Rapid High-Yield Transient Expression of Swine Hepatitis E ORF2 Capsid Proteins in Nicotiana benthamiana Plants and Production of Chimeric Hepatitis E Virus-Like Particles Bearing the M2e Influenza Epitope
Abstract
:1. Introduction
2. Results
2.1. Gene Design and Gene cloning
2.2. Protein Expression in Nicotiana Benthamiana Plants Using pEAQ Vector
2.3. Purification of HEV VLPs
2.4. Expression Using pEAQ Vector and Purification of the Chimeric Proteins
2.5. Self-Assembly of the Chimeric M2 HEV 110–610 into VLPs
2.6. Protein Expression in Nicotiana Benthamiana Plants Using pEff Vector
3. Discussion
4. Materials and Methods
4.1. Gene Synthesis, Cloning and Plasmid Construction
4.2. Agroinfiltration
4.3. Protein Extraction, SDS-PAGE and Western Blot Analyses
4.4. Capture ELISA for the HEV ORF2 Protein Quantification
4.5. SDS-PAGE and Western Blot during the Protein Expression with pEAQ and pEff and Comparison
4.6. Purification of VLPs
4.7. Mass Spectrometry
4.8. Transmission Electron Microscopy
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Khuroo, M.S.; Kamili, S. Aetiology, clinical course and outcome of sporadic acute viral hepatitis in pregnancy. J. Viral Hepat. 2003, 10, 61–69. [Google Scholar] [CrossRef] [PubMed]
- Wong, K.H.; Liu, Y.M.; Ng, P.S.P.; Young, B.W.Y.; Lee, S.S. Epidemiology of hepatitis A and hepatitis E infection and their determinants in adult Chinese community in Hong Kong. J. Med. Virol. 2004, 72, 538–544. [Google Scholar] [CrossRef] [PubMed]
- Purcell, R.H.; Emerson, S.U. Hepatitis E: An emerging awareness of an old disease. J. Hepatol. 2008, 48, 494–503. [Google Scholar] [CrossRef] [PubMed]
- Meng, X.J. Hepatitis E virus: Animal reservoirs and zoonotic risk. Vet. Microbiol. 2010, 140, 256–265. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meng, X.-J. Zoonotic and foodborne transmission of hepatitis E virus. Semin. Liver Dis. 2013, 33, 41–49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tam, A.W.; Smith, M.M.; Guerra, M.E.; Huang, C.C.; Bradley, D.W.; Fry, K.E.; Reyes, G.R. Hepatitis E virus (HEV): Molecular cloning and sequencing of the full-length viral genome. Virology 1991, 185, 120–131. [Google Scholar] [CrossRef]
- Sehgal, D.; Thomas, S.; Chakraborty, M.; Jameel, S. Expression and processing of the Hepatitis E virus ORF1 nonstructural polyprotein. Virol. J. 2006, 3, 38. [Google Scholar] [CrossRef] [Green Version]
- Jiménez de Oya, N.; Escribano-Romero, E.; Blázquez, A.-B.; Lorenzo, M.; Martín-Acebes, M.A.; Blasco, R.; Saiz, J.-C. Characterization of Hepatitis E Virus Recombinant ORF2 Proteins Expressed by Vaccinia Viruses. J. Virol. 2012, 86, 7880–7886. [Google Scholar] [CrossRef] [Green Version]
- Bradley, D.; Andjaparidze, A.; Cook, E.H.; McCaustland, K.; Balayan, M.; Stetler, H.; Velazquez, O.; Robertson, B.; Humphrey, C.; Kane, M. Aetiological agent of enterically transmitted non-A., non-B hepatitis. J. Gen. Virol. 1988, 69, 731–738. [Google Scholar] [CrossRef]
- Tyagi, S.; Korkaya, H.; Zafrullah, M.; Jameel, S.; Lal, S.K. The phosphorylated form of the ORF3 protein of hepatitis E virus interacts with its non-glycosylated form of the major capsid protein, ORF2. J. Biol. Chem. 2002, 277, 22759–22767. [Google Scholar] [CrossRef] [Green Version]
