A Critical Factor for Quantifying Proteins in Unmodified Gold Nanoparticles-Based Aptasensing: The Effect of pH
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents and Chemicals
2.2. Apparatus
2.3. Synthesis of AuNPs
2.4. Adjusting of pH in the uGA Sensing System
2.5. Detection of Proteins in Aqueous Solutions
2.6. Removal of the Interfering Proteins from the Assay
3. Results
3.1. Feasibility and Analytical Performance of the uGA Assay
3.2. Anti-Interference Performance of the uGA Assay
3.3. The Universality of the uGA Assay Confirmed by Using Two Different Target Proteins
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Lopa, N.S.; Rahman, M.M.; Ahmed, F.; Ryu, T.; Sutradhar, S.C.; Kim, J.; Kim, D.H.; Lee, Y.H.; Kim, W. Simple, Low-cost, Sensitive and Label-Free Aptasensor for the Detection of Cardiac Troponin I Based on a Gold Nanoparticles Modified Titanium Foil. Biosens. Bioelectron. 2019, 126, 381–388. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Loiseau, A.; Zhang, L.; Hu, D.; Salmain, M.; Mazouzi, Y.; Flack, R.; Liedberg, B.; Boujday, S. Core-Shell Gold/Silver Nanoparticles for Localized Surface Plasmon Resonance-Based Naked-Eye Toxin Biosensing. ACS Appl. Mater. Interfaces 2019, 11, 46462–46471. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, S.; Liu, X.; Liu, Q.; Chen, Z. Colorimetric Differentiation of Flavonoids Based on Effective Reactivation of Acetylcholinesterase Induced by Different Affnities between Flavonoids and Metal Ions. Anal. Chem. 2020, 92, 3361–3365. [Google Scholar] [CrossRef] [Scilit]
- Esmaelpourfarkhani, M.; Abnous, K.; Taghdisi, S.M.; Chamsaz, M. A Novel Turn-Off Fluorescent Aptasensor for Ampicillin Detection Based on Perylenetetracarboxylic Acid Diimide and Gold Nanoparticles. Biosens. Bioelectron. 2020, 164, 112329. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zang, L.; Salmain, M.; Liedberg, B.; Boujday, S. Naked Eye Immunosensing of Food Biotoxins Using Gold Nanoparticle-Antibody Bioconjugates. ACS Appl. Nano Mater. 2019, 2, 4150–4158. [Google Scholar] [CrossRef] [Scilit]
- Luo, K.; Ryu, J.; Seol, I.H.; Jeong, K.B.; You, S.M.; Kim, Y.R. Paper-Based Radial Chromatographic Immunoassay for the Detection of Pathogenic Bacteria in Milk. ACS Appl. Mater. Interfaces 2019, 11, 46472–46478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, R.; Zhou, X.; Liedberg, B.; Zhu, X.Y.; Memon, A.G.; Shi, H. Screening Criteria for Qualified Antibiotic Targets in Unmodified Gold Nanoparticles-Based Aptasensing. ACS Appl. Mater. Interfaces 2019, 9, 35492–35494. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alsager, O.A.; Kumar, S.; Zhu, B.; Travas-Sejdic, J.; McNatty, K.P.; Hodgkiss, J.M. Label-Free Electrochemical Aptasensor for Femtomolar Detection of 17 Beta-Estradiol. Anal. Chem. 2015, 87, 4201–4209. [Google Scholar] [CrossRef] [Scilit]
- Eissa, S.; Siddiqua, A.; Chinnappan, R.; Zourob, M. Electrochemical SELEX Technique for the Selection of DNA Aptamers against the Small Molecule 11-Deoxycortisol. Anal. Chem. 2019, 2, 2624–2632. [Google Scholar] [CrossRef] [Scilit]
