The Effects of HP0044 and HP1275 Knockout Mutations on the Structure and Function of Lipopolysaccharide in Helicobacter pylori Strain 26695
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains, Plasmids and Growth Conditions
2.2. Construction of the HP0044 and HP1275 Knockout Mutants and the Corresponding Knockout Complementary Mutants
2.3. SDS-PAGE and Immunoblotting Analysis
2.4. Isolation of OMVs
2.5. LPS Isolation and LPS Profile Analysis
2.6. Growth Curve Analysis of H. pylori
2.7. SDS and Novobiocin Sensitivity Assay
2.8. Bacterial Infection Assay
2.9. Adhesion Assay
2.10. Internalization Assay
2.11. The Surface Hydrophobicity and Autoaggregation Assays
2.12. Statistics Analysis
3. Results
3.1. Sequence Analysis of the HP0044 and HP1275 Proteins in H. pylori 26695
3.2. The HP0044 and HP1275 Proteins Are Critical for LPS Expression
3.3. HP00044/HP1275 Gene Disruptions Affect Bacterial Growth, Sensitivity to the Detergent SDS and Resistance to the Antibiotic Novobiocin
3.4. The HP0044- and HP1275-Disrupted Mutations Significantly Affect H. pylori Membrane Properties
3.5. The HP0044- and HP1275-Disrupted Mutations Have Profound Influences on Bacterial Virulence
3.6. HP0044 and HP1275 Gene Disruptions Affect Protein Sorting into H. pylori OMVs
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Goh, K.-L.; Chan, W.-K.; Shiota, S.; Yamaoka, Y. Epidemiology of Helicobacter pylori Infection and Public Health Implications. Helicobacter 2011, 16, 1–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leja, M.; Grinberga-Derica, I.; Bilgilier, C.; Steininger, C. Review: Epidemiology of Helicobacter pylori infection. Helicobacter 2019, 24, e12635. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carter, F.P.; Frankson, T.; Pintard, J.; Edgecombe, B. Seroprevalence of Helicobacter pylori infection in adults in the Baha-mas. West. Indian Med. J. 2011, 60, 662–665. [Google Scholar]
- Kalali, B.; Mejías-Luque, R.; Javaheri, A.; Gerhard, M.H. pyloriVirulence Factors: Influence on Immune System and Pathology. Mediat. Inflamm. 2014, 2014, 1–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roesler, B.M.; Rabelo-Gonçalves, E.M.; Zeitune, J.M. Virulence Factors of Helicobacter pylori: A Review. Clin. Med. Insights Gastroenterol. 2014, 7, 9–17. [Google Scholar] [CrossRef] [Scilit]
- He, C.; Chen, M.; Liu, J.; Yuan, Y. Host genetic factors respond to pathogenic step-specific virulence factors of Helicobacter pylori in gastric carcinogenesis. Mutat. Res. Mutat. Res. 2014, 759, 14–26. [Google Scholar] [CrossRef] [Scilit]
- Marshall, B.J.; Warren, J.R. Undentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet 1984, 1, 1311–1315. [Google Scholar] [CrossRef] [Scilit]
- Wang, F.; Meng, W.; Wang, B.; Qiao, L. Helicobacter pylori-induced gastric inflammation and gastric cancer. Cancer Lett. 2014, 345, 196–202. [Google Scholar] [CrossRef] [Scilit]
- Infection with Helicobacter pylori. IARC Monogr. Eval. Carcinog. Risks Hum. 1994, 61, 177–240.