- Meng, J.; Dai, X.; Chang, J.C.; Lopareva, E.; Pillot, J.; Fields, H.A.; Khudyakov, Y.E. Identification and characterization of the neutralization epitope(s) of the hepatitis E virus. Virology 2001, 288, 203–211. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Emerson, S.U.; Clemente-Casares, P.; Moiduddin, N.; Arankalle, V.A.; Torian, U.; Purcell, R.H. Putative neutralization epitopes and broad cross-genotype neutralization of Hepatitis E virus confirmed by a quantitative cell-culture assay. J. Gen. Virol. 2006, 87, 697–704. [Google Scholar] [CrossRef] [PubMed]
- Mazalovska, M.; Varadinov, N.; Koynarski, T.; Minkov, I.; Teoharov, P.; Lomonossoff, G.P.; Zahmanova, G. Detection of Serum Antibodies to Hepatitis E Virus Based on HEV Genotype 3 ORF2 Capsid Protein Expressed in Nicotiana benthamiana. Ann. Lab. Med. 2017, 37, 313–319. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meng, X.J. Hepatitis E Virus. In Encyclopedia of Virology, 3rd ed.; Mahy, B.W.J., Van Regenmortel, M.H.V., Eds.; Academic Press: Oxford, UK, 2008; pp. 377–383. ISBN 978-0-12-374410-4. [Google Scholar]
- Yamashita, T.; Mori, Y.; Miyazaki, N.; Cheng, R.H.; Yoshimura, M.; Unno, H.; Shima, R.; Moriishi, K.; Tsukihara, T.; Li, T.C.; et al. Biological and immunological characteristics of hepatitis E virus-like particles based on the crystal structure. Proc. Natl. Acad. Sci. USA 2009, 106, 12986–12991. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guu, T.S.Y.; Liu, Z.; Ye, Q.; Mata, D.A.; Li, K.; Yin, C.; Zhang, J.; Tao, Y.J. Structure of the hepatitis E virus-like particle suggests mechanisms for virus assembly and receptor binding. Proc. Natl. Acad. Sci. USA 2009, 106, 12992–12997. [Google Scholar] [CrossRef] [Green Version]
- Jameel, S.; Zafrullah, M.; Ozdener, M.H.; Panda, S.K. Expression in animal cells and characterization of the hepatitis E virus structural proteins. J. Virol. 1996, 70, 207–216. [Google Scholar]
- Zhang, Y.; McAtee, P.; Yarbough, P.O.; Tam, A.W.; Fuerst, T. Expression, characterization, and immunoreactivities of a soluble hepatitis E virus putative capsid protein species expressed in insect cells. Clin. Diagn. Lab. Immunol. 1997, 4, 423–428. [Google Scholar]
- McAtee, C.P.; Zhang, Y.; Yarbough, P.O.; Bird, T.; Fuerst, T.R. Purification of a soluble hepatitis E open reading frame 2-derived protein with unique antigenic properties. Protein Expr. Purif. 1996, 8, 262–270. [Google Scholar] [CrossRef]
- Li, T.-C.; Takeda, N.; Miyamura, T.; Matsuura, Y.; Wang, J.C.Y.; Engvall, H.; Hammar, L.; Xing, L.; Cheng, R.H. Essential elements of the capsid protein for self-assembly into empty virus-like particles of hepatitis E virus. J. Virol. 2005, 79, 12999–13006. [Google Scholar] [CrossRef] [Green Version]
- Shrestha, M.P.; Scott, R.M.; Joshi, D.M.; Mammen, J.M.; Thapa, G.B.; Thapa, N.; Myint, K.S.; Fourneau, M.; Kuschner, R.A.; Shrestha, S.K.; et al. Safety and efficacy of a recombinant hepatitis E vaccine. N. Engl. J. Med. 2007, 356, 895–903. [Google Scholar] [CrossRef]
- Tsarev, S.A.; Tsareva, T.S.; Emerson, S.U.; Govindarajan, S.; Shapiro, M.; Gerin, J.L.; Purcell, R.H. Successful passive and active immunization of cynomolgus monkeys against hepatitis E. Proc. Natl. Acad. Sci. USA 1994, 91, 10198–10202. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tsarev, S.A.; Tsareva, T.S.; Emerson, S.U.; Govindarajan, S.; Shapiro, M.; Gerin, J.L.; Purcell, R.H. Recombinant vaccine against hepatitis E: Dose response and protection against heterologous challenge. Vaccine 1997, 15, 1834–1838. [Google Scholar] [CrossRef]
- Sainsbury, F.; Lomonossoff, G.P. Extremely High-Level and Rapid Transient Protein Production in Plants without the Use of Viral Replication. Plant. Physiol. 2008, 148, 1212–1218. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sainsbury, F.; Liu, L.; Lomonossoff, G.P. Cowpea mosaic virus-based systems for the expression of antigens and antibodies in plants. Methods Mol. Biol. 2009, 483, 25–39. [Google Scholar] [PubMed]
