Next Article in Journal
Function of Anthocyanin and Chlorophyll Metabolic Pathways in the Floral Sepals Color Formation in Different Hydrangea Cultivars
Previous Article in Journal
Unveiling the Potential Role of Dhurrin in Sorghum During Infection by the Head Smut Pathogen Sporisorium reilianum f. sp. reilianum
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 14
Issue 5
10.3390/plants14050741
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

An Integrative Systematic Approach Reveals a New Species of Crocus Series Verni (Iridaceae) Endemic to Albania

by
Irena Raca
1,*,
Donald Shuka
2,3,
Lulëzim Shuka
3,
Nomar Espinosa Waminal
4 and
Dörte Harpke
4
1
Department of Biology and Ecology, Faculty of Sciences and Mathematics, University of Niš, 18000 Niš, Serbia
2
Department of Biology, Faculty of Technical Sciences, University of Vlora “Ismail Qemali”, 9401 Vlorë, Albania
3
Department of Biology, Faculty of Natural Sciences, University of Tirana, Bld “Zogu I” Nr. 25/1, 1001 Tiranë, Albania
4
Leibniz Institute of Plant Genetics and Crop Plant Research (IPK), 06466 Gatersleben, Germany
*
Author to whom correspondence should be addressed.
Plants 2025, 14(5), 741; https://doi.org/10.3390/plants14050741
Submission received: 19 January 2025 / Revised: 25 February 2025 / Accepted: 26 February 2025 / Published: 28 February 2025
(This article belongs to the Section Plant Systematics, Taxonomy, Nomenclature and Classification)
Browse Figures
Versions Notes

Abstract

The allopolyploid complexes in Crocus series Verni represent taxonomic challenges due to their variable or mostly overlapping morphology with one parental species. Moreover, their diploid ancestors remain unidentified, even with genome-wide SNP data. One such case, collected from the southeasternmost point of the series’ geographical distribution, is herein characterised and described as a new species, C. bachofenii. This study integrates phylogenomics and cytogenetics to infer the parental origin of C. bachofenii and establish its diagnostic morphological characteristics. Genome skimming of C. bachofenii and 10 other C. ser. Verni species enabled the development of novel satellite repeats as cytogenetic markers and the assembly of their complete chloroplast genomes that were employed for phylogenetic analysis alongside GBS data. The allopolyploid origin of C. bachofenii (2n = 16) was confirmed with C. vernus as the maternal parent. The probably extinct paternal parent was affiliated with a clade comprising C. heuffelianus, C. tommasinianus, C. kosaninii, and C. bertiscensis. Morphologically, C. bachofenii is distinguished by larger flowers, perigone segment coloration, and a stigma–anther ratio from its close relatives. In conclusion, its phylogenetic affiliation, distinctive cytological status, and unique morphological features justified the description of this taxon as a new species.

1. Introduction

Allopolyploid complexes are taxonomically challenging for various reasons [1]. Their high morphological variability can lead to characters overlapping with other species [2], or a predominance of one of the parental genomes can result in a high resemblance to one of the parents. Moreover, it might complicate the morphological recognition of the allopolyploids [3,4].
In the past decade, Crocus L. series Verni B. Mathew was the object of different investigations aimed at resolving phylogenetic relationships and unraveling the evolutionary history of allopolyploids and their cytotypes [4,5]. The group currently comprises 12 species from Central and South Europe (C. bertiscensis Raca, Harpke, Shuka and V. Randjel., C. etruscus Parl., C. ilvensis Peruzzi and Carta, C. heuffelianus Herb., C. kosaninii Pulević, C. longiflorus Raf., C. neapