A C-Terminally Encoded Peptide, MeCEP6, Promotes Nitrate Uptake in Cassava Roots

Abstract

Cassava, an essential food crop, is valued for its tolerance to infertile soils. This study explores the role of C-terminally encoded peptides (CEPs) in cassava, mainly focusing on MeCEP6 and its function in nitrate uptake and plant growth. A comprehensive search on the UniProt website identified 12 CEP genes in cassava, predominantly located on chromosomes 12 and 13. Notably, MeCEP6 demonstrated high expression levels in root tips and exhibited a significant response to low nitrate stress. Exogenous MeCEP6 and its overexpression enhanced NRT2 transporter expression while suppressing auxin-related genes, promoting nitrate uptake and inhibiting seedling growth under nitrogen limitation. This growth inhibition likely represents an adaptive mechanism, enhancing cassava’s survival under nitrogen limitation by optimizing nitrogen allocation and use efficiency, albeit at the cost of reduced growth potential in nitrogen-replete conditions. Moreover, it was identified that MeWRKY65 and MeWRKY70 could interact with the promoter of MeCEP6 to modulate the expression of MeCEP6. The dual-luciferase assays further prove that MeWRKY65 and MeWRKY70 can activate the transcription of MeCEP6 under low nitrate stress conditions. The study’s results help explain the underlying mechanism of MeCEP6 that benefits nitrogen use efficiency and nitrogen deficiency tolerance in cassava. These findings provide a molecular basis for improving cassava yield in nitrogen-deficient soils and highlight MeCEP6 as a potential target for crop improvement.

1. Introduction

Nitrogen is one of the plant macronutrients that plays a critical role in plant growth and development; however, its availability in the soil mainly changes over time and in various areas because of the changes in multiple conditions [1,2]. Therefore, to avoid the impacts of fluctuating nitrogen, plants (including cassava) have developed complex ways to monitor changes in environmental nitrogen, which trigger considerable biochemical adaptations in root architecture to obtain the maximum nutrients from the soil nitrogen [3]. Nitrate is an essential form of nitrogen used by plants directly as a nutrient and potentially as a signal molecule to modulate nitrogen-dependent gene expression and coordinate downstream adaptive responses to maintain a balance between plant growth and nutritional stress adaption [4,5,6]. Local and systemic long-distance signals regulate the root absorption and adaptive response according to the nitrogen status within and outside the plant [7]. It has been proved that proteins like NRT1.1 and NLP7 can directly sense nitrate levels and then receive and transduce nitrate status signals [8,9,10]. Some transporters in the NRT1 family have been capable of transporting nitrates along with other compounds, including nitrite, amino acids, peptides, and various plant hormones, suggesting that they may work together to regulate plant growth and development [11,12,13,14,15].

C-terminally encoded peptides (CEPs) are small peptide hormones produced by plants, including an N-terminal signal peptide, a connecting peptide, and one or more functional domains at the C-terminal area [16,17]. They are made up of approximately 20 amino acids. They have been conserved very well across species, regulating plant growth and development, stress response, and nutrient uptake [18]. CEPs bind to receptors on the cell membrane and activate the expression of downstream genes, thereby affecting plant physiological activities [19]. The overexpression of AtCEP1 inhibits primary root elongation, reduces the number of lateral roots, and results in smaller cells in the apical meristem and maturation zone [20]. CEPs can function in several plant organs to regulate their development and further influence crop yield [21,22,23]. For instance, overexpressed MtCEP1 reduces the number of lateral roots in alfalfa but does not affect root length [24]. The expression of AtCEP2 minimizes the number of rosette leaves and delays flowering [25]. In maize, the expression of ZmCEP1 causes shorter plant height and smaller seeds, leading to a lower plant yield [26].

A previous study has proved that CEPs can be sensitively produced by the roots upon low-nitrogen stress, transported long-distance through the vascular bundles, recognized by its receptor CEPR on the above-ground part, activate the production of CEPD, and induce the expression of the NRT2.1 gene, enhancing nitrate absorption in the roots [27]. HBI1 and TCP20 act in concert to enhance CEP expression, improve nitrate absorption efficiency, and maintain nitrogen levels within Arabidopsis [28]. In addition, local applications of the CEP1 peptide can also promote nitrate absorption in plants such as Arabidopsis and alfalfa, thereby promoting their growth and development [6].

Cassava (Manihot esculenta Crantz) is the world’s sixth most important food crop, growing in more than 100 countries and regions in Africa, the Americas, and Asia. This plant performs well in infertile soil [29,30]. However, even with the advancements made in cassava research, the mechanisms behind its tolerance to poor soils are not yet fully understood, and the specific role of CEPs in cassava needs to be explored [31]. This study predicted 12 cassava CEP homologous genes, and MeCEP6 was identified as the highest level in the root tip zone upon nitrogen starvation. The overexpression of MeCEP6 and the external application of MeCEP6 can stimulate nitrate absorption by activating the nitrate transporter NRTs in roots and increasing the nitrate–nitrogen concentration of the plants. Moreover, the cultivation of MeCEP6-overexpresed transgenic cassava and the external application decreases the expression of auxin signal-associated genes, resulting in growth inhibition. This phenotype resembles the adaptive response to low nitrate stress, suggesting that MeCEP6 overexpression suppresses cassava growth while enhancing tolerance to nitrate limitation. These studies provide new insights and a theoretical basis for peptides, helping increase cassava’s nitrogen use efficiency under N deficiency.