- Oliveira, J.; Reygaert, W.C. Gram Negative Bacteria. In StatPearls; StatPearls Publishing LLC.: Treasure Island, FL, USA, 2021. [Google Scholar]
- Bertani, B.; Ruiz, N. Function and Biogenesis of Lipopolysaccharides. EcoSal Plus 2018, 8. [Google Scholar] [CrossRef] [Scilit]
- Raetz, C.R.H.; Whitfield, C. Lipopolysaccharide Endotoxins. Annu. Rev. Biochem. 2002, 71, 635–700. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H.; Yang, T.; Liao, T.; Debowski, A.W.; Nilsson, H.-O.; Fulurija, A.; Haslam, S.M.; Mulloy, B.; Dell, A.; Stubbs, K.; et al. The redefinition of Helicobacter pylori lipopolysaccharide O-antigen and core-oligosaccharide domains. PLoS Pathog. 2017, 13, e1006280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H.; Marceau, M.; Yang, T.; Liao, T.; Tang, X.; Hu, R.; Xie, Y.; Tang, H.; Tay, A.; Shi, Y.; et al. East-Asian Helicobacter pylori strains synthesize heptan-deficient lipopolysaccharide. PLoS Genet. 2019, 15, e1008497. [Google Scholar] [CrossRef] [Scilit]
- Wang, G.; Boulton, P.G.; Chan, N.W.C.; Palcic, M.M.; Taylor, D.E. Novel Helicobacter pylori α1,2-fucosyltransferase, a key enzyme in the synthesis of Lewis antigens. Microbiology 1999, 145, 3245–3253. [Google Scholar] [CrossRef] [Scilit]
- Edwards, N.J.; Monteiro, M.A.; Faller, G.; Walsh, E.J.; Moran, A.P.; Roberts, I.S.; High, N.J. Lewis X structures in the O antigen side-chain promote adhesion of Helicobacter pylori to the gastric epithelium. Mol. Microbiol. 2002, 35, 1530–1539. [Google Scholar] [CrossRef] [Scilit]
- Moran, A. Lipopolysaccharide in bacterial chronic infection: Insights from Helicobacter pylori lipopolysaccharide and lipid A. Int. J. Med. Microbiol. 2007, 297, 307–319. [Google Scholar] [CrossRef] [Scilit]
- Wang, G.; Ge, Z.; Rasko, D.A.; Taylor, D.E. Lewis antigens in Helicobacter pylori: Biosynthesis and phase variation. Mol. Microbiol. 2002, 36, 1187–1196. [Google Scholar] [CrossRef] [Scilit]
- Moran, A.P. Relevance of fucosylation and Lewis antigen expression in the bacterial gastroduodenal pathogen Helicobacter pylori. Carbohydr. Res. 2008, 343, 1952–1965. [Google Scholar] [CrossRef] [Scilit]
- Becker, D.J.; Lowe, J.B. Fucose: Biosynthesis and biological function in mammals. Glycobiology 2003, 13, 41R–53R. [Google Scholar] [CrossRef] [Scilit]
- Mäki, M.; Renkonen, R. Biosynthesis of 6-deoxyhexose glycans in bacteria. Glycobiology 2003, 14, 1R–15R. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Liao, T.; Debowski, A.W.; Tang, H.; Nilsson, H.; Stubbs, K.A.; Marshall, B.J.; Benghezal, M. Lipopolysaccharide Structure and Biosynthesis in H elicobacter pylori. Helicobacter 2016, 21, 445–461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, B.; Zhang, Y.; Wang, P.G. Identification and Characterization of GDP-D-mannose 4,6-Dehydratase and GDP-L-fucose Synthetase in a GDP-L-fucose Biosynthetic Gene Cluster from Helicobacter pylori. Biochem. Biophys. Res. Commun. 2001, 285, 364–371. [Google Scholar] [CrossRef] [Scilit]
- Sturla, L.; Bisso, A.; Zanardi, D.; Benatti, U.; De Flora, A.; Tonetti, M. Expression, purification and characterization of GDP-d-mannose 4,6-dehydratase fromEscherichia coli. FEBS Lett. 1997, 412, 126–130. [Google Scholar] [CrossRef] [Scilit]
