–734. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luengo-Gil, G.; Gonzalez-Billalabeitia, E.; Perez-Henarejos, S.A.; Manzano, E.N.; Chaves-Benito, A.; Garcia-Martinez, E.; Garcia-Garre, E.; Vicente, V.; De La Peña, F.A. Angiogenic role of miR-20a in breast cancer. PLoS ONE 2018, 13, e0194638. [Google Scholar] [CrossRef] [PubMed]
- Wu, K.; Feng, J.; Lyu, F.; Xing, F.; Sharma, S.; Liu, Y.; Wu, S.-Y.; Zhao, D.; Tyagi, A.; Deshpande, R.P.; et al. Exosomal miR-19a and IBSP cooperate to induce osteolytic bone metastasis of estrogen receptor-positive breast cancer. Nat. Commun. 2021, 12, 5196. [Google Scholar] [CrossRef] [PubMed]
- An, G.; Lu, F.; Huang, S.; Bai, J.; He, L.; Liu, Y.; Hou, L. Effects of miR-93 on epithelial-to-mesenchymal transition and vasculogenic mimicry in triple-negative breast cancer cells. Mol. Med. Rep. 2020, 23, 30. [Google Scholar] [CrossRef]
- Wu, Y.; Shi, W.; Tang, T.; Wang, Y.; Yin, X.; Chen, Y.; Zhang, Y.; Xing, Y.; Shen, Y.; Xia, T.; et al. miR-29a contributes to breast cancer cells epithelial-mesenchymal transition, migration, and invasion via down-regulating histone H4K20 trimethylation through directly targeting SUV420H2. Cell Death Dis. 2019, 10, 176, Erratum in: Cell Death Dis. 2019, 10, 856. [Google Scholar] [CrossRef]
- Ahmad, A.; Ginnebaugh, K.R.; Sethi, S.; Chen, W.; Ali, R.; Mittal, S.; Sarkar, F.H. miR-20b is up-regulated in brain metastases from primary breast cancers. Oncotarget 2015, 6, 12188–12195. [Google Scholar] [CrossRef] [Green Version]
- Chen, D.; Su, H.; Li, Y.; Wu, X.; Li, Y.; Wei, C.; Shi, D.; Gao, Y.; Zhou, Q.; Wang, Q.; et al. miR-20b and miR-125a promote tumorigenesis in radioresistant esophageal carcinoma cells. Aging 2021, 13, 9566–9581. [Google Scholar] [CrossRef]
- Wang, Y.; Xu, W.; Wang, Y.; Xu, X.; Lv, S.; Dong, X. miR-17-5p promotes migration and invasion in breast cancer cells by repressing netrin 4. Int. J. Clin. Exp. Pathol. 2019, 12, 1649–1657. [Google Scholar]
- Taha, M.; Mitwally, N.; Soliman, A.; Yousef, E. Potential Diagnostic and Prognostic Utility of miR-141, miR-181b1, and miR-23b in Breast Cancer. Int. J. Mol. Sci. 2020, 21, 8589. [Google Scholar] [CrossRef] [PubMed]
- Debeb, B.G.; Lacerda, L.; Anfossi, S.; Diagaradjane, P.; Chu, K.; Bambhroliya, A.; Huo, L.; Wei, C.; Larson, R.A.; Wolfe, A.R.; et al. miR-141-Mediated Regulation of Brain Metastasis From Breast Cancer. JNCI J. Natl. Cancer Inst. 2016, 108, djw026. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lan, F.; Yue, X.; Ren, G.; Li, H.; Ping, L.; Wang, Y.; Xia, T. miR-15a/16 Enhances Radiation Sensitivity of Non-Small Cell Lung Cancer Cells by Targeting the TLR1/NF-κB Signaling Pathway. Int. J. Radiat. Oncol. 2014, 91, 73–81. [Google Scholar] [CrossRef] [PubMed]
- Rana, S.; Espinosa-Diez, C.; Ruhl, R.; Chatterjee, N.; Hudson, C.; Fraile-Bethencourt, E.; Agarwal, A.; Khou, S.; Thomas, C.R.; Anand, S. Differential regulation of microRNA-15a by radiation affects angiogenesis and tumor growth via modulation of acid sphingomyelinase. Sci. Rep. 2020, 10, 5581. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stankevicins, L.; da Silva, A.P.A.; dos Passos, F.V.; Ferreira, E.D.S.; Ribeiro, M.C.M.; David, M.G.; Pires, E.J.; Ferreira-Machado, S.C.; Vassetzky, Y.; de Almeida, C.E.; et al. MiR-34a is up-regulated in response to low dose, low energy X-ray induced DNA damage in breast cells. Radiat. Oncol. 2013, 8, 231. [Google Scholar] [CrossRef] [Green Version]
- Imani, S.; Wei, C.; Cheng, J.; Khan, A.; Fu, S.; Yang, L.; Tania, M.; Zhang, X.; Xiao, X.; Zhang, X.; et al. MicroRNA-34a targets epithelial to mesenchymal transition-inducing transcription factors (EMT-TFs) and inhibits breast cancer cell migration and invasion. Oncotarget 2017, 8, 21362–21379. [Google Scholar] [CrossRef] [Green Version]