2. Results

2.1. Identification and Analysis of the Cassava CEP Gene

To identify CEP genes in cassava, we searched UniProt and retrieved 12 CEP genes designated as MeCEP1-12. These genes were located on chromosomes 12, 13, 15, and 17 (Figure 1A). Structural analysis revealed that all MeCEP genes were composed of a single exon that did not contain introns. Except for MeCEP7, MeCEP10, and MeCEP12, the remaining MeCEP genes did not contain untranslated regions (Supplementary Figure S1A). A more detailed prediction of the structural domains of MeCEP proteins was carried out using InterProScan-5.25-64.0. The results indicate that all MeCEPs, except MeCEP2, were equipped with an N-terminal signal peptide.

Additionally, MeCEP3-6, MeCEP8-9, and MeCEP11 possessed a maturation domain. In contrast, MeCEP1-2 and MeCEP7 contained multiple maturation domains, whereas MeCEP12 lacked a maturation domain (Supplementary Figure S1B). The sequencing alignment of the 12 mature domain protein-generated sequence conservation Logo further revealed that MeCEP1-8 exhibited differences at amino acids 2, 3, and 7. Meanwhile, MeCEP10 and MeCEP12 had deletions at amino acids 10 and 11 (Supplementary Figure S1C).

Interestingly, a highly conserved helix structure was identified at the C-terminus among the 12 MeCEP proteins, consistent with the C-terminally encoded peptide (Supplementary Figure S1D). This helix structure spanned in the range of 89-322a, and the isoelectric point (pI) was in the range of 5–10 (

Table A1. Physicochemical properties of MeCEP gene family.

Name	Gene Identifier	aa	Start	Termination	Direction	MW(Da)	pI	GRAVY
MeCEP1	Manes.12G100000	120	25886473	25887221	+	13,137.72	7.17	−0.592
MeCEP2	Manes.12G100100	322	25866490	25867763	+	34,318.59	6.62	−0.861
MeCEP3	Manes.12G100200	88	25811645	25812113	+	9577.61	5.03	−0.193
MeCEP4	Manes.12G100300	92	25805335	25805933	+	10,220.97	9.64	−0.261
MeCEP5	Manes.13G126300	90	33391382	33392276	+	10,063.72	7.73	−0.227
MeCEP6	Manes.13G126400	93	33394734	33395016	+	10,481.85	6.25	−0.333
MeCEP7	Manes.13G126500	293	33397428	33398310	+	31,134.11	6.17	−0.745
MeCEP8	Manes.13G126600	117	33403801	33404532	+	12,973.67	6.70	−0.517
MeCEP9	Manes.15G184800	89	28678844	28679114	+	9753.32	9.77	−0.237
MeCEP10	Manes.16G042800	96	6566461	6567257	+	10,501.05	9.60	−0.101
MeCEP11	Manes.17G001300	89	1491711	1492329	+	9846.43	9.60	−0.042
MeCEP12	Manes.17G059300	101	25812294	25813455	+	10,718.20	9.69	0.003

). Subsequently, the CEP families of cassava and Arabidopsis were combined, and an evolutionary tree was constructed using MEGA6 (Figure 1B). The results indicate that Arabidopsis AtCEP1 is most closely related to cassava MeCEP6, exhibiting the highest degree of homology.

Gene duplication is of vital importance in the evolutionary process of species. It was confirmed by the collinear analysis of the CEPs gene family in cassava species. Excluding MeCEP10 and MeCEP12, four gene duplication events were detected in both species. These events were found to originate from post-speciation whole-genome duplications or segmental duplications. In cassava, MeCEP1 and MeCEP2 are corresponding duplicates of MeCEP8 and MeCEP7. Notably, there are no corresponding orthologs of them in Arabidopsis, which implies that these duplication events took place after the divergence of the two species. In addition, the MeCEP5 gene in cassava is orthologous to AtCEP3 in Arabidopsis. However, the lack of an orthologous MeCEP3 in Arabidopsis indicates that this gene might have newly emerged during evolution (Supplementary Figure S2).

A promoter analysis was conducted on the 2000 bp region upstream of the start codon of each MeCEP gene (Supplementary Figure S3). The results indicate various elements related to different hormone and stress responses in the MeCEPs’ promoter. These encompassed elements responsive to abscisic acid, gibberellin, auxin, salicylic acid, and those associated with drought, low temperature, defense mechanisms, meristem activity, and seed-specific responses. Such findings imply that MeCEPs might potentially play significant roles in the context of abiotic stress responses.

