Wound-Healing and Skin-Moisturizing Effects of Sasa veitchii Extract
Abstract
:1. Introduction
2. Materials and Methods
2.1. Kumazasa Extract
2.2. Animals
2.3. Treatments
2.4. Cell Culture
2.5. Real-Time RT-PCR
2.6. Electrophoresis and Immunoblotting
2.7. Wound Healing Scratch Assay
2.8. Statistical Analysis
3. Results
3.1. Skin Wound-Healing Effect of Kumazasa Extract
3.2. Skin-Moisturizing Effect of Kumazasa Extract
3.3. AQP3 Expression Level in Mouse Skin
3.4. Expression Levels of Function-Regulating Genes in Mouse Skin
3.5. AQP3 Expression Level in HaCaT Cells
3.6. Wound-Healing Effect of Kumazasa Extract in HaCaT Cells
3.7. Expression Level of Phospho-p38 MAPK
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Chambers, E.S.; Vukmanovic-Stejic, M. Skin barrier immunity and ageing. Immunology 2020, 160, 116–125. [Google Scholar] [CrossRef] [Green Version]
- Bollag, W.B.; Aitkens, L.; White, J.; Hyndman, K.A. Aquaporin-3 in the epidermis: More than skin deep. Am. J. Physiol. Cell Physiol. 2020, 318, C1144–C1153. [Google Scholar] [CrossRef]
- Morasso, M.I.; Tomic-Canic, M. Epidermal stem cells: The cradle of epidermal determination, differentiation and wound healing. Biol. Cell 2005, 97, 173–183. [Google Scholar] [CrossRef] [Green Version]
- Santoro, M.M.; Gaudino, G. Cellular and molecular facets of keratinocyte reepithelization during wound healing. Exp. Cell Res. 2005, 304, 274–286. [Google Scholar] [CrossRef]
- Verkman, A.S. Aquaporins at a glance. J. Cell Sci. 2011, 124, 2107–2112. [Google Scholar] [CrossRef] [Green Version]
- Patel, R.; Kevin Heard, L.; Chen, X.; Bollag, W.B. Aquaporins in the Skin. Adv. Exp. Med. Biol. 2017, 969, 173–191. [Google Scholar] [CrossRef]
- Hara, M.; Ma, T.; Verkman, A.S. Selectively reduced glycerol in skin of aquaporin-3-deficient mice may account for impaired skin hydration, elasticity, and barrier recovery. J. Biol. Chem. 2002, 277, 46616–46621. [Google Scholar] [CrossRef] [Green Version]
- Ma, T.; Hara, M.; Sougrat, R.; Verbavatz, J.M.; Verkman, A.S. Impaired stratum corneum hydration in mice lacking epidermal water channel aquaporin-3. J. Biol. Chem. 2002, 277, 17147–17153. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cao, C.; Sun, Y.; Healey, S.; Bi, Z.; Hu, G.; Wan, S.; Kouttab, N.; Chu, W.; Wan, Y. Correction: EGFR-mediated expression of aquaporin-3 is involved in human skin fibroblast migration. Biochem. J. 2017, 474, 2901–2902. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sebastian, R.; Chau, E.; Fillmore, P.; Matthews, J.; Price, L.A.; Sidhaye, V.; Milner, S.M. Epidermal aquaporin-3 is increased in the cutaneous burn wound. Burns 2015, 41, 843–847. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hara-Chikuma, M.; Verkman, A.S. Aquaporin-3 facilitates epidermal cell migration and proliferation during wound healing. J. Mol. Med. 2008, 86, 221–231. [Google Scholar] [CrossRef] [PubMed]