- Ghayad, S.E.; Cohen, P. Inhibitors of the PI3K/Akt/mTOR Pathway: New Hope for Breast Cancer Patients. Recent Patents Anti-Cancer Drug Discov. 2010, 5, 29–57. [Google Scholar] [CrossRef]
- González-González, A.; Rueda, N.; Alonso-González, C.; Menéndez, J.M.; Martínez-Campa, C.; Mitola, S.; Cos, S. Usefulness of melatonin as complementary to chemotherapeutic agents at different stages of the angiogenic process. Sci. Rep. 2020, 10, 4790. [Google Scholar] [CrossRef] [Green Version]







| Gene | Forward | Reverse |
|---|---|---|
| MUC1 | ccaagagcactccattctcaatt | tggcatcagtcttggtgctatg |
| MYC | tgaggaggaacaagaagatg | atccagactctgaccttttg |
| BIRC5 | tctccgcagtttcctcaaat | ggaccaccgcatctctacat |
| BCL2 | cctttggaatggaagcttag | gagggaatgttttctccttg |
| ABCB1 | gtacattaacatgatctggtc | cgttcatcagcttgatccgat |
| PTEN | aggtttcctctggtcctggt | cgacgggaagacaagttcat |
| NME1 | agaagtctccacggatggt | agaaaggattccgccttgtt |
| RASSF1 | atgaagtgcgtgaatgtatg | tgaggatcttgaaatctttat |
| CST6 | ctcctctcagctcctaaag | tttattgtgacagatacggc |
| TP53 | cctatgcttgtatggctaac | tagatccatgccttcttcttc |
| BAX2 | aactggacagtaacatggag | ttgctggcaaagtagaaaag |
| BAD | atcatggaggcgctg | cttaaaggagtccacaaactc |
| CDKN1A | cagcatgacagatttctacc | cagggtatgtacatgaggag |
| PGR | gagagctcatcaaggcaattgg | caccatccctgccaatatcttg |
| RB1 | accagatcatgtcagagag | taacctcccaatactccatc |
| SERPINE1 | atccacagctgtcatagtc | cacttggcccatgaaaag |
| SNAI2 | cagtgattatttccccgtatc | ccccaaagatgaggagtatc |
| SFN | tctgatcgtaggaattgagg | cacaggggaactttattgag |
| ERBB2 | ccagcctgaatatgtgaac | ccccaaaggcaaaaacg |
| AKT1 | aagtactctttccagaccc | ttctccagcttgaggtc |
| N3RC1 | actgcttctctcttcagttc | gattttcaaccacttcatgc |
| PLAU | gctttaagattattgggggag | atgtagtcctccttctttgg |
| ATM | gagaaaagaagccgtgg | catcactgtcactgcac |
| APC | agaggtcatctcagaacaag | catgttgatttctcccactc |
| GATA3 | cggtccagcacaggcagggagt | gagcccacaggcattgcagaca |
| β-ACTIN | tagcacagcctggatagcaa | aaatctggcaccacaccttc |
| Breast Cancer Array | R vs. C | M + R vs. R | ||
|---|---|---|---|---|
| Up | Down | Up | Down | |
| Angiogenesis, cell adhesion and proteases | 7 | 14 | 8 | 20 |
| Signal transduction | 2 | 9 | 4 | 11 |
| Apoptosis and Cell cycle | 6 | 12 | 6 | 14 |
| DNA damage and repair | 5 | 3 | 2 | 4 |
| Transcription factors | 2 | 9 | 3 | 14 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alonso-González, C.; González-Abalde, C.; Menéndez-Menéndez, J.; González-González, A.; Álvarez-García, V.; González-Cabeza, A.; Martínez-Campa, C.; Cos, S. Melatonin Modulation of Radiation-Induced Molecular Changes in MCF-7 Human Breast Cancer Cells. Biomedicines 2022, 10, 1088. https://doi.org/10.3390/biomedicines10051088
Alonso-González C, González-Abalde C, Menéndez-Menéndez J, González-González A, Álvarez-García V, González-Cabeza A, Martínez-Campa C, Cos S. Melatonin Modulation of Radiation-Induced Molecular Changes in MCF-7 Human Breast Cancer Cells. Biomedicines. 2022; 10(5):1088. https://doi.org/10.3390/biomedicines10051088
Chicago/Turabian StyleAlonso-González, Carolina, Cristina González-Abalde, Javier Menéndez-Menéndez, Alicia González-González, Virginia Álvarez-García, Alicia González-Cabeza, Carlos Martínez-Campa, and Samuel Cos. 2022. "Melatonin Modulation of Radiation-Induced Molecular Changes in MCF-7 Human Breast Cancer Cells" Biomedicines 10, no. 5: 1088. https://doi.org/10.3390/biomedicines10051088
APA StyleAlonso-González, C., González-Abalde, C., Menéndez-Menéndez, J., González-González, A., Álvarez-García, V., González-Cabeza, A., Martínez-Campa, C., & Cos, S. (2022). Melatonin Modulation of Radiation-Induced Molecular Changes in MCF-7 Human Breast Cancer Cells. Biomedicines, 10(5), 1088. https://doi.org/10.3390/biomedicines10051088