2.2. Expression Patterns of MeCEP Genes in Different Tissues and Nitrogen Treatments

To study the expression patterns of MeCEP genes in cassava under different tissues and nitrogen conditions, we analyzed their transcripts in 11 tissues [32]. The results show that most MeCEPs were highly expressed in root tips, with MeCEP6 having the highest expression (Figure 2A).

After pre-treatment with nitrogen-free (-N) or ammonium (NH₄⁺) media, most MeCEP genes were upregulated by nitrate (NO₃⁻), especially MeCEP6 and MeCEP8, which showed weaker responses to ammonium or -N induction. Conversely, after nitrate pre-treatment, most MeCEPs were induced under -N conditions, with MeCEP6 being the most sensitive to nitrogen deficiency (Figure 2B). Thus, MeCEP6 was selected for further study due to its strong response to nitrate and nitrogen deficiency. Additionally, in 15-day-old SC8 seedlings transferred to -N MS medium, MeCEP6 expression increased after 12 h and peaked at 24 h (Figure 2C). As external nitrate concentrations rose, MeCEP6 expression decreased (Figure 2D), indicating that it is induced under low nitrate conditions and inhibited under normal nitrate levels.

2.3. Exogenous Application of MeCEP6 Promotes Nitrate Uptake by Cassava Roots

To investigate the role of MeCEPs on nitrate uptake, we synthesized the mature MeCEP6 small peptide (GWMPDGSVPSPGVGH). Ten-day-old SC8 seedlings were transferred to nitrogen-free MS liquid medium supplemented with 0 mM NO₃⁻, 1 µM MeCEP6 peptide, 5 mM NO₃⁻, or a combination of 5 mM NO₃⁻ and 1 µM MeCEP6 peptide for 15 days of cultivation (Figure 3A). The exogenous application of 1 µM MeCEP6 peptide alone did not significantly impact the growth of SC8 seedlings in terms of root length and fresh weight compared to the 0 mM NO₃⁻ treatment. In contrast, the sole application of 5 mM NO₃⁻ significantly promoted plant growth. However, when it was combined with the exogenous application of 1 µM MeCEP6 peptide, an inhibitory consequence on plant growth emerged, manifested as shortened root systems and diminished biomass (Figure 3B,C). SC8 seedlings showed similar shoot nitrate concentrations but lower root nitrate concentration between 1 µM MeCEP6 peptide-only treatment and 0 mM NO₃⁻ controls. As expected, 5 mM NO₃⁻ treatment increased shoot nitrate concentration 10-fold and whole-plant levels 5-fold compared to 0 mM NO₃⁻ controls, respectively (Figure 3D–F). Notably, 1 µM MeCEP6 peptide enhanced nitrate utilization efficiency under 0 mM NO₃⁻ conditions, though combining 5 mM NO₃⁻ with the 1 µM MeCEP6 peptide only elevated shoot nitrate concentration (Figure 3D, p < 0.05) without affecting roots, whole plants (Figure 3E,F), nitrate accumulation, or utilization efficiency (Figure 3G,H). These results indicate that the exogenous application of MeCEP6 peptide could improve nitrate utilization efficiency by decreasing the nitrate concentration in the root of cassava under low nitrogen conditions, suggesting a potential role in enhancing the tolerance of cassava plants to low nitrogen environments.

The qRT-PCR results show (Figure 3I–O) that, despite the seedlings being in a nitrogen-rich environment (5 mM NO₃⁻), the expression of nitrate transporter genes MeNRT1.1, MeNRT1.5, MeNRT2.1, MeNRT3.1, and assimilation genes MeNIA1 and MeNIR1 in the roots continued to be upregulated within 48 h, showing a similar increasing pattern. This result suggests that MeCEP6 can enhance the ability of roots to acquire nitrate by activating the expression of nitrate uptake and transport-related genes and, at the same time, transmit nitrogen starvation signals, even in the presence of abundant external nitrogen.

2.4. Overexpression of MeCEP6 Promotes Nitrate Uptake by the Roots of Cassava

To further clarify the influence of MeCEP6 on nitrate uptake and signaling pathways, SC8 transgenic plants harboring an empty vector (CK), with two lines exhibiting high levels of MeCEP6 expression, namely MeCEP6-OE#1 and MeCEP6-OE#2 (Figure 4B), were cultivated for 60 days in 5 mM NO₃⁻ solid MS medium, and samples were collected for analysis (Figure 4A). The results reveal that, in comparison to the SC8 plants, the root systems of the MeCEP6-OE transgenic plants were noticeably shortened and their biomass was diminished (Figure 4C,D).

Similar to the treatment with 5 mM NO₃⁻ and 1 µM MeCEP6, the root and shoot nitrate concentration in MeCEP6-OE transgenic plants was higher than those in SC8 transgenic plants carrying an empty vector, but there was no significant difference in nitrate utilization efficiency and nitrate accumulation (Figure 4E–I). It indicates that the overexpression and exogenous application of MeCEP6 promote the absorption of nitrate by cassava seedlings. Moreover, genes related to nitrate transport and assimilation, such as MeNRT1.1, MeNRT1.5, MeNRT2.1, MeNRT2.4, MeNRT3.1, MeNIA1, and MeNIR1, were all discovered to be upregulated in the root systems of the MeCEP6-OE transgenic plants (Figure 4J–P). This further substantiates the impact of MeCEP6 on nitrate uptake and nitrogen starvation signaling.