- Kneidinger, B.; Graninger, M.; Adam, G.; Puchberger, M.; Kosma, P.; Zayni, S.; Messner, P. Identification of Two GDP-6-deoxy-d-lyxo-4-hexulose Reductases Synthesizing GDP-d-rhamnose in Aneurinibacillus thermoaerophilus L420-91T. J. Biol. Chem. 2001, 276, 5577–5583. [Google Scholar] [CrossRef] [Scilit]
- Somoza, J.R.; Menon, S.; Schmidt, H.; Joseph-McCarthy, D.; Dessen, A.; Stahl, M.L.; Somers, W.S.; Sullivan, F.X. Structural and kinetic analysis of Escherichia coli GDP-mannose 4,6 dehydratase provides insights into the enzyme’s catalytic mechanism and regulation by GDP-fucose. Structure 2000, 8, 123–135. [Google Scholar] [CrossRef] [Scilit]
- Webb, N.A.; Mulichak, A.M.; Lam, J.S.; Rocchetta, H.L.; Garavito, R.M. Crystal structure of a tetrameric GDP-d-mannose 4,6-dehydratase from a bacterial GDP-d-rhamnose biosynthetic pathway. Protein Sci. 2004, 13, 529–539. [Google Scholar] [CrossRef] [Scilit]
- Köplin, R.; Arnold, W.; Hötte, B.; Simon, R.; Wang, G.; Pühler, A. Genetics of xanthan production in Xanthomonas campestris: The xanA and xanB genes are involved in UDP-glucose and GDP-mannose biosynthesis. J. Bacteriol. 1992, 174, 191–199. [Google Scholar] [CrossRef] [Scilit]
- Ye, R.W.; Zielinski, N.A.; Chakrabarty, A.M. Purification and characterization of phosphomannomutase/phosphoglucomutase from Pseudomonas aeruginosa involved in biosynthesis of both alginate and lipopolysaccharide. J. Bacteriol. 1994, 176, 4851–4857. [Google Scholar] [CrossRef] [Scilit]
- Regni, C.; Tipton, P.A.; Beamer, L.J. Crystal Structure of PMM/PGM: An Enzyme in the Biosynthetic Pathway of P. aeruginosa Virulence Factors. Structure 2002, 10, 269–279. [Google Scholar] [CrossRef] [Scilit]
- Zhu, J.-S.; Stiers, K.M.; Soleimani, E.; Groves, B.R.; Beamer, L.J.; Jakeman, D.L. Inhibitory Evaluation of αPMM/PGM from Pseudomonas aeruginosa: Chemical Synthesis, Enzyme Kinetics, and Protein Crystallographic Study. J. Org. Chem. 2019, 84, 9627–9636. [Google Scholar] [CrossRef] [Scilit]
- Goldberg, J.B.; Hatano, K.; Pier, G.B. Synthesis of lipopolysaccharide O side chains by Pseudomonas aeruginosa PAO1 requires the enzyme phosphomannomutase. J. Bacteriol. 1993, 175, 1605–1611. [Google Scholar] [CrossRef] [Scilit]
- Yu, C.-K.; Wang, C.-J.; Chew, Y.; Wang, P.-C.; Yin, H.-S.; Kao, M.-C. Functional characterization of Helicobacter pylori 26695 sedoheptulose 7-phosphate isomerase encoded by hp0857 and its association with lipopolysaccharide biosynthesis and adhesion. Biochem. Biophys. Res. Commun. 2016, 477, 794–800. [Google Scholar] [CrossRef] [Scilit]
- Chang, P.-C.; Wang, C.-J.; You, C.-K.; Kao, M.-C. Effects of a HP0859 (rfaD) knockout mutation on lipopolysaccharide structure of Helicobacter pylori 26695 and the bacterial adhesion on AGS cells. Biochem. Biophys. Res. Commun. 2011, 405, 497–502. [Google Scholar] [CrossRef] [Scilit]
- Chiu, S.-F.; Teng, K.-W.; Wang, P.-C.; Chung, H.-Y.; Wang, C.-J.; Cheng, H.-C.; Kao, M.-C. Helicobacter pylori GmhB enzyme involved in ADP-heptose biosynthesis pathway is essential for lipopolysaccharide biosynthesis and bacterial virulence. Virulence 2021, 12, 1610–1628. [Google Scholar] [CrossRef] [Scilit]