- Cao, X.; Zhong, L.; Peng, X.; Sun, S.; Li, S.; Liu, S.; Sun, R. Comparative study of the pyrolysis of lignocellulose and its major components: Characterization and overall distribution of their biochars and volatiles. Bioresour. Technol. 2014, 155, 21–27. [Google Scholar] [CrossRef]
- Bai, Y.Y.; Xiao, L.P.; Shi, Z.J.; Sun, R.C. Structural variation of bamboo lignin before and after ethanol organosolv pretreatment. Int. J. Mol. Sci. 2013, 14, 21394–21413. [Google Scholar] [CrossRef]
- Okada, Y.; Okajima, H.; Takeshita, K.; Kanamori, M. Kinetic study of Sasa veitchii extract as a radical scavenger and an antioxidant. J. Food Sci. 2012, 77, C1211–C1217. [Google Scholar] [CrossRef]
- Kim, K.M.; Kim, Y.S.; Lim, J.Y.; Min, S.J.; Shin, J.H.; Ko, H.C.; Kim, S.J.; Lim, Y.; Kim, Y. Sasa quelpaertensis leaf extract suppresses dextran sulfate sodium-induced colitis in mice by inhibiting the proinflammatory mediators and mitogen-activated protein kinase phosphorylation. Nutr. Res. 2014, 34, 894–905. [Google Scholar] [CrossRef]
- Yoshioka, H.; Nonogaki, T.; Fukaya, S.; Ichimaru, Y.; Nagatsu, A.; Yoshikawa, M.; Fujii, H.; Nakao, M. Sasa veitchii extract protects against carbon tetrachloride-induced hepatic fibrosis in mice. Environ. Health Prev. Med. 2018, 23, 49. [Google Scholar] [CrossRef] [PubMed]
- Iwata, K.; Naito, E.; Yamashita, K.; Kakino, K.; Taharaguchi, S.; Kimachi, Y.; Hara, M.; Takase, K. Anti pseudorabies virus activity of kumazasa extract. Biocontrol Sci. 2010, 15, 123–128. [Google Scholar] [CrossRef] [Green Version]
- Sakai, A.; Watanabe, K.; Koketsu, M.; Akuzawa, K.; Yamada, R.; Li, Z.; Sadanari, H.; Matsubara, K.; Muroyama, T. Anti-human cytomegalovirus activity of constituents from Sasa albo-marginata (Kumazasa in Japan). Antivir. Chem. Chemother. 2008, 19, 125–132. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ichimaru, Y.; Kanaeda, N.; Tominaga, S.; Suzui, M.; Maeda, T.; Fujii, H.; Nakao, M.; Yoshioka, H. Sasa veitchii extract induces anticancer effects via inhibition of cyclin D1 expression in MCF-7 cells. Nagoya J. Med. Sci. 2020, 82, 509–518. [Google Scholar] [CrossRef]
- Hirose, K.; Onishi, H.; Sasatsu, M.; Takeshita, K.; Kouzuma, K.; Isowa, K.; Machida, Y. In vivo evaluation of Kumazasa extract and chitosan films containing the extract against deep skin ulcer model in rats. Biol. Pharm. Bull. 2007, 30, 2406–2411. [Google Scholar] [CrossRef] [Green Version]
- Zheng, Z.; Liu, Y.; Huang, W.; Mo, Y.; Lan, Y.; Guo, R.; Cheng, B. Neurotensin-loaded PLGA/CNC composite nanofiber membranes accelerate diabetic wound healing. Artif. Cells Nanomed. Biotechnol. 2018, 46, 493–501. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zheng, Z.; Liu, Y.; Yang, Y.; Tang, J.; Cheng, B. Topical 1% propranolol cream promotes cutaneous wound healing in spontaneously diabetic mice. Wound. Repair. Regen. 2017, 25, 389–397. [Google Scholar] [CrossRef] [PubMed]