2.5. External Application of MeCEP6 and Its Overexpression Suppress the Gene Expression Associated with Plant Hormones That Regulate Growth

We observed that both the exogenous application of MeCEP6 and its overexpression notably reduced the length of the primary roots, diminished the fresh weight, and restrained the growth of the plants (Figure 3A and Figure 4A). To explore the influence of MeCEP6 on the root growth and development of cassava plants, we examined the expression of genes related to auxin synthesis and transport in the SC8 roots after a 30-day exogenous application of 1 μM MeCEP6 peptide. We also investigated the same in MeCEP6-OE#1 and MeCEP6-OE#2 plants following a comparable incubation period in the MS medium. The expression levels of three genes related to auxin synthesis, namely TAA1, YUC2, and YUC4 (Figure 5A), along with four genes associated with auxin transport, including AUX2, PIN1, PIN2, and PIN3 (Figure 5B), were all markedly reduced in the two transgenic plants when compared to those in the SC8 plants. The two MeCEP6-OE plants exhibited more potent inhibitory effects than the exogenous application. It can be inferred that MeCEP6 can influence plant growth by impeding plant root elongation via the regulation of auxin biosynthesis and the distribution of auxin concentration among sub-tissues.

2.6. MeWRKY65 and MeWRKY70 Positively Regulate the Expression of MeCEP6

To explore the regulatory mechanism of MeCEP6, we employed the yeast one-hybrid (Y1H) assay and identified 11 potential candidate transcription factors (TFs;

Table A3. Basic information on transcription factors.

Number	Gene Symbol	CDS (bp)	Protein (aa)
1	MeWRKY7	1077	359
2	MeWRKY65	798	266
3	MeWRKY70	849	283
4	MeWRKY75	582	194
5	MebHLH96	999	333
6	MeHB6	927	309
7	MeHSFA6B	1077	359
8	MeOBP3	984	328
9	MeTGA1	1134	378
10	MeZML2	858	286
11	MeAGL16	678	226

). Among them, two TFs, namely MeWRKY65 and MeWRKY70 (Figure 6A), exhibited relatively higher expression levels in the adventitious roots and root tips, respectively. In 10-day SC8 seedlings treated with 0 mM NO₃⁻ and 5 mM NO₃⁻ for 24 h, we found that the expression levels of MeWRKY65 and MeWRKY70 were increased under 0 mM NO₃⁻ treatment compared with the 5 mM NO₃⁻ treatment (Supplementary Figure S5). We transiently transformed Nicotiana benthamiana leaves with Agrobacterium tumefaciens GV3101 (pSoup-p19) carrying the recombinant plasmids pGreen II 0800-MeCEP6pro together with pGreen II 62-SK-MeWRKY65 or pGreen II 62-SK-MeWRKY70. The results show that the LUC/REN ratios and fluorescence intensities from live-cell imaging were significantly higher in the combinations of pGreen II 0800-MeCEP6pro with pGreen II 62-SK-MeWRKY65 or pGreen II 62-SK-MeWRKY70 compared to the control groups. It indicates that MeWRKY65 and MeWRKY70 can bind to the MeCEP6 promoter and positively regulate its expression (Figure 6B–G).

3. Discussion

3.1. MeCEP6 Promotes Nitrate Uptake by Cassava Roots

Over 900 CEPs have been detected in plant genomes, and most of them respond to abiotic stresses, such as nitrogen, salt, and sugar [26]. However, the precise mechanisms through which CEPs govern nitrate absorption by cassava roots remain elusive. This study identified 12 MeCEP genes, 8 clustered on chromosomes 12 and 13. Most MeCEP genes are highly expressed in root tips, with MeCEP6 showing the highest expression, particularly under nitrogen starvation, where MeCEP6 expression is significantly upregulated. The exogenous application and overexpression of MeCEP6 upregulate genes associated with nitrate transporters and nitrogen assimilation. Furthermore, MeCEP6-treated plants show a higher NUE without significant changes in total nitrate accumulation or fresh weight under low-nitrogen conditions.

CEPDL2 can regulate nitrate absorption and transport through the stem-to-root migration [33]. Research shows that applying CEP peptides at 5 mM NO₃⁻ promotes MeGRXC1 (MeCEPD) expression in cassava leaves (Supplementary Figure S6), indicating that CEP peptides may influence the absorption and utilization of nitrate in plants through a similar mechanism, improving nitrate use efficiency without changing total nitrate accumulation or fresh weight. The effects of CEP peptides on plants are time-dependent, involving initial adaptation, signal transduction, metabolic adjustments, and growth changes. In this study, with the CEP peptide treatment for 15 days, the nitrate utilization efficiency increased, but the total nitrate accumulation and biomass did not change significantly, which suggests that a prolonged treatment duration may be required to observe systemic effects on plant growth. In summary, MeCEP6 enhances NUE under low nitrogen conditions by regulating nitrate transporter gene expression, thereby improving nitrate uptake in cassava roots.