- Zhao, L.; Qi, X.; Yan, X.; Huang, Y.; Liang, X.; Zhang, L.; Wang, S.; Tan, W. Engineering Aptamer with Enhanced Affinity by Triple Helix-Based Terminal Fixation. J. Am. Chem. Soc. 2019, 141, 17493–17497. [Google Scholar] [CrossRef] [Scilit]
- Fan, D.; Zhai, Q.; Zhou, W.; Zhu, X.; Wang, E.; Dong, S. A Label-Free Colorimetric Aptasensor for Simple, Sensitive and Selective Detection of Pt (II) Based on Platinum (II)-Oligonucleotide Coordination Induced Gold Nanoparticles Aggregation. Biosens. Bioelectron. 2016, 85, 771–776. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, R.; Huang, Y.; Ma, Y.; Jia, S.; Gao, M.; Li, J.; Zhang, H.; Xu, D.; Wu, M.; Chen, Y.; et al. Design and Synthesis of Target-Responsive Aptamer-Cross-linked Hydrogel for Visual Quantitative Detection of Ochratoxin A. ACS Appl. Mater. Interfaces 2015, 7, 6982–6990. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yin, X.; Wang, S.; Liu, X.; He, C.; Tang, Y.; Li, Q.; Liu, J.; Su, H.; Tan, T.; Dong, Y. Aptamer-based Colorimetric Biosensing of Ochratoxin A in Fortified White Grape Wine Sample Using Unmodified Gold Nanoparticle. Aanl. Sci. 2017, 33, 659–664. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bhairab, M.; Shylaja, R.; Lavu, P.S.; Bhavanashri, N.; Kingston, J. Highly Sensitive Colorimetric Biosensor for Staphylococcal Enterotoxin B by a Label-Free Aptamer and Gold Nanoparticles. Front. Microbiol. 2018, 9, 179. [Google Scholar]
- Kasoju, A.; Shahdeo, D.; Khan, A.A.; Shrikrishna, N.S.; Mahari, S.; Alanazi, A.M.; Bhat, M.A.; Giri, J.; Gandhi, S. Fabrication of Microfluidic Device for Aflatoxin M1 Detection in Milk Samples with Specific Aptamers. Sci. Rep. 2020, 10, 4627. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Hu, W.; Hassan, M.M.; Zhang, Z.; Chen, Q. A Facile and Sensitive SERS-Based Biosensor for Colormetric Detection of Acetamiprid in Green Tea Based on Unmodified Gold Nanoparticles. J. Food Meas. Charact. 2019, 13, 259–268. [Google Scholar] [CrossRef] [Scilit]
- Bala, R.; Dhingra, S.; Kumar, M.; Bansal, K.; Mittal, S.; Sharma, R.K.; Wangoo, N. Detection of Organophosphorus Pesticide—Malathion in Environmental Samples Using Peptide and Aptamer Based Nanoprobes. Chem. Eng. J. 2016, 311, 111–116. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Rothberg, L. Colorimetric Detection of DNA Sequences Based on Electrostatic Interactions with Unmodified Gold Nanoparticles. Proc. Natl. Acad. Sci. USA 2004, 101, 14036–14039. [Google Scholar] [CrossRef] [Scilit]
- Lee, E.H.; Lee, S.; Kim, M.; Lee, S.W. Simple and Rapid Detection of Bisphenol A Using a Gold Nanoparticle-Based Colorimetric Aptasensor. Food Chem. 2019, 287, 205–213. [Google Scholar] [CrossRef] [Scilit]
- Gao, Z.; Qiu, Z.; Lu, M.; Shu, J.; Tang, D. Hybridization Chain Reaction-Based Colorimetric Aptasensor of Adenosine 5′-Triphosphate on Unmodified Gold Nanoparticles and Two Label-Free Hairpin Probes. Biosens. Bioelectron. 2017, 89, 1006–1012. [Google Scholar] [CrossRef] [Scilit]
- Lan, L.; Yao, Y.; Ping, J.; Ying, Y. Recent Progress in Nanomaterial-Based Optical Aptamer Assay for the Detection of Food Chemical Contaminants. ACS Appl. Mater. Interfaces 2017, 9, 23287–23301. [Google Scholar] [CrossRef] [Scilit]
- Xia, F.; Zuo, X.; Yang, R.; Xiao, Y.; Kang, D.; Valleebelisale, A.; Gong, X.; Yuen, J.; Hsu, B.B.; Heeger, A.J.; et al. Colorimetric Detection of DNA, Small Molecules, Proteins, and Ions using Unmodified Gold Nanoparticles and Conjugated Polyelectrolytes. Proc. Natl. Acad. Sci. USA 2010, 107, 10837–10841. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Hao, J.; Xu, X.; Chen, X.; Wang, J. Protein Corona-triggered Catalytic Inhibition of Insufficient POSS Polymer-caged Gold Nanoparticles for Sensitive Colorimetric Detection of Metallothioneins. Anal. Chem. 2020, 92, 2080–2087. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mahmoudi, M.; Lohse, S.E.; Murphy, C.J.; Fathizadeh, A.; Montazeri, A.; Suslick, K.S. Variation of Protein Corona Composition of Gold Nanoparticles Following Plasmonic Heating. Nano Lett. 2014, 14, 6–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dewald, I.; Isakin, O.; Schubert, J.; Kraus, T.; Chanana, M. Protein Identity and Environmental Parameters Determine the Final Physicochemical Properties of Protein-Coated Metal Nanoparticles. J. Phys. Chem. C 2015, 119, 25482–25492. [Google Scholar] [CrossRef] [Scilit]
- Razmi, N.; Baradaran, B.; Hejazi, M.; Hasanzadeh, M.; Mosafer, J.; Mokhtarzadeh, A.; Guardia, M.D. Recent Advances on Aptamer-Based Biosensors to Detection of Platelet-Derived Growth Factor. Biosens. Bioelectron. 2018, 113, 58–71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, T.; Dai, P.; Xu, J.; Chen, H. A Sensitive Aptasensor for Colorimetric Detection of Adenosine Triphosphate Based on the Protective Effect of ATP-Aptamer Complexes on Unmodified Gold Nanoparticles. ACS Appl. Mater. Interfaces 2016, 8, 4434–4441. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kairdolf, B.A.; Nie, S. Multidentate-Protected Colloidal Gold Nanocrystals: pH Control of Cooperative Precipitation and Surface Layer Shedding. J. Am. Chem. Soc. 2011, 133, 7268–7271. [Google Scholar] [CrossRef] [Scilit]
- Peng, D.; Yang, J.; Li, J.; Tang, C.; Li, B. Foams Stabilized by β-Lactoglobulin Amyloid Fibrils: Effect of pH. J. Agric. Food Chem. 2017, 65, 10658–10665. [Google Scholar] [CrossRef] [Scilit]
- Teepakorn, C.; Flaty, K.; Charcosset, C. Optimization of Lactoferrin and Bovine Serum Albumin Separation Using Ion-Exchange Membrane Chromatography. Sep. Purif. Technol. 2015, 151, 292–302. [Google Scholar]
- Santos, M.B.; Carvalho, C.W.; Garciarojas, E.E. Heteroprotein Complex Formation of Bovine Serum Albumin and Lysozyme: Structure and Thermal Stability. Food Hydrocolloid. 2018, 74, 267–274. [Google Scholar] [CrossRef] [Scilit]