- Horton, R.M. In Vitro Recombination and Mutagenesis of DNA: SOEing Together Tailor-Made Genes. PCR Protocols 1993, 15, 251–262. [Google Scholar] [CrossRef] [Scilit]
- Lefebvre, B.; Formstecher, P.; Lefebvre, P. Improvement of the gene splicing overlap (SOE) method. Biotechiques 1995, 19, 186–188. [Google Scholar]
- Horton, R.M.; Ho, S.N.; Pullen, J.K.; Hunt, H.D.; Cai, Z.; Pease, L.R. [17]Gene splicing by overlap extension. Metab. Amino Acids Amines Part. B 1993, 217, 270–279. [Google Scholar] [CrossRef] [Scilit]
- Wai, S.N.; Takade, A.; Amako, K. The Release of Outer Membrane Vesicles from the Strains of Enterotoxigenic Escherichia coli. Microbiol. Immunol. 1995, 39, 451–456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fomsgaard, A.; Freudenberg, M.A.; Galanos, C. Modification of the silver staining technique to detect lipopolysaccharide in polyacrylamide gels. J. Clin. Microbiol. 1990, 28, 2627–2631. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abu-Lail, N.I.; Camesano, T.A. Role of Lipopolysaccharides in the Adhesion, Retention, and Transport of Escherichia coli JM109. Environ. Sci. Technol. 2003, 37, 2173–2183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haurat, M.F.; Opoku, A.; Rangarajan, M.; Dorobantu, L.; Gray, M.A.; Curtis, M.; Feldman, M.F. Selective Sorting of Cargo Proteins into Bacterial Membrane Vesicles. J. Biol. Chem. 2011, 286, 1269–1276. [Google Scholar] [CrossRef] [Scilit]
- Moran, A.P.; Knirel, Y.A.; Senchenkova, S.N.; Widmalm, G.; Hynes, S.O.; Jansson, P.-E. Phenotypic Variation in Molecular Mimicry betweenHelicobacter pylori Lipopolysaccharides and Human Gastric Epithelial Cell Surface Glycoforms. J. Biol. Chem. 2002, 277, 5785–5795. [Google Scholar] [CrossRef] [Scilit]
- Bosch, L.V.D.; Manning, P.A.; Morona, R. Regulation of O-antigen chain length is required for Shigella flexneri virulence. Mol. Microbiol. 1997, 23, 765–775. [Google Scholar] [CrossRef] [Scilit]
- Chiku, K.; Tsunemi, K.; Yamamoto, M.; Ohnishi-Kameyama, M.; Yoshida, M.; Ishii, T.; Taguchi, F.; Iwaki, M.; Ichinose, Y.; Ono, H. Defects inD-Rhamnosyl Residue Biosynthetic Genes Affect Lipopolysaccharide Structure, Motility, and Cell-Surface Hydrophobicity inPseudomonas syringaePathovarglycineaRace 4. Biosci. Biotechnol. Biochem. 2013, 77, 505–510. [Google Scholar] [CrossRef] [Scilit]
- Tang, H.B.; DiMango, E.; Bryan, R.; Gambello, M.; Iglewski, B.H.; Goldberg, J.B.; Prince, A. Contribution of specific Pseudomonas aeruginosa virulence factors to pathogenesis of pneumonia in a neonatal mouse model of infection. Infect. Immun. 1996, 64, 37–43. [Google Scholar] [CrossRef] [Scilit]
- Krzyżek, P.; Grande, R.; Migdał, P.; Paluch, E.; Gościniak, G. Biofilm Formation as a Complex Result of Virulence and Adaptive Responses of Helicobacter pylori. Pathogens 2020, 9, 1062. [Google Scholar] [CrossRef] [Scilit]
