Myxovirus resistance (Mx) Gene Diversity in Avian Influenza Virus Infections
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Area and Chickens Investigated
2.2. Sample Collection
2.3. DNA Extraction from the Cellular Portion of the Blood
2.4. Primers and Restriction Enzymes
2.5. Amplification of Mx Gene by Polymerase Chain Reaction (PCR)
2.6. Mx Gene Diversity Analysis by Restriction Fragment Length Polymorphism (RFLP) Analysis
2.7. Anti-AIV Antibody Detection
2.8. Virus Isolation and Identification
2.9. Statistical Designs/Analytical Methods Used
3. Results
3.1. General Properties of Sampled Chickens
3.2. Detection of Mx Gene
3.3. Diversity of Mx Gene and Genotyping of Chickens
3.4. Serological Status of Chickens
3.5. Virological Status of Chickens
3.6. Association Analysis
4. Discussion
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Tareque, A.M.M.; Chowdhury, S.M.Z.H. Agricultural Research Priority: Vision- 2030 and Beyond. Sub-Sector: Livestock; Bangladesh Agricultural Research Council: Farmgate, Dhaka, Bangladesh, 2010.
- Bangladesh Economic Review, Chapter 7 Agriculture. 2021; pp. 91–105. Available online: https://mof.portal.gov.bd/site/page/28ba57f5-59ff-4426-970a-bf014242179e/Bangladesh-Economic-Review-2021 (accessed on 12 March 2022).
- Bhuiyan, A.K.F.H.; Bhuiyan, M.S.A.; Deb, G.K. Indigenous chicken genetic resources in Bangladesh: Current status and future outlook. Anim. Genet. Resour. 2005, 36, 73–84. [Google Scholar] [CrossRef]
- Bhuiyan, M.S.; Chen, S.; Faruque, S.; Bhuiyan, A.K.; Beja-Pereira, A. Genetic diversity and maternal origin of Bangladeshi chicken. Mol. Biol. Rep. 2013, 40, 4123–4128. [Google Scholar] [CrossRef]
- National Livestock Development Policy. Government of the People’s Republic of Bangladesh Ministry of Fisheries and Livestock. 2007; p. 9. Available online: http://nda.erd.gov.bd/files/1/Publications/Sectoral%20Policies%20and%20Plans/Livestock_Policy_Final.pdf (accessed on 12 March 2022).
- Gerloff, N.A.; Khan, S.U.; Zanders, N.; Balish, A.; Haider, N.; Islam, A.; Chowdhury, S.; Rahman, M.Z.; Haque, A.; Hosseini, P.; et al. Genetically diverse low pathogenicity avian influenza A virus subtypes co-circulate among poultry in Bangladesh. PLoS ONE 2016, 11, e0152131. [Google Scholar] [CrossRef] [PubMed]
- Nasreen, S.; Khan, S.U.; Luby, S.P.; Gurley, E.S.; Abedin, J.; Rashid-UzZaman Sohel, B.M.; Rahman, M.; Hancock, K.; Levine, M.Z.; Veguilla, V.; et al. Highly pathogenic avian influenza A(H5N1) virus infection among workers at live bird markets, Bangladesh, 2009–2010. Emerg. Infect. Dis. 2015, 21, 629–637. [Google Scholar] [CrossRef] [PubMed]
- Icddr, B. Unusual waterfowl mortality due to highly pathogenic avian influenza A (H5N1) virus in Netrokona, Bangladesh, 2011. Health Sci. Bull. 2013, 11, 15–20. [Google Scholar]
- Giasuddin, M.; Haque, M.E.; Kamal, A.H.M.; Islam, M.R.; Jahangir, A.; Chowdhury, E.H.; Taimur, M.J.F.A.; Rahman, M.H. Outbreak evaluation of highly pathogenic avian influenza in Bangladesh. Bang. J. Lives. Res. 2013, 19, 44–46. [Google Scholar] [CrossRef][Green Version]
- FAO-OIE-WHO. Technical Update: Current Evolution of Avian Influenza H5N1 Viruses. 2011. Available online: http://www.who.int/influenza/human_animal_interface/tripartite_notes_H5N1.pdf (accessed on 14 August 2016).
- Ansari, W.K.; Parvej, M.S.; Zowalaty, E.E.l.M.; Jackson, S.; Bustin, S.A.; Ibrahim, A.K.; Rahman, M.T.; Zhang, H.; Khan, M.F.R.; Ahamed, M.M.; et al. Surveillance, epidemiological, and virological detection of highly pathogenic H5N1 avian influenza viruses in duck and poultry from Bangladesh. Vet. Microbiol. 2016, 193, 49–59. [Google Scholar] [CrossRef][Green Version]
- Rushton, J.; Viscarra, R.; Guerne-Bleich, E.; Mcleod, A. Impact of influenza outbreaks in the poultry sectors of five South-east Asian countries (Cambodia, Indonesia, Lao PDR, Thailand, Viet Nam) outbreak costs, responses and potential long-term control. Worlds Poult. Sci. J. 2005, 61, 491–514. [Google Scholar] [CrossRef]
- Omar, M.; Sabur, S.; Moniruzzaman, M.; Hoq, M. Marketing channel, margin, and price behavior of egg in selected areas of Gazipur district. J. Bangladesh Agri. Univ. 2014, 11, 277–284. [Google Scholar] [CrossRef]
- Haller, O.; Kochs, G.; Weber, F. Interferon, Mx, and viral countermeasures. Cytokine Growth Factor Rev. 2007, 18, 425–433. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Nichols, J.E.; Valdez, R.; Mendelson, C.R.; Simpson, E.R. Tumor necrosis factor-% stimulates aromatase gene expression in human adipose stromal cells through use of an activating protein-1 binding site upstream of promoter 1.4. Mol. Endocrinol. 1996, 10, 1350–1357. [Google Scholar] [PubMed]
- Garber, E.A.; Rosenblum, C.I.; Chute, H.T.; Scheidel, L.M.; Chen, H. Avian retroviral expression of luciferase. Virology 1991, 185, 652–660. [Google Scholar] [CrossRef]
- Haller, O.; Frese, M.; Rost, D.; Nuttall, P.A.; Kochs, G. Tick-borne thogoto virus infection in mice is inhibited by the Orthomyxovirus resistance gene product Mx1. J. Virol. 1995, 69, 2596–2601. [Google Scholar] [CrossRef]
- Ko, J.H.; Jin, H.K.; Asano, A.; Takada, A.; Ninomiya, A.; Kida, H.; Hokiyama, H.; Ohara, M.; Tsuzuki, M.; Nishibori, M.; et al. Polymorphisms and the differential antiviral activity of the chicken Mx gene. Genome Res. 2002, 12, 595–601. [Google Scholar] [CrossRef] [PubMed]
- Sartika, T.; Sulandar, S.; Syamsul, M.; Zein, A. Selection of Mx gene genotype as genetic marker for Avian Influenza resistance in Indonesian indigenous chicken. BMC Proc. 2011, 5, S37. [Google Scholar] [CrossRef] [PubMed]
- Benfield, C.T.O.; Lyall, J.W.; Kochs, G.; Tiley, L.S. Asparagine 631 variants of the chicken Mx protein do not inhibit influenza virus replication in primary chicken embryo fibroblasts of in vitro surrogate assays. J. Virol. 2008, 82, 7533–7539. [Google Scholar] [CrossRef] [PubMed]
- Janzen, C.; Kochs, G.; Haller, O. A monomeric GTPase negative MxA mutant with antiviral activity. J. Virol. 2000, 74, 8202–8206. [Google Scholar] [CrossRef]