- Shi, X.; Lu, D.; Wang, Z.; Zhang, D.; Gao, W.; Zhang, C.; Deng, J.; Guo, S. Colorimetric and visual determination of acrylamide via acrylamide-mediated polymerization of acrylamide-functionalized gold nanoparticles. Microchim. Acta 2018, 185, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Haiss, W.; Thanh, N.T.K.; Aveyard, J.; Fernig, D.G. Determination of size and concentration of gold Nanoparticles from UV−Vis spectra. Anal. Chem. 2007, 79, 4215–4221. [Google Scholar] [CrossRef] [Scilit]
- Aggarwal, P.; Hall, J.B.; McLeland, C.B.; Dobrovolskaia, M.A.; Mcneil, S.E. Nanoparticle Interaction with Plasma Proteins as It Relates to Particle Biodistribution, Biocompatibility and Therapeutic Efficacy. Adv. Drug. Deliver. Rev. 2009, 61, 428–437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, X.; Chen, Z.; Tan, L.; Lou, T.; Zhao, Y. DNA-Catalytically Active Gold Nanoparticle Conjugates-Based Colorimetric Multidimensional Sensor Array for Protein Discrimination. Anal. Chem. 2017, 89, 556–559. [Google Scholar] [CrossRef] [Scilit]
- Xi, H.; He, W.; Liu, Q.; Chen, Z. Protein Discrimination Using a Colorimetric Sensor Array Based on Gold Nanoparticle Aggregation Induced by Cationic Polymer. ACS Sustain. Chem. Eng. 2018, 6, 10751–10757. [Google Scholar] [CrossRef] [Scilit]
- Lu, Y.; Liu, Y.; Zhang, S.; Wang, S.; Zhang, S.; Zhang, X. Aptamer-Based Plasmonic Sensor Array for Discrimination of Proteins and Cells with the Naked Eye. Anal. Chem. 2013, 85, 6571–6574. [Google Scholar] [CrossRef] [Scilit]
- Dam, D.; Lee, H.; Lee, R.; Kim, K.; Kelleher, N.; Odom, T. Tunable Loading of Oligonucleotides with Secondary Structure on Gold Nanoparticles through a pH-Driven Method. Bioconjugate Chem. 2015, 26, 279–285. [Google Scholar] [CrossRef] [Scilit]



| Name | Sequence (5′ to 3′) |
|---|---|
| β-LG aptamer | CGACGATCGGACCGCAGTACCCACCCACCAGCCCCAACATCATGCCCATCCGTGTGTG |
| LF aptamer | AGGCAGGACACCGTAACCGGTGCATCTATGGCTACTAGCTCTTCCTGCCT |
| Lysozyme aptamer | ATCAGGGCTAAAGAGTGCAGAGTTACTTAG |
| Proteins | MW (KDa) | pI |
|---|---|---|
| β-LG | 35–42 | 5.2 |
| BSA | 66.5 | 4.6–5.8 |
| γ-globulin | 156–300 | 5.2–5.5 |
| casein | 25 | 4.8 |
| LF | 80 | 8.7 |
| LZM | 14 | 10.7 |
| protamine | 4.5 | 12.2 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lu, D.; Zhang, D.; Zhao, Q.; Lu, X.; Shi, X. A Critical Factor for Quantifying Proteins in Unmodified Gold Nanoparticles-Based Aptasensing: The Effect of pH. Chemosensors 2020, 8, 98. https://doi.org/10.3390/chemosensors8040098
Lu D, Zhang D, Zhao Q, Lu X, Shi X. A Critical Factor for Quantifying Proteins in Unmodified Gold Nanoparticles-Based Aptasensing: The Effect of pH. Chemosensors. 2020; 8(4):98. https://doi.org/10.3390/chemosensors8040098
Chicago/Turabian StyleLu, Dai, Dong Zhang, Qian Zhao, Xiangyang Lu, and Xingbo Shi. 2020. "A Critical Factor for Quantifying Proteins in Unmodified Gold Nanoparticles-Based Aptasensing: The Effect of pH" Chemosensors 8, no. 4: 98. https://doi.org/10.3390/chemosensors8040098
APA StyleLu, D., Zhang, D., Zhao, Q., Lu, X., & Shi, X. (2020). A Critical Factor for Quantifying Proteins in Unmodified Gold Nanoparticles-Based Aptasensing: The Effect of pH. Chemosensors, 8(4), 98. https://doi.org/10.3390/chemosensors8040098