- Yonezawa, H.; Osaki, T.; Kamiya, S. Biofilm Formation byHelicobacter pyloriand Its Involvement for Antibiotic Resistance. BioMed Res. Int. 2015, 2015, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Stark, R.M.; Gerwig, G.J.; Pitman, R.S.; Potts, L.F.; Williams, N.A.; Greenman, J.; Weinzweig, I.P.; Hirst, T.R.; Millar, M.R. Biofilm formation byHelicobacter pylori. Lett. Appl. Microbiol. 1999, 28, 121–126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gaddy, J.A.; Radin, J.N.; Cullen, T.W.; Chazin, W.J.; Skaar, E.P.; Trent, M.S.; Algood, H.M.S. Helicobacter pylori Resists the Antimicrobial Activity of Calprotectin via Lipid A Modification and Associated Biofilm Formation. mBio 2015, 6, e01349-15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hathroubi, S.; Zerebinski, J.; Ottemann, K.M. Helicobacter pylori Biofilm Involves a Multigene Stress-Biased Response, Including a Structural Role for Flagella. mBio 2018, 9, e01973-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hathroubi, S.; Hu, S.; Ottemann, K.M. Genetic requirements and transcriptomics of Helicobacter pylori biofilm formation on abiotic and biotic surfaces. npj Biofilms Microbiomes 2020, 6, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Krasowska, A.; Sigler, K. How microorganisms use hydrophobicity and what does this mean for human needs? Front. Cell. Infect. Microbiol. 2014, 4, 112. [Google Scholar] [CrossRef] [Scilit]
- Servetas, S.L.; Carpenter, B.M.; Haley, K.P.; Gilbreath, J.J.; Gaddy, J.A.; Merrell, D.S. Characterization of Key Helicobacter pylori Regulators Identifies a Role for ArsRS in Biofilm Formation. J. Bacteriol. 2016, 198, 2536–2548. [Google Scholar] [CrossRef] [Scilit]
- Keenan, J.I.; Allardyce, R.A.; Bagshaw, P.F. Dual silver staining to characterise Helicobacter spp. outer membrane components. J. Immunol. Methods 1997, 209, 17–24. [Google Scholar] [CrossRef] [Scilit]
- Jarzab, M.; Posselt, G.; Meisner-Kober, N.; Wessler, S. Helicobacter pylori-Derived Outer Membrane Vesicles (OMVs): Role in Bacterial Pathogenesis? Microorg. 2020, 8, 1328. [Google Scholar] [CrossRef] [Scilit]
- Bonnington, K.; Kuehn, M. Protein selection and export via outer membrane vesicles. Biochim. Biophys. Acta 2014, 1843, 1612–1619. [Google Scholar] [CrossRef] [Scilit]
- Meyer, D.H.; Fives-Taylor, P.M. Characteristics of adherence of Actinobacillus actinomycetemcomitans to epithelial cells. Infect. Immun. 1994, 62, 928–935. [Google Scholar] [CrossRef] [Scilit]
- Kesty, N.C.; Kuehn, M.J. Incorporation of Heterologous Outer Membrane and Periplasmic Proteins into Escherichia coli Outer Membrane Vesicles. J. Biol. Chem. 2004, 279, 2069–2076. [Google Scholar] [CrossRef] [Scilit]
- Yonezawa, H.; Osaki, T.; Kurata, S.; Fukuda, M.; Kawakami, H.; Ochiai, K.; Hanawa, T.; Kamiya, S. Outer Membrane Vesicles of Helicobacter pylori TK1402 are Involved in Biofilm Formation. BMC Microbiol. 2009, 9, 197. [Google Scholar] [CrossRef] [Scilit]
- Ciofu, O.; Beveridge, T.J.; Kadurugamuwa, J.; Walther-Rasmussen, J.; Høiby, N. Chromosomal beta-lactamase is packaged into membrane vesicles and secreted from Pseudomonas aeruginosa. J. Antimicrob. Chemother. 2000, 45, 9–13. [Google Scholar] [CrossRef] [Scilit]