- Ikarashi, N.; Mizukami, N.; Pei, C.; Uchino, R.; Fujisawa, I.; Fukuda, N.; Kon, R.; Sakai, H.; Kamei, J. Role of Cutaneous Aquaporins in the Development of Xeroderma in Type 2 Diabetes. Biomedicines 2021, 9, 104. [Google Scholar] [CrossRef] [PubMed]
- Ikarashi, N.; Kaneko, M.; Watanabe, T.; Kon, R.; Yoshino, M.; Yokoyama, T.; Tanaka, R.; Takayama, N.; Sakai, H.; Kamei, J. Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitor Erlotinib Induces Dry Skin via Decreased in Aquaporin-3 Expression. Biomolecules 2020, 10, 545. [Google Scholar] [CrossRef] [Green Version]
- Silberstein, C.; Kierbel, A.; Amodeo, G.; Zotta, E.; Bigi, F.; Berkowski, D.; Ibarra, C. Functional characterization and localization of AQP3 in the human colon. Braz. J. Med. Biol. Res. 1999, 32, 1303–1313. [Google Scholar] [CrossRef] [Green Version]
- Spector, D.A.; Wade, J.B.; Dillow, R.; Steplock, D.A.; Weinman, E.J. Expression, localization, and regulation of aquaporin-1 to -3 in rat urothelia. Am. J. Physiol. Renal Physiol. 2002, 282, F1034–F1042. [Google Scholar] [CrossRef]
- Baumgarten, R.; Van De Pol, M.H.; Wetzels, J.F.; Van Os, C.H.; Deen, P.M. Glycosylation is not essential for vasopressin-dependent routing of aquaporin-2 in transfected Madin-Darby canine kidney cells. J. Am. Soc. Nephrol. 1998, 9, 1553–1559. [Google Scholar] [CrossRef]
- Hendriks, G.; Koudijs, M.; van Balkom, B.W.; Oorschot, V.; Klumperman, J.; Deen, P.M.; van der Sluijs, P. Glycosylation is important for cell surface expression of the water channel aquaporin-2 but is not essential for tetramerization in the endoplasmic reticulum. J. Biol. Chem. 2004, 279, 2975–2983. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Umenishi, F.; Narikiyo, T.; Schrier, R.W. Effect on stability, degradation, expression, and targeting of aquaporin-2 water channel by hyperosmolality in renal epithelial cells. Biochem. Biophys. Res. Commun. 2005, 338, 1593–1599. [Google Scholar] [CrossRef]
- Baumann, L. Skin ageing and its treatment. J. Pathol. 2007, 211, 241–251. [Google Scholar] [CrossRef]
- Rawlings, A.V.; Harding, C.R. Moisturization and skin barrier function. Dermatol. Ther. 2004, 17, 43–48. [Google Scholar] [CrossRef] [PubMed]
- Verdier-Sevrain, S.; Bonte, F. Skin hydration: A review on its molecular mechanisms. J. Cosmet. Dermatol. 2007, 6, 75–82. [Google Scholar] [CrossRef] [PubMed]
- Fitsialos, G.; Chassot, A.A.; Turchi, L.; Dayem, M.A.; LeBrigand, K.; Moreilhon, C.; Meneguzzi, G.; Busca, R.; Mari, B.; Barbry, P.; et al. Transcriptional signature of epidermal keratinocytes subjected to in vitro scratch wounding reveals selective roles for ERK1/2, p38, and phosphatidylinositol 3-kinase signaling pathways. J. Biol. Chem. 2007, 282, 15090–15102. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Harper, E.G.; Alvares, S.M.; Carter, W.G. Wounding activates p38 map kinase and activation transcription factor 3 in leading keratinocytes. J. Cell Sci. 2005, 118, 3471–3485. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Turchi, L.; Chassot, A.A.; Rezzonico, R.; Yeow, K.; Loubat, A.; Ferrua, B.; Lenegrate, G.; Ortonne, J.P.; Ponzio, G. Dynamic characterization of the molecular events during in vitro epidermal wound healing. J. Investig. Dermatol. 2002, 119, 56–63. [Google Scholar] [CrossRef] [Green Version]