3.2. MeCEP6 Inhibits the Growth of Cassava Plants Through Plant Hormones

In various crops, such as Arabidopsis, maize, rice, cereals, and apples, the expression of CEP peptide hormones has been demonstrated to impede plant growth and restrain root elongation [26,27,34,35,36]. In this study, overexpressed MeCEP6 or treated with exogenous MeCEP6 manifested shorter primary roots and diminished fresh weight. Exogenous MdCEP1 and its ectopic expression in Arabidopsis could negatively regulate genes related to IAA [36].

Similarly, SiCEP3 impacts cereal growth by facilitating the uptake of abscisic acid (ABA) and curtailing root elongation [37]. ZmCEP1 influences maize kernel development by modulating the transcription of genes implicated in nitrogen metabolism, nitrate, sugar transport, and IAA response pathways [26]. CEP signaling with cytokinin (CTK) impedes primary root growth via the CEPD system in Arabidopsis [38]. Moreover, investigations conducted by three other scientists highlighted that nitrate engages in crosstalk with other plant hormones like CTK and ethylene (ETH) [39,40,41].

While MeCEP6 enhances nitrate uptake under low nitrogen, its concurrent suppression of auxin biosynthesis (TAA1, YUC2) and transport (PIN1, PIN2) genes (Figure 5) suggests a trade-off between nutrient acquisition and growth. It aligns with an adaptive strategy: cassava prioritizes nitrogen assimilation over biomass expansion, redirecting resources to sustain metabolic efficiency under nitrogen scarcity. Similar growth-inhibition phenotypes are observed in Arabidopsis and maize under CEP overexpression, supporting the hypothesis that CEPs act as systemic signals to balance nutrient uptake and growth under stress [27,42]. Based on these discoveries, we hypothesized that MeCEP6 might impede cassava plant growth and development by holistically influencing IAA’s concentration and distribution. This inhibitory effect could also be achieved through synergistic crosstalk with other hormones like abscisic acid (ABA) and cytokinin (CTK).

3.3. The CEP Signaling Pathway Plays a Role in Cassava’s Tolerance to Barrenness

Cassava roots face heterogeneous nitrogen-stress environments. Low nitrogen in the rhizosphere triggers MeCEP gene expression in roots. MeCEP binds to MeCEPR in leaves, producing MeCEPD. MeCEPD moves to roots and activates genes related to nitrate transport and assimilation (e.g., MeNRT1.1, MeNRT2.1, etc.), enhancing root nitrate absorption capacity. So, cassava alleviates nitrogen starvation via the MeCEP pathway. Concurrently, MeCEP also suppresses genes related to growth-stimulating hormone synthesis and transport, leading to shorter primary roots and impeded growth. MeCEP likely affects plant growth and development by modulating the concentration and distribution of hormones, like IAA, CTK, ETH, and ABA, and substances like sugars [43,44]. Its role in cassava is complex, involving response to nitrogen stress and possibly regulating plant growth through hormone balance, and perhaps inhibiting growth under nitrogen restriction as a trade-off for barren tolerance. Future research needs to explore the interaction between MeCEP and plant hormones like IAA, ABA, and CTK in different environments, as well as the impact of MeCEP6 on cassava growth and nitrogen use efficiency. It will help to comprehensively understand the role of the MeCEP signaling pathway in cassava’s tolerance to nutrient-poor conditions and its response to nitrogen availability.

4. Materials and Methods

4.1. Identification of MeCEP Genes in Cassava

Using the AtCEP amino acid sequence, we obtained 12 MeCEP genes in cassava from the search on UniPort (https://www.uniprot.org/; accessed on 8 November 2022). Evolutionary trees were generated using MEGA6. Mature peptides were predicted using InterPro (https://www.ebi.ac.uk/interpro/; accessed on 24 December 2022). We used the ExPASy proteomics server (http://expasy.org/; accessed on 15 May 2023) to predict isoelectric points and molecular weights—wepredicted the 3D model of the MeCEPs protein by I-TASSER (https://zhanglab.ccmb.med.umich.edu/ITASSER/; accessed on 3 July 2023). The cis-element in the MeCEPs gene promoter was predicted using PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/; accessed on 8 August 2023).

4.2. The Creation of Overexpressed Transgenetic MeCEP6 Cassava

Primers corresponding to the full-length CDSs of MeCEP6 were designed from the Phytozome v13 database. Total RNA was extracted from SC8 roots using the RNA Plant Extraction Kit (Tiangen Biotech, Beijing, China), followed by cDNA synthesis with PrimeScript™ RT Kit (Takara Bio, Shiga, Japan). The MeCEP6 CDS (Manes.13G126400) was amplified using primers MeCEP6-F/R (

Table A2. Primers used in this study.