- Sironi, L.; Williams, J.L.; Moreno-Martin, A.M.; Ramelli, P.; Stella, A.; Jianlin, H.; Weigend, S.; Lombardi, G.; Cordioli, P.; Mariani, P. Susceptibility of different chicken lines to H7N1 highly pathogenic avian influenza virus and the role of Mx gene polymorphism coding amino acid position 631. Virology 2008, 380, 152–156. [Google Scholar] [CrossRef]
- Sironi, L.; Williams, J.L.; Stella, A.; Minozzi, G.; Moreno, A.; Ramelli, P.; Han, J.; Weigend, S.; Wan, J.; Lombardi, G.; et al. Genomic study of the response of chicken to highly pathogenic avian influenza virus. BMC Proc. 2011, 5 (Suppl. 4), S25. [Google Scholar] [CrossRef]
- Schusser, B.; Reuter, A.; Malsburg A von der Penski, N.; Weigend, S.; Kaspers, B.; Staeheli, P.; Härtle, S. Mx is dispensable for interferon-mediated resistance of chicken cells against influenza A virus. J. Virol. 2011, 85, 8307–8315. [Google Scholar] [CrossRef]
- Sánchez-González, R.; Ramis, A.; Nofrarías, M.; Wali, N.; Valle, R.; Pérez, M.; Perlas, A.; Majó, N. Pathobiology of the highly pathogenic avian influenza viruses H7N1 and H5N8 in different chicken breeds and role of Mx 2032 G/A polymorphism in infection outcome. Vet. Res. 2020, 51, 113. [Google Scholar] [CrossRef] [PubMed]
- Jahangir, A.; Hasan, M.; Hasan, K.; Giasuddin, M.; Rahman, M.H.; Alam, M.S.; Taimur, M.J.F.A. Genetic identification and restriction fragment length polymorphism (RFLP) based analysis of Myxovirus resistant gene (Mx) in chicken of Bangladesh. Bang. J. Livs. Res. 2013, 20, 18–25. [Google Scholar]
- Nag, M.; Rahman, M.M.; Bhuyan, A.A.; Hossain, M.M.K.; Alim, M.A.; Islam, M.S.; Akter, M.R.; Hasan, M.; Jahangir, A. Avian influenza resistant gene (Mx) and its diversity in chicken and duck. Intl. J. Anim. Biol. 2015, 1, 78–85. [Google Scholar]
- Uddin, M.H.; Ali, A.; Akter, Y.; Khatum, M.A. Geographical distribution, classification, characterization and conservation of different indigenous chicken varieties of Bangladesh. Bangladesh Res. Pub. J. 2011, 3, 227–233. [Google Scholar]
- International Livestock Research Institute Report. Status, Trends, Utilization and Performance of FAnGR of Bangladesh; Consultancy report of GEF-UNEP-ILRI FAnGR Asia Project; ILRI: Nairobi, Kenya, 2004; p. 49. [Google Scholar]
- Sambrook, J.; Russell, D.W. Purification of nucleic acids by extraction with phenol:chloroform. Cold Spring Harb Protoc. 2006. [Google Scholar] [CrossRef]
- Sironi, L.; Ramelli, P.; Williams, J.L.; Mariani, P. RFLP Genotyping protocol for chicken Mx gene G/A polymorphism associated with the S631N mutation. Genet. Mol. Res. 2010, 9, 1104–1108. [Google Scholar] [CrossRef]
- Seyama, T.; Ko, J.H.; Ohe, M.; Sasaoka, N.; Okada, A.; Gomi, H.; Yoneda, A.; Ueda, J.; Nishibori, M.; Okamoto, S.; et al. Population research of genetic polymorphism at amino acid position 631 in chicken Mx protein with differential antiviral activity. Biochem. Genet. 2006, 44, 437–448. [Google Scholar] [CrossRef]
- Hoffmann, E.; Stech, J.; Guan, Y.; Webster, R.G.; Perez, D.R. Universal primer set for the full-length amplification of all influenza A viruses. Arch. Virol. 2001, 6, 2275–2289. [Google Scholar] [CrossRef]
- Lee, M.S.; Chang, P.C.; Shien, J.H.; Cheng, M.C.; Shieh, H.K. Identification & subtyping of avian influenza viruses by reverse transcription-PCR. J. Virol. Methods 2001, 97, 13–22. [Google Scholar]
- Mase, M.; Imai, K.; Sanada, Y.; Sanada, N.; Yuasa, N.; Imada, T.; Tsukamoto, K.; Yamaguchi, S. Phylogenetic analysis of Newcastle disease virus genotypes isolated in Japan. J. Clin. Microbiol. 2002, 40, 3826–3830. [Google Scholar] [CrossRef]
- Mase, M.; Tsukamoto, K.; Imada, T.; Imai, K.; Tanimura, N.; Nakamura, K.; Yamamoto, Y.; Hitomi, T.; Kira, T.; Nakai, T.; et al. Characterization of H5N1 influenza A viruses isolated during the 2003–2004 influenza outbreaks in Japan. Virology 2005, 332, 167–176. [Google Scholar] [CrossRef] [PubMed]
- Tsukamoto, K.; Ashizawa, T.; Nakanishi, K.; Kaji, N.; Suzuki, K.; Shishido, M.; Okamatsu, M.; Mase, M. Use of reverse transcriptase PCR to subtype N1 to N9 neuraminidase genes of avian influenza viruses. J. Clin. Microbiol. 2009, 47, 2301–2303. [Google Scholar] [CrossRef] [PubMed]
- Hirst, G.K. The agglutination of red blood cells by allantoic fluid of chicken embryos infected with influenza virus. Science 1941, 94, 22–23. [Google Scholar] [CrossRef] [PubMed]
- Jahangir, A.; Ruenphet, S.; Ueda, S.; Ueno, Y.; Shoham, D.; Shindo, J.; Okamura, M.; Nakamura, M.; Takehara, K. Avian influenza and Newcastle disease viruses from northern pintail in Japan: Isolation, characterization and inter-annual comparisons during 2006–2008. Virus Res. 2009, 143, 44–52. [Google Scholar] [CrossRef] [PubMed]
- Nei, M.; Kumar, S. Molecular Evolution and Phylogenetics; Oxford University Press: New York, NY, USA, 2000. [Google Scholar]
- Subbarao, K.; Klimov, A.; Katz, J.; Regnery, H.; Lim, W.; Hall, H.; Perdue, M.; Swayne, D.; Bender, C.; Huang, J.; et al. Characterization of an avian influenza A (H5N1) virus isolated from a child with a fatal respiratory illness. Science 1998, 279, 393–396. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.H.; Vidal, S.M. Functional diversity of Mx proteins: Variations on a theme of host resistance to infection. Genome Res. 2002, 12, 527–530. [Google Scholar] [CrossRef]
- Watanabe, T. Polymorphisms of the chicken antiviral MX gene. Cytogenet. Genome Res. 2007, 117, 370–375. [Google Scholar] [CrossRef]
- Li, X.Y.; Qu, L.J.; Hou, Z.C.; Yao, J.F.; Xu, G.Y.; Yang, N. Genomic structure and diversity of the chicken Mx gene. Poult. Sci. 2007, 86, 786–789. [Google Scholar] [CrossRef]
- Bernasconi, D.; Schultz, U.; Staeheli, P. The interferon-induced Mx protein of chickens lacks antiviral activity. J. Interferon Cytokine Res. 1995, 15, 47–53. [Google Scholar] [CrossRef]
- Sulandari, S.; SyamsulArifinZein, M.; Astuti, D.; Sartika, T. Genetic polymorphisms of the chicken antiviral Mx gene in a variety of Indonesian indigenous chicken breeds. J. Veteriner. 2009, 10, 50–56. [Google Scholar]
- Jahangir, A.; Koike, I.; Giasuddin, M.; Rahman, M.M. Sero-prevalence of poultry diseases in indigenous chickens in Bangladesh. In Proceedings of the Abstracts of the 9th Annual Scientific Conference of the Bangladesh Society for Veterinary Education and Research (BSVER), Mymensingh, Bangladesh, 6–7 January 2003; BSVER: Mymensingh, Bangladesh, 2003. Abstract No. 11. [Google Scholar]
- Rahman, M.Z.; Harun-ur- Rashid, S.M.; Azam, M.G.; Nuruzzaman, M.; Rahman, M.G. Seroprevalence of Low Pathogenic Avian Influenza (H9) in Sonali Chickens of Joypurhat. ABC Res. Alert. 2020, 8, 78–83. [Google Scholar] [CrossRef]
- Nooruddin, G.M.; Hossain, M.T.; Mohammad, M.; Rahman, M.M. Seroepidemiology of avian influenza virus in indigenous chicken in Bangladesh. Int. J. Poult. Sci. 2006, 5, 1029–1033. [Google Scholar]
- Biswas, P.K.; Barua, H.; Uddin, G.M.N.; Biswas, D.; Ahad, A.; Debnath, N.C. Serosurvey of five viruses in chickens on smallholdings in Bangladesh. Prev. Vet. Med. 2009, 88, 67–71. [Google Scholar] [CrossRef] [PubMed]
- Khan, S.U.; Gurley, E.S.; Gerloff, N.; Rahman, M.Z.; Simpson, N.; Rahman, M.; Haider, N.; Chowdhury, S.; Balish, A.; Zaman, R.U.; et al. Avian influenza surveillance in domestic waterfowl and environment of live bird markets in Bangladesh, 2007–2012. Sci. Rep. 2018, 8, 9396. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.; Hong, Y.; Vu, T.H.; Lee, S.; Heo, J.; Truong, A.D.; Lillehoj, H.S.; Hong, Y.H. Influenza A pathway analysis of highly pathogenic avian influenza virus (H5N1) infection in genetically disparate Ri chicken lines. Vet. Immunol. Immunopathol. 2022, 246, 110404. [Google Scholar] [CrossRef]
- Looi, F.Y.; Baker, M.L.; Townson, T.; Richard, M.; Novak, B.; Doran, T.J.; Short, K.R. Creating Disease Resistant Chickens: A Viable Solution to Avian Influenza? Viruses 2018, 10, 561. [Google Scholar] [CrossRef]
- Qu, L.J.; Li, X.Y.; Xu, G.Y.; Ning, Z.H.; Yang, N. Lower Antibody Response in Chickens Homozygous for the Mx Resistant Allele to Avian Influenza. Asian-Aust. J. Anim. Sci. 2009, 22, 465–470. [Google Scholar]
- Li, X.Y.; Qu, L.J.; Yao, J.F.; Qu, L.J.; Yao, J.F.; Yang, N. Skewed allele frequencies of an Mx gene mutation with potential resistance to avian influenza virus in different chicken populations. Poult. Sci. 2006, 85, 1327–1329. [Google Scholar] [CrossRef]
- Hou, Z.C.; Xu, G.Y.; Su, Z. Purifying selection and positive selection on the myxovirus resistance gene in mammals and chickens. Gene 2007, 396, 188–195. [Google Scholar] [CrossRef]
- Berlin, S.; Qu, L.; Li, X.; Yang, N.; Ellegren, H. Positive diversifying selection in avian Mx genes. Immunogenetics 2008, 60, 689–697. [Google Scholar] [CrossRef]


| Sampling Location | Chicken Type | No. of Samples * | No. of Villages/ Farms | Age (mo.) | Sex | Health Condition |
|---|---|---|---|---|---|---|
| Indigenous Chickens | ||||||
| Savar, Dhaka | Common deshi | 105 | 3 | 6–11 | M = 40 F = 65 | Apparently healthy |
| Brahmanbaria Sadar | Aseel | 68 | 4 | 9–14 | M = 30 F = 38 | Apparently healthy |
| Madhupur, Tangail | Naked neck | 109 | 5 | 2–6 | M = 29 F = 80 | Apparently healthy |
| Bandarban Sadar | Hilly | 95 | 4 | 6–12 | M = 40 F = 55 | Apparently healthy |
| Commercial Chickens | ||||||
| Savar, Dhaka | Commercial (Breed X) | 50 | 5 | 12–16 | F = 50 | Apparently healthy |
| Gazipur Sadar | Commercial (Breed Y) | 45 | 3 | 11–16 | F = 45 | Apparently healthy |
| Savar, Dhaka | Sonali | 40 | 2 | 1 | M = 14 F = 26 | Apparently healthy |
| Total | 512 | |||||
| Primer Sequence 5′-3′ | PCR Product Size (bp) | Restriction Enzyme | Fragment Length upon Digestion | Reference |
|---|---|---|---|---|
| F: GCACTGTCACCTCTTAATAGA | 299 | Hpy8I | AA: 299 AG:299, 200, 99 GG: 200, 99 | [31] |
| R: GTATTGGTAGGCTTTGTTGA | ||||
| NE-F2: CCTTCAGCCTGTTTTTCTCCTTTTAGGAA | 100 | RsaI | AA: 100 AG:100, 73, 27 GG: 73, 27 | [32] |
| NE-R2/R: CAGAGGAATCTGATTGCTCAGGCGTGTA | ||||
| NE-F2: CCTTCAGCCTGTTTTTCTCCTTTTAGGAA | 100 | SspI | AA: 73, 27 AG: 100, 73, 27 GG: 100 | |
| NE-R2/S: CAGAGGAATCTGATTGCTCAGGCGAATA |
| Chicken Type | Total Samples | Genotype Frequency (No.) | Allele Frequency | Ho | He | HWE | |||
|---|---|---|---|---|---|---|---|---|---|
| AA | AG | GG | A | G | |||||
| Indigenous Chickens | |||||||||
| Common Deshi | 105 | 0.89 (93) | 0.11 (12) | 0.00 (0) | 0.95 | 0.05 | 0.11 | 0.10 | p > 0.05 |
| Aseel | 68 | 0.22 (15) | 0.71 (48) | 0.07 (5) | 0.58 | 0.42 | 0.71 | 0.49 | p < 0.05 |
| Naked Neck | 109 | 0.49 (53) | 0.44 (48) | 0.07 (8) | 0.71 | 0.29 | 0.44 | 0.41 | p > 0.05 |
| Hilly | 95 | 0.11 (10) | 0.65 (62) | 0.24 (23) | 0.44 | 0.56 | 0.65 | 0.49 | p < 0.05 |
| Subtotal Indigenous Chicken | 377 | 0.45 (171) | 0.45 (170) | 0.10 (36) | 0.68 | 0.32 | 0.45 | 0.43 | |
| Commercial Chickens | |||||||||
| Commercial Chicken- X | 50 | 1.0 (50) | 0 (0) | 0 (0) | 1.0 | 0 | 0 | - | - |
| Commercial Chicken-Y | 45 | 0 (0) | 0 (0) | 1.0 (45) | 0 | 1.0 | 0 | - | - |
| Sonali | 40 | 0.57 (23) | 0.03 (1) | 0.40 (16) | 0.59 | 0.41 | 0.03 | 0.48 | p < 0.05 |
| Subtotal Commercial | 135 | 0.54 (73) | 0.01 (1) | 0.45 (61) | 0.54 | 0.45 | 0.01 | 0.48 | |
| Chicken Type | % Ab Positive | No. of AA Genotype | % Ab Positive | No. of AG Genotype | % Ab Positive | No. of GG Genotype | % Ab Positive |
|---|---|---|---|---|---|---|---|
| Non-vaccinated chickens | |||||||
| Common Deshi | 30.48 (32/105) * | 93 | 30.11 (28/93) | 12 | 33.33 (4/12) | 0 | 0 |