- Mardanova, E.S.; Blokhina, E.A.; Tsybalova, L.M.; Peyret, H.; Lomonossoff, G.P.; Ravin, N.V. Efficient Transient Expression of Recombinant Proteins in Plants by the Novel pEff Vector Based on the Genome of Potato Virus, X. Front. Plant. Sci. 2017, 8, 247. [Google Scholar] [CrossRef]
- Avdjieva, I.; Terziyski, I.; Zahmanova, G.; Simeonova, V.; Kulev, O.; Krustev, E.; Krachunov, M.; Nisheva, M.; Vassilev, D. Homology based computational modelling of hepatitis-E viral fusion capsid protein. C. R. De l’Academie Bulgare Des. Sci. 2019, 72, 358–364. [Google Scholar]
- Niikura, M.; Takamura, S.; Kim, G.; Kawai, S.; Saijo, M.; Morikawa, S.; Kurane, I.; Li, T.-C.; Takeda, N.; Yasutomi, Y. Chimeric recombinant hepatitis E virus-like particles as an oral vaccine vehicle presenting foreign epitopes. Virology 2002, 293, 273–280. [Google Scholar] [CrossRef] [Green Version]
- Fromantin, C.; Jamot, B.; Cohen, J.; Piroth, L.; Pothier, P.; Kohli, E. Rotavirus 2/6 virus-like particles administered intranasally in mice, with or without the mucosal adjuvants cholera toxin and Escherichia coli heat-labile toxin, induce a Th1/Th2-like immune response. J. Virol. 2001, 75, 11010–11016. [Google Scholar] [CrossRef] [Green Version]
- Byrne, M.J.; Steele, J.F.C.; Hesketh, E.L.; Walden, M.; Thompson, R.F.; Lomonossoff, G.P.; Ranson, N.A. Combining Transient Expression and Cryo-EM to Obtain High-Resolution Structures of Luteovirid Particles. Structure 2019, 27, 1761–1770. [Google Scholar] [CrossRef] [Green Version]
- He, J.; Tam, A.W.; Yarbough, P.O.; Reyes, G.R.; Carl, M. Expression and diagnostic utility of hepatitis E virus putative structural proteins expressed in insect cells. J. Clin. Microbiol. 1993, 31, 2167–2173. [Google Scholar]
- Montpellier, C.; Wychowski, C.; Sayed, I.M.; Meunier, J.-C.; Saliou, J.-M.; Ankavay, M.; Bull, A.; Pillez, A.; Abravanel, F.; Helle, F.; et al. Hepatitis E Virus Lifecycle and Identification of 3 Forms of the ORF2 Capsid Protein. Gastroenterology 2018, 154, 211–223. [Google Scholar] [CrossRef] [PubMed]
- Robinson, R.A.; Burgess, W.H.; Emerson, S.U.; Leibowitz, R.S.; Sosnovtseva, S.A.; Tsarev, S.; Purcell, R.H. Structural characterization of recombinant hepatitis E virus ORF2 proteins in baculovirus-infected insect cells. Protein Expr. Purif. 1998, 12, 75–84. [Google Scholar] [CrossRef] [PubMed]
- Li, T.C.; Yamakawa, Y.; Suzuki, K.; Tatsumi, M.; Razak, M.A.; Uchida, T.; Takeda, N.; Miyamura, T. Expression and self-assembly of empty virus-like particles of hepatitis E virus. J. Virol. 1997, 71, 7207–7213. [Google Scholar] [PubMed]
- Jutras, P.V.; D’Aoust, M.-A.; Couture, M.M.-J.; Vézina, L.-P.; Goulet, M.-C.; Michaud, D.; Sainsbury, F. Modulating secretory pathway pH by proton channel co-expression can increase recombinant protein stability in plants. Biotechnol. J. 2015, 10, 1478–1486. [Google Scholar] [CrossRef] [PubMed]
- Komarova, T.V.; Baschieri, S.; Donini, M.; Marusic, C.; Benvenuto, E.; Dorokhov, Y.L. Transient expression systems for plant-derived biopharmaceuticals. Expert Rev. Vaccines 2010, 9, 859–876. [Google Scholar] [CrossRef]
- Thuenemann, E.C.; Lenzi, P.; Love, A.J.; Taliansky, M.; Bécares, M.; Zuñiga, S.; Enjuanes, L.; Zahmanova, G.G.; Minkov, I.N.; Matić, S.; et al. The use of transient expression systems for the rapid production of virus-like particles in plants. Curr. Pharm. Des. 2013, 19, 5564–5573. [Google Scholar] [CrossRef]