Name	Sequence (5′–3′)	Purpose
MeCEP1qPCR-F	CGGTAGATGGAAGGCACTTG	qRT-PCR
MeCEP1qPCR-R	CCACTAGGAATTGGGATGGC	qRT-PCR
MeCEP2qPCR-F	CGTACCGCATTTGCTGATTC	qRT-PCR
MeCEP2qPCR-R	CAACTTCAGGGTTCGGACAA	qRT-PCR
MeCEP3qPCR-F	CCTCAAGTGTGTGGAATGCT	qRT-PCR
MeCEP3qPCR-R	ATCCGTCACTGGGTTCAATG	qRT-PCR
MeCEP4qPCR-F	GCAACCATTAGGGCAATGTG	qRT-PCR
MeCEP5qPCR-F	GAACGTGTCTGAAGATACCCA	qRT-PCR
MeCEP5qPCR-R	TGTTGATGGAGTGACCAACG	qRT-PCR
MeCEP6qPCR-F	GCCAACAATGTAGATCGCAC	qRT-PCR
MeCEP6qPCR-R	TCCTCTGCTAGGGATTCTCG	qRT-PCR
MeCEP7qPCR-F	ATGATCACAGGCCGACAAAG	qRT-PCR
MeCEP7qPCR-R	TCAATTGTGGTCCCAGGAGA	qRT-PCR
MeCEP8qPCR-F	AGTCCGTAGATGGAAAAAGGC	qRT-PCR
MeCEP8qPCR-R	TCACCATGCACGTTATGCTT	qRT-PCR
MeCEP9qPCR-F	TCCGCCACCTTTCCCTAATA	qRT-PCR
MeCEP9qPCR-R	TTATGACCTACACCAGGGCT	qRT-PCR
MeCEP10qPCR-F	CGACTCGTCTCTGTTCCAAG	qRT-PCR
MeCEP10qPCR-R	GGAACAGACCGTAGAATCCG	qRT-PCR
MeCEP11qPCR-F	AGGCCACTGCATATTCATCC	qRT-PCR
MeCEP11qPCR-R	CTATGACCTGGGCTTGTTGG	qRT-PCR
MeCEP12qPCR-F	GCAGGAAGCTGTTGATGAGT	qRT-PCR
MeCEP12qPCR-R	TTGGAAGGGCACTGGAAATC	qRT-PCR
MeNRT1.1qPCR-F	TCAAATCAAGTGTCTCGGGC	qRT-PCR
MeNRT1.1qPCR-R	GTGCCAGACAAGAACAGGAT	qRT-PCR
MeNRT2.1qPCR-F	TATTTCCGGCATGACTGGTG	qRT-PCR
MeNRT2.1qPCR-R	TCTTCGGTGGATTTCACGAC	qRT-PCR
MeNRT2.4qPCR-F	GTTCTGGACTGACACAGCTT	qRT-PCR
MeNRT2.4qPCR-R	TCTGCTTTTCCTCCTCGTTC	qRT-PCR
MeNRT3.1qPCR-F	TCCGGAAAACTCTTGTGGTC	qRT-PCR
MeNRT3.1qPCR-R	TTGGATAGGTTGTCCTCGGT	qRT-PCR
MeTAA1qPCR-F	CTGGAGGAAGATGGGTGAGA	qRT-PCR
MeTAA1qPCR-R	GGTTCGAGAAACCAGCAGAA	qRT-PCR
MeYUC1qPCR-F	CCCAAGTACCCAACAAAGCA	qRT-PCR
MeYUC1qPCR-R	ATTCAGCTTCTTGAACGGCT	qRT-PCR
MeYUC2qPCR-F	TGCATAGCTTCGTTGTGGAA	qRT-PCR
MeYUC2qPCR-R	GTCGGGTAGGTAGGGAAACT	qRT-PCR
MeAUX1qPCR-F	GTTCGCATGTACACCTCTGT	qRT-PCR
MeAUX1qPCR-R	TATGGGTATCACCACAGGCA	qRT-PCR
MePIN1qPCR-F	ATGGTGGTGGTTTGGGTAAC	qRT-PCR
MePIN1qPCR-R	GCATTATTAGCAGCAACGCC	qRT-PCR
MePIN2qPCR-F	CACTCTGGTTATGGGCATCC	qRT-PCR
MePIN2qPCR-R	TCAGGAAACTGTTCGCCAAT	qRT-PCR
MePIN3qPCR-F	AGGGTGGAGTTGCTGCTAATA	qRT-PCR
MePIN3qPCR-R	TGGAGATACAGCCAATCGAAC	qRT-PCR
MeCEP6-F	ATGGCCAACAATGTAGATCGC	Carrier construction
MeCEP6-R	TTAATGACCAACACCTGGGCT	Carrier construction
MeCEP6OE-F	CGCGGATCCATGGCCAACAATGTAGATCGC	Carrier construction
MeCEP6OE-R	AACTGCAGATGACCAACACCTGGGCTAT	Carrier construction
MeCEP6pro-F	GCCTCATAGGCTCGCTTAAC	Yeast one-hybrid
MeCEP6pro-R	ATGACCAACACCTGGGCTAT	Yeast one-hybrid
MeWRKY65-F	CATCAGCAGCCACTTAACTCT	Yeast one-hybrid
MeWRKY65-R	TATCACCCACACAATTTCCCAT	Yeast one-hybrid
MeWRKY70-F	GCGTCGACATGGCAACTCCTTGGCC	Yeast one-hybrid
MeWRKY70-R	CGGGATCCTTAGCTTAGGTAGTTGAAATCACTT	Yeast one-hybrid
MeWRKY75-F	TGAAGACATGGCTGTGGAAC	Yeast one-hybrid
MeWRKY75-R	CTGCTCAGCCCTTAATGAGT	Yeast one-hybrid
MeWRKY7-F	TTAGCTTTGGCTTGGTTCTCG	Yeast one-hybrid
MeWRKY7-R	AACCCGCGTGATGACAATG	Yeast one-hybrid
MeActin-F	TCTTCTCAACTGAGGAGCTGCT	Internal reference primer
MeActin-R	CCTTCGTCTGGACCTTGCTG	Internal reference primer