- Ryu, H.M.; Oh, E.J.; Park, S.H.; Kim, C.D.; Choi, J.Y.; Cho, J.H.; Kim, I.S.; Kwon, T.H.; Chung, H.Y.; Yoo, M.; et al. Aquaporin 3 expression is up-regulated by TGF-beta1 in rat peritoneal mesothelial cells and plays a role in wound healing. Am. J. Pathol. 2012, 181, 2047–2057. [Google Scholar] [CrossRef]
- Sugimoto, T.; Huang, L.; Minematsu, T.; Yamamoto, Y.; Asada, M.; Nakagami, G.; Akase, T.; Nagase, T.; Oe, M.; Mori, T.; et al. Impaired aquaporin 3 expression in reepithelialization of cutaneous wound healing in the diabetic rat. Biol. Res. Nurs. 2013, 15, 347–355. [Google Scholar] [CrossRef]
- Ikarashi, N.; Kon, R.; Kaneko, M.; Mizukami, N.; Kusunoki, Y.; Sugiyama, K. Relationship between Aging-Related Skin Dryness and Aquaporins. Int. J. Mol. Sci. 2017, 18, 1559. [Google Scholar] [CrossRef]
- Ikarashi, N.; Mizukami, N.; Kon, R.; Kaneko, M.; Uchino, R.; Fujisawa, I.; Fukuda, N.; Sakai, H.; Kamei, J. Study of the Mechanism Underlying the Onset of Diabetic Xeroderma Focusing on an Aquaporin-3 in a Streptozotocin-Induced Diabetic Mouse Model. Int. J. Mol. Sci. 2019, 20, 3782. [Google Scholar] [CrossRef] [Green Version]
- Kim, N.H.; Lee, A.Y. Reduced aquaporin3 expression and survival of keratinocytes in the depigmented epidermis of vitiligo. J. Investig. Dermatol. 2010, 130, 2231–2239. [Google Scholar] [CrossRef] [Green Version]
- Lee, A.Y. Role of keratinocytes in the development of vitiligo. Ann. Dermatol. 2012, 24, 115–125. [Google Scholar] [CrossRef] [Green Version]
- Lee, Y.; Je, Y.J.; Lee, S.S.; Li, Z.J.; Choi, D.K.; Kwon, Y.B.; Sohn, K.C.; Im, M.; Seo, Y.J.; Lee, J.H. Changes in transepidermal water loss and skin hydration according to expression of aquaporin-3 in psoriasis. Ann. Dermatol. 2012, 24, 168–174. [Google Scholar] [CrossRef]
- Cao, C.; Sun, Y.; Healey, S.; Bi, Z.; Hu, G.; Wan, S.; Kouttab, N.; Chu, W.; Wan, Y. EGFR-mediated expression of aquaporin-3 is involved in human skin fibroblast migration. Biochem. J. 2006, 400, 225–234. [Google Scholar] [CrossRef]
- Shin, S.Y.; Lee, D.H.; Gil, H.N.; Kim, B.S.; Choe, J.S.; Kim, J.B.; Lee, Y.H.; Lim, Y. Agerarin, identified from Ageratum houstonianum, stimulates circadian CLOCK-mediated aquaporin-3 gene expression in HaCaT keratinocytes. Sci. Rep. 2017, 7, 11175. [Google Scholar] [CrossRef] [Green Version]
- Ikarashi, N.; Ogiue, N.; Toyoda, E.; Nakamura, M.; Kon, R.; Kusunoki, Y.; Aburada, T.; Ishii, M.; Tanaka, Y.; Machida, Y.; et al. Elucidating the mechanism by which Gypsum fibrosum, a traditional Chinese medicine, maintains cutaneous water content. Biol. Pharm. Bull. 2013, 36, 1615–1621. [Google Scholar] [CrossRef] [Green Version]