- Peyret, H.; Lomonossoff, G. The pEAQ vector series: The easy and quick way to produce recombinant proteins in plants. Plant. Mol. Biol. 2013, 83, 51–58. [Google Scholar] [CrossRef]
- Mardanova, E.S.; Kotlyarov, R.Y.; Kuprianov, V.V.; Stepanova, L.A.; Tsybalova, L.M.; Lomonosoff, G.P.; Ravin, N.V. Rapid high-yield expression of a candidate influenza vaccine based on the ectodomain of M2 protein linked to flagellin in plants using viral vectors. BMC Biotechnol. 2015, 15, 42. [Google Scholar] [CrossRef] [Green Version]
- Mardanova, E.S.; Ravin, N.V. Plant-produced Recombinant Influenza A Vaccines Based on the M2e Peptide. Curr. Pharm. Des. 2018, 24, 1317–1324. [Google Scholar] [CrossRef]
- Pang, E.L.; Peyret, H.; Ramirez, A.; Loh, H.-S.; Lai, K.-S.; Fang, C.-M.; Rosenberg, W.M.; Lomonossoff, G.P. Epitope Presentation of Dengue Viral Envelope Glycoprotein Domain III on Hepatitis B Core Protein Virus-Like Particles Produced in Nicotiana benthamiana. Front. Plant. Sci. 2019, 10, 455. [Google Scholar] [CrossRef]
- Inoue, H.; Nojima, H.; Okayama, H. High efficiency transformation of Escherichia coli with plasmids. Gene 1990, 96, 23–28. [Google Scholar] [CrossRef]
- Hoekema, A.; Hirsch, P.R.; Hooykaas, P.J.J.; Schilperoort, R.A. A binary plant vector strategy based on separation of vir- and T-region of the Agrobacterium tumefaciens Ti-plasmid. Nature 1983, 303, 179–180. [Google Scholar] [CrossRef]
- Wu, F.S.; Wang, M.Y. Extraction of proteins for sodium dodecyl sulfate-polyacrylamide gel electrophoresis from protease-rich plant tissues. Anal. Biochem. 1984, 139, 100–103. [Google Scholar] [CrossRef]
Primer Name | Primer Sequence (5′-3′) | Purpose |
---|---|---|
HEV-leader F | AAATACCGGTAACAATGGGTGGTGCTGGTGGT | HEV 33–660 |
HEV-leader R | AGGCCTCGAGCTAAGACTCTCTGGTCTTTCC | HEV 33–660 |
HEV_N110_F | AAATACCGGTAACAATGGCTACT | HEV 110–660 |
HEV_N33_F | AAATTCGCGAAACAATGGGTGGTGCTGGTGGT | HEV 33–610, M2 HEV 33–610 |
HEV_N33_R | CAATCTCGAGCTAAGCAAGAGCAGAGTGAGGAGCAA | HEV 33–610, M2 HEV 33–610 |
HEV110_Asc-F | TAGGCGCGCCATGGGTATGGCTACTTCTCCTG | Cloning in pEff vector |
HEV_Sma-R | ATCCCGGGCTAAGCAAGAGCAGAGTGAGGAG | Cloning in pEff vector |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zahmanova, G.G.; Mazalovska, M.; Takova, K.H.; Toneva, V.T.; Minkov, I.N.; Mardanova, E.S.; Ravin, N.V.; Lomonossoff, G.P. Rapid High-Yield Transient Expression of Swine Hepatitis E ORF2 Capsid Proteins in Nicotiana benthamiana Plants and Production of Chimeric Hepatitis E Virus-Like Particles Bearing the M2e Influenza Epitope. Plants 2020, 9, 29. https://doi.org/10.3390/plants9010029
Zahmanova GG, Mazalovska M, Takova KH, Toneva VT, Minkov IN, Mardanova ES, Ravin NV, Lomonossoff GP. Rapid High-Yield Transient Expression of Swine Hepatitis E ORF2 Capsid Proteins in Nicotiana benthamiana Plants and Production of Chimeric Hepatitis E Virus-Like Particles Bearing the M2e Influenza Epitope. Plants. 2020; 9(1):29. https://doi.org/10.3390/plants9010029
Chicago/Turabian StyleZahmanova, Gergana G., Milena Mazalovska, Katerina H. Takova, Valentina T. Toneva, Ivan N. Minkov, Eugenia S. Mardanova, Nikolai V. Ravin, and George P. Lomonossoff. 2020. "Rapid High-Yield Transient Expression of Swine Hepatitis E ORF2 Capsid Proteins in Nicotiana benthamiana Plants and Production of Chimeric Hepatitis E Virus-Like Particles Bearing the M2e Influenza Epitope" Plants 9, no. 1: 29. https://doi.org/10.3390/plants9010029