- Chatterjee, D.; Chaudhuri, K. Association of cholera toxin with Vibrio cholerae outer membrane vesicles which are internalized by human intestinal epithelial cells. FEBS Lett. 2011, 585, 1357–1362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liaskos, M.; Ferrero, R. Immune modulation by bacterial outer membrane vesicles. Nat. Rev. Immunol. 2015, 15, 375–387. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Horstman, A.L.; Kuehn, M.J. Enterotoxigenic Escherichia coli Secretes Active Heat-labile Enterotoxin via Outer Membrane Vesicles. J. Biol. Chem. 2000, 275, 12489–12496. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kato, S.; Kowashi, Y.; Demuth, D.R. Outer membrane-like vesicles secreted by Actinobacillus actinomycetemcomitans are enriched in leukotoxin. Microb. Pathog. 2002, 32, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Cahill, B.K.; Seeley, K.W.; Gutel, D.; Ellis, T. Klebsiella pneumoniae O antigen loss alters the outer membrane protein composition and the selective packaging of proteins into secreted outer membrane vesicles. Microbiol. Res. 2015, 180, 1–10. [Google Scholar] [CrossRef] [Scilit]







| Strain/Plasmid | Characteristics and Marker 1 | Source | |
|---|---|---|---|
| Strain | E. coli | ||
| Top10 | The host for construction of pGEM-T-HP0044 and pGEM-T-HP1275 clones | Invitrogen, Carlsbad, CA, USA | |
| DH5α | The host for construction of pGEM-T-HP0044d::Cmr and pGEM-T-HP1275d::Cmr clones | Invitrogen, Carlsbad, CA, USA | |
| H. pylori | |||
| 26695 | H. pylori whole-genome sequencing strain, isolated from the stomach of a patient with gastritis | ATCC 2 700392 | |
| KO 0044 | H. pylori 26695 strain with a chloramphenicol resistance cassette in HP0044; Cmr | This study | |
| Com 0044 | KO 0044 with HP0044 insertion in HP0954 (RdxA); Metr, Cmr | This study | |
| KO 1275 | H. pylori 26695 strain with a chloramphenicol resistance cassette in HP1275; Cmr | This study | |
| Com 1275 | KO 1275 with HP1275 insertion in HP0954 (RdxA); Metr, Cmr | This study | |
| Plasmid | pGEM-T | T-A cloning vector; Ampr | Promega, Madison, WI, USA |
| pGEM-T-HP0044 | pGEM-T with HP0044 DNA fragment; Ampr | This study | |
| pGEM-T-HP0044d::Cmr | pGEM-T with HP0044 interrupted with a chloramphenicol resistance cassette; Cmr | This study 1 | |
| pGEM-T-RdxAL-PHP1563-HP0044-T7ter-RdxAR | pGEM-T with HP0044 insertion in HP0954 (RdxA); Metr, Cmr | This study | |
| pGEM-T-HP1275 | pGEM-T with HP1275 DNA fragment; Ampr | This study | |
| pGEM-T-HP1275d::Cmr | pGEM-T with HP1275 interrupted with a chloramphenicol resistance cassette; Cmr | This study | |
| pGEM-T-RdxAL-PHP1563-HP1275-T7ter-RdxAR | pGEM-T with HP1275 insertion in HP0954 (RdxA); Metr, Cmr | This study | |
| Primer | Restriction Enzyme Site | Sequence (5′→3′) 5 |
|---|---|---|
| KO0044F1 1 | - | AATCGCTTTAATCACCGGGG |
| KO0044R1 1 | BamHI | TACAGGATCCAAAGTTTCGC |
| KO0044F2 1 | BamHI | CTTTGGATCCTGTAACCCGT |
| KO0044R2 1 | - | ATGCCATAGGCACCAGTGAT |
| Com0044F1 2 | NcoI | CCATGGCTTGATTGGAAGCACTAGCCACG |
| Com0044R1 2 | - | ATTTTTTCTTTCATATCGTAACTCCTTAAGTGTT |
| Com0044F2 2 | - | TAAGGAGTTACGATATGAAAGAAAAAATCGCTTT |