) under the following conditions: initial denaturation at 98 °C for 30 s; 35 cycles of 98 °C for 10 s, 60 °C for 30 s, and 72 °C for 30 s, and a final extension at 72 °C for 5 min. The products were cloned into the pCAMBIA1300 vector via the KpnI and SalI restriction sites and transformed into Ecoli DH5α competent cells for propagation. Plasmid DNA was isolated and sequenced by Sangon Biotech (Shanghai, China https://www.sangon.com) using vector primers (MeCEP6OE-F/R, Table A2) to confirm sequence integrity. Next, the recombinant plasmid was transformed into the susceptible state of Agrobacterium LBA4404 and infected the brittle embryogenic callus of cassava SC8 [34]. After the transgenic seedlings grew new leaves, a real leaf was cut from the transgenic plants to extract DNA. Then, the detection primers were designed to identify positive transgenic events. For plants correctly detected at the DNA level, a one-month-old leaf sample was obtained and fully ground in liquid nitrogen for RNA extraction and reverse transcription. The qRT-PCR primers of the MeCEP6 gene were designed to examine its expression level (Supplementary Figure S7).

4.3. Plant Nitrogen Treatment

The cassava variety SC8 and two overexpression lines were grown on 1/2 MS solid medium (containing 10 mM NO₃⁻ as the standard nitrogen level) for 10 days, and then transferred to a nitrogen-free (-N) MS liquid medium for stress tests. The control group for low-nitrogen experiments was strictly defined as 0 mM NO₃⁻, while the standard nitrogen condition was maintained at 5 mM NO₃⁻, unless otherwise specified. Potassium nitrate was the nitrogen source and potassium sulfate replaced it at lower levels to maintain ionic balance. The medium’s pH was 5.8, containing 25 g L⁻¹ sucrose and 1 g L⁻¹ agar. The chamber was kept at 26 °C, 50% humidity, with a 14 h/10 h light/dark cycle and 250 µmol m⁻² s⁻¹ light intensity. Seedlings were treated with 0 mM (-N), 0.5 mM, and 5 mM potassium nitrate and chloride for 0 h, 2 h, 12 h, 24 h, and 48 h. The harvested roots were frozen in liquid nitrogen and stored at −80 °C.

For the root nitrogen separation treatment, the root of the 15-day-old SC8 plant was carefully divided into two equal parts with a sterile scalpel after a 15-day pretreatment with no nitrogen (-N), 5 mM NH₄⁺, or 5 mM NO₃⁻, while keeping the stem system intact.After the no-nitrogen (-N) pretreatment, the roots of SC8 plants were treated with 5 mM NH₄⁺ or 5 mM NO₃⁻ simultaneously. For plants pretreated with 5 mM NH₄⁺, the roots were exposed to either no nitrogen (-N) or 5 mM NO₃⁻, whereas for those pretreated with 5 mM NO₃⁻, the roots received 5 mM NH₄⁺ or no nitrogen (-N). Samples were collected after 2 h and 2 d, quickly frozen in liquid nitrogen, and stored at −80 °C for subsequent RNA extraction and gene expression analysis.

MeCEP6 small peptide (AFRPTYPGHSPGVGH) was 75% pure and N-terminal-labeled with a fluorescent dye (5-FITC) and synthesized by Sangon Biotech (Shanghai, China, https://www.sangon.com). SC8 seedlings were cultured on 1/2 MS curing medium for 15 days and transferred to 1/2 MS liquid medium supplemented with 1 µM MeCEP6 peptide. The other experiments were conducted after 0 h, 12 h, 24 h, and 48 h.