- Ikarashi, N.; Mochiduki, T.; Takasaki, A.; Ushiki, T.; Baba, K.; Ishii, M.; Kudo, T.; Ito, K.; Toda, T.; Ochiai, W.; et al. A mechanism by which the osmotic laxative magnesium sulphate increases the intestinal aquaporin 3 expression in HT-29 cells. Life Sci. 2011, 88, 194–200. [Google Scholar] [CrossRef] [PubMed]
- Yang, R.; Chowdhury, S.; Choudhary, V.; Chen, X.; Bollag, W.B. Keratinocyte aquaporin-3 expression induced by histone deacetylase inhibitors is mediated in part by peroxisome proliferator-activated receptors (PPARs). Exp. Dermatol. 2020, 29, 380–386. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiang, Y.J.; Kim, P.; Lu, Y.F.; Feingold, K.R. PPARgamma activators stimulate aquaporin 3 expression in keratinocytes/epidermis. Exp. Dermatol. 2011, 20, 595–599. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ikarashi, N.; Kon, R.; Nagoya, C.; Ishikura, A.; Sugiyama, Y.; Takahashi, J.; Sugiyama, K. Effect of Astaxanthin on the Expression and Activity of Aquaporin-3 in Skin in an In-Vitro Study. Life 2020, 10, 193. [Google Scholar] [CrossRef] [PubMed]
- Huber, K.L.; Fernandez, J.R.; Webb, C.; Rouzard, K.; Healy, J.; Tamura, M.; Voronkov, M.; Stock, J.B.; Stock, M.; Perez, E. HYVIA: A novel, topical chia seed extract that improves skin hydration. J. Cosmet. Dermatol. 2020, 19, 2386–2393. [Google Scholar] [CrossRef]
Gene | Forward (5′ to 3′) | Reverse (5′ to 3′) |
---|---|---|
mAqp3 | AGACAGCCCCTTCAGGATTT | TCCCTTGCCCTGAATATCTG |
mFilaggrin | AAGGAAATCAGTCTTGCCGT | CTGACCTTCTGAGACACACC |
mLoricrin | GCCGATGGGCTTAACTTTCT | CAGGATACACCTTGAGCGAC |
mAcer1 | CCGAGTTCTACAATACGTTCA | CATACGGATGCATGAGGAAC |
mAsah1 | CTGTCCTCAACAAGCTGACTG | TCTCAGTACGTCCTCAAGGC |
mSptlc1 | TCCCCTTCCAGAACTGGTTAAA | CCATAGTGCTCGGTGACT |
mSptlc2 | GTCAGGAAATTGGAAACCTGG | AGCTTCCACACCTAAGAACC |
mHyal1 | TTTCTTTGAGCCTGGAGCTA | GTAGTTTCCTTTCGTTGGCT |
mHas2 | CGTGGATTATGTACAGGTGTGT | CCAACACCTCCAACCATAGG |
mCol1a1 | CCCGAGGTATGCTTGATCTG | GGTGATACGTATTCTTCCGGG |
mCol1a2 | TCTCACTCCTGAAGGCTCTA | GTAGTAATCGCTGTTCCACTC |
m18S rRNA | GTCTGTGATGCCCTTAGATG | AGCTTATGACCCGCACTTAC |
hAQP3 | AGACAGCCCCTTCAGGATTT | TCCCTTGCCCTGAATATCTG |
hRPL30 | GAAGACGAAAAAGTCGCTGG | GACCAATTTCGCTTTGCCTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ikarashi, N.; Kaneko, M.; Fujisawa, I.; Fukuda, N.; Yoshida, R.; Kon, R.; Sakai, H.; Sugiyama, K.; Kamei, J. Wound-Healing and Skin-Moisturizing Effects of Sasa veitchii Extract. Healthcare 2021, 9, 761. https://doi.org/10.3390/healthcare9060761
Ikarashi N, Kaneko M, Fujisawa I, Fukuda N, Yoshida R, Kon R, Sakai H, Sugiyama K, Kamei J. Wound-Healing and Skin-Moisturizing Effects of Sasa veitchii Extract. Healthcare. 2021; 9(6):761. https://doi.org/10.3390/healthcare9060761
Chicago/Turabian StyleIkarashi, Nobutomo, Miho Kaneko, Izumi Fujisawa, Natsuko Fukuda, Ryotaro Yoshida, Risako Kon, Hiroyasu Sakai, Kiyoshi Sugiyama, and Junzo Kamei. 2021. "Wound-Healing and Skin-Moisturizing Effects of Sasa veitchii Extract" Healthcare 9, no. 6: 761. https://doi.org/10.3390/healthcare9060761