| Com0044R2 2 | KpnI | AAGGTACCTCAGTGGTGATGGTGATGATGTTCATAAAAATTCCT |
| KO1275F1 3 | - | AAACGCATGGCAAAATTTATGCG |
| KO1275R1 3 | BamHI | CCCAGGATCCTCAGGATCCG |
| KO1275F2 3 | BamHI | CTGAGGATCCTGGGAATTTC |
| KO1275R2 3 | - | GGGATATGAAATGAGATTATCCC |
| Com1275F1 4 | NcoI | CCATGGCTTGATTGGAAGCACTAGCCACG |
| Com1275R1 4 | - | ATGCTAATGTCCATATCGTAACTCCTTAAGTGTT |
| Com1275F2 4 | - | TAAGGAGTTACGATATGGACATTAGCATTTTTAG |
| Com1275R2 4 | KpnI | AAGGTACCTTAGTGGTGATGGTGATGATGAAGTTTTTCTAATAA |
| Species | UniProt AC | Identity 1 (%) | Similarity 1 (%) | Length | |
|---|---|---|---|---|---|
| GDP-D-mannose dehydratase (GMD, dehydration of GDP-D-mannose) | Helicobacter pylori 26695 | O24885 | 100% | 100% | 381 aa 2 |
| Yersinia enterocolitica 8081 | Q56872 | 61.7% | 83.6% | 372 aa 2 | |
| Escherichia coli K12 | P0AC88 | 60.1% | 82.7% | 373 aa 2 | |
| Salmonella typhimurium CT18 | Q8Z5H1 | 59.6% | 81.9% | 373 aa 2 | |
| Vibrio cholerae O1 biovar El Tor N16961 | Q06952 | 61.0 % | 81.8% | 373 aa 2 | |
| Phosphomannomutase (PMM, transferring phosphate group within a mannose) | Helicobacter pylori 26695 | O24885 | 100% | 100% | 459 aa 2 |
| Xanthomonas campestris pv. vesicatoria | Q3BP79 | 28.2% | 57.4% | 448 aa 2 | |
| Pseudomonas aeruginosa PAO1 | P26276 | 38.9% | 67.2% | 463 aa 2 | |
| Salmonella typhimurium SL1344 | A0A718J2B2 | 27.4% | 55.9% | 456 aa 2 | |
| Vibrio cholerae 2017V-1105 | A0A366AER7 | 26.4% | 57.1% | 454 aa 2 | |
| Phosphoglucomutase (PGM, transferring phosphate group within a glucose) | Helicobacter pylori 26695 | O24885 | 100% | 100% | 459 aa 2 |
| Xanthomonas campestris pv. vesicatoria | Q3BP79 | 28.2% | 57.4% | 448 aa 2 | |
| Pseudomonas aeruginosa PAO1 | P26276 | 38.9% | 67.2% | 463 aa 2 | |
| Vibrio cholerae | A0A0H5W931 | 21.6% | 54.2% | 548 aa 2 | |
| Neisseria gonorrhoeae | P40390 | 40.4% | 66.2% | 460 aa 2 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, A.-N.; Teng, K.-W.; Chew, Y.; Wang, P.-C.; Nguyen, T.T.H.; Kao, M.-C. The Effects of HP0044 and HP1275 Knockout Mutations on the Structure and Function of Lipopolysaccharide in Helicobacter pylori Strain 26695. Biomedicines 2022, 10, 145. https://doi.org/10.3390/biomedicines10010145
Liu A-N, Teng K-W, Chew Y, Wang P-C, Nguyen TTH, Kao M-C. The Effects of HP0044 and HP1275 Knockout Mutations on the Structure and Function of Lipopolysaccharide in Helicobacter pylori Strain 26695. Biomedicines. 2022; 10(1):145. https://doi.org/10.3390/biomedicines10010145
Chicago/Turabian StyleLiu, Ai-Ning, Kai-Wen Teng, Yongyu Chew, Po-Chuan Wang, Tram Thi Hong Nguyen, and Mou-Chieh Kao. 2022. "The Effects of HP0044 and HP1275 Knockout Mutations on the Structure and Function of Lipopolysaccharide in Helicobacter pylori Strain 26695" Biomedicines 10, no. 1: 145. https://doi.org/10.3390/biomedicines10010145
APA StyleLiu, A.-N., Teng, K.-W., Chew, Y., Wang, P.-C., Nguyen, T. T. H., & Kao, M.-C. (2022). The Effects of HP0044 and HP1275 Knockout Mutations on the Structure and Function of Lipopolysaccharide in Helicobacter pylori Strain 26695. Biomedicines, 10(1), 145. https://doi.org/10.3390/biomedicines10010145