| Aseel | 67.65 (46/68) | 15 | 80.00 (12/15) | 48 | 60.42 (29/48) | 5 | 100 (5/5) |
| Naked Neck | 35.78 (39/109) | 53 | 37.74 (20/53) | 48 | 35.42 (17/48) | 8 | 25.00 (2/8) |
| Hilly | 27.37 (26/95) | 10 | 40.00 (4/10) | 62 | 27.42 (17/62) | 23 | 21.74 (5/23) |
| Subtotal | 37.90 (143/377) | 171 | 37.43 (64/171) | 170 | 39.41 (67/170) | 36 | 33.33 (12/36) |
| Vaccinated Chickens | |||||||
| Commercial X | 26.0 (13/50) | 50 | 26.00 (13/50) | 0 | 0 | 0 | 0 |
| Commercial Y | 86.67 (39/45) | 0 | 0 | 0 | 0 | 45 | 86.67 (39/45) |
| Sonali | 87.50 (35/40) | 23 | 91.30 (21/23) | 1 | 100 (1/1) | 16 | 81.25 (13/16) |
| Sub-total | 64.44 (87/135) | 73 | 46.58 (34/73) | 1 | 100 (1/1) | 61 | 85.25 (52/61) |
| Grand Total | 44.92 (230/512) | 244 | 40.16 (98/244) | 171 | 39.77 (68/171) | 97 | 65.98 (64/97) |
| Chicken Type | Tested Samples | HA-Positive Samples | Samples with Virus | AIV Subtype/Mx Gene Genotype | |
|---|---|---|---|---|---|
| AIV | NDV | ||||
| Common Deshi | 105 | 5 | 1 | 4 | H1N1/AA |
| Aseel | 68 | 4 | 0 | 4 | |
| Naked Neck | 109 | 5 | 1 | 4 | H1N1/AG |
| Hilly | 95 | 3 | 0 | 3 | |
| CommercialX | 50 | 0 | 0 | 0 | |
| CommercialY | 45 | 0 | 0 | 0 | |
| Sonali | 40 | 0 | 0 | 0 | |
| Total (%) | 512 | 17 (3.29) | 2 (0.39) | 15 (2.93) | |
| Locus | Genotype | Anti-AIV Antibody Prevalence |
|---|---|---|
| g.2032 A > G | AA (243) | 1.399 ± 0.031 A |
| AG (171) | 1.397 ± 0.037 AB | |
| GG (97) | 1.659 ± 0.049 AB | |
| p < 0.01 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alam, J.; Rahman, M.M.; Halder, J.; Islam, M.R.; Sarkar, N.; Jabeen, I.; Hossain, M.M.K.; Rubaya, R.; Alim, M.A.; Bhuyan, A.A.; et al. Myxovirus resistance (Mx) Gene Diversity in Avian Influenza Virus Infections. Biomedicines 2022, 10, 2717. https://doi.org/10.3390/biomedicines10112717
Alam J, Rahman MM, Halder J, Islam MR, Sarkar N, Jabeen I, Hossain MMK, Rubaya R, Alim MA, Bhuyan AA, et al. Myxovirus resistance (Mx) Gene Diversity in Avian Influenza Virus Infections. Biomedicines. 2022; 10(11):2717. https://doi.org/10.3390/biomedicines10112717
Chicago/Turabian StyleAlam, Jahangir, Md. Mostafizer Rahman, Joyanta Halder, Md. Rezuanul Islam, Nandini Sarkar, Ishrat Jabeen, Mridha Md. Kamal Hossain, Rubaya Rubaya, Md. Abdul Alim, Anjuman Ara Bhuyan, and et al. 2022. "Myxovirus resistance (Mx) Gene Diversity in Avian Influenza Virus Infections" Biomedicines 10, no. 11: 2717. https://doi.org/10.3390/biomedicines10112717
APA StyleAlam, J., Rahman, M. M., Halder, J., Islam, M. R., Sarkar, N., Jabeen, I., Hossain, M. M. K., Rubaya, R., Alim, M. A., Bhuyan, A. A., Jahan, N., Rahman, M. M., & Ashour, H. M. (2022). Myxovirus resistance (Mx) Gene Diversity in Avian Influenza Virus Infections. Biomedicines, 10(11), 2717. https://doi.org/10.3390/biomedicines10112717