For the exogenous application of the MeCEP6 treatment, 10-day-old SC8 seedlings were transferred to a liquid MS medium supplemented with 0 mM NO₃⁻ + 1 µM MeCEP6 peptide [19], 5 mM NO₃⁻, and 5 mM NO₃⁻ + 1 µM MeCEP6 peptide without nitrogen for 15 days. Transgenic seedlings were propagated by excising apical buds (1 cm) and transferring them to a fresh MS medium for 60 days under sterile conditions. Roots, shoots, and apical meristems were collected separately from plants grown under standard nitrogen conditions for tissue-specific expression profiling. For the nitrogen treatment, 15-day-old SC8 cassava seedlings were pre-cultured in a 1/2 MS solid medium for 10 days and transferred to a liquid MS medium containing 1 µM MeCEP6 peptide for treatment. Treatment times were 0 h, 12 h, 24 h, and 48 h (3 biological replicates in each group). After treatment, root samples were frozen in liquid nitrogen and stored at −80 °C for subsequent RNA extraction and gene expression analysis.

4.4. RT-qPCR Analysis

RNA extraction was performed from cassava tissues (each 100 mg) using an RNA Plant Extraction Kit (Tiangen Biotechnology Ltd., Beijing, China), following the manufacturer’s instructions. The extracted RNA was then quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Reverse transcription was conducted using PrimeScript^TM RT kit (Perfect Real Time) (Takara Bio, Shiga, Japan). The specificity of the gene-specific primers was analyzed using the melt curve analysis. The cassava actin gene MeActin (Manes.13G084300) served as the reference, with primer efficiency validated, and the 2^−ΔΔCT method was employed for quantification to calculate the expression of the target gene [45]. Three biological replicates were conducted for the experiment, and the forward and reverse primers used in the experiment are presented in Table A2.

4.5. Phenotypic Characterization

Representative plants exposed to the above nitrogen treatments were selected to measure the root length and weigh plant weight. We photographed and analyzed distinct phenotypes using image software, and then statistically evaluated the data to assess plant traits. The nitrate–nitrogen concentrations of the shoot and root were determined using a plant nitrate–nitrogen kit (Suzhou Kemin Biotechnology Co., Ltd., Suzhou, China, www.cominbio.com). The accumulation of nitrogen was calculated using the following formulas:

Total NO₃⁻ accumulation (mg) = Nitrogen concentration × Fresh weight

NO₃⁻ use efficiency (NUE, g/g) = Fresh weight/Total NO₃⁻ accumulation

4.6. Yeast One-Hybrid (Y1H) Library Screening

The 2000 bp promoter region of MeCEP6 was amplified with primers MeCEP6pro-F/R (Table A2), cloned into the pAbAi vector (Clontech), and then sequenced to verify this. A cassava root cDNA library was constructed using RNA from low nitrogen-treated seedlings. The yeast single hybridization (Y1H) system screened the cassava root cDNA library. After determining the minimum AbA concentration for screening, the cDNA library was transferred into the Y1H Gold yeast containing MeCEP6pro. Positive clones capable of activating reporter genes were screened on an appropriately selective medium. These positive clones were picked for PCR identification and Sanger sequencing after secondary streaking on SD/-Ura-Leu plates with minimum Aureobasidin A (AbA) concentration. The sequence data obtained from Sanger sequencing were aligned with the reference cassava genome for annotation. The function of candidate genes was further verified by co-expression and other functional verification experiments.

4.7. Luciferase In Vivo Imaging Assay (LCI)

The plasmid used in this experiment was pGreen II-0800, and the MeCEP6 promoter was used as the reporter plasmid for this vector. Subsequently, effector plasmids were constructed by cloning the coding sequences (CDS) of MeWRKY65 and MeWRKY70 into the pGreen II-62-SK vector. The plasmids pGreen II-0800-MeCEP6 and pGreen II-62-SK-MeWRKY65 or pGreen II-62-SK-MeWRKY70 were co-transformed into Agrobacterium tumefaciens GV3101 (pSoup-P19). Then, they were cultured with shaking at 200 rpm in a LB liquid medium (containing 50 mg/L Rif and 50 mg/L Kan) at 28 °C until the optical density at 600 nm (OD₆₀₀) reached 0.8. The bacterial suspension was injected into the leaves of Nicotiana benthamiana using the agroinfiltration method. Samples were collected after 48 h of dark incubation. The dual-luciferase activity (LUC/REN) was measured using the GloMax^® Navigator Multimode Detection System (Promega Corporation, Madison, WI, USA) according to the instructions of the Luciferase assay System kit (Promega Corporation, Madison, WI, USA). The fluorescence signals were captured by the ChemiDoc™ MP Imaging System (Bio-Rad Laboratories, Inc., Hercules, CA, USA) with an exposure time set to 30 s and a 530 nm emission filter.

4.8. Statistical Analysis

All experiments were conducted with three biological replicates, and the data presented in this paper represent the means ± standard deviation (SD). Statistical significance was determined using a one-way analysis of variance (ANOVA) followed by Tukey’s honestly significant difference (HSD) post hoc test for multiple comparisons. The difference in letters was statistically significant (p < 0.05). The statistical tests for each figure or table are detailed in the corresponding figure legends or Section 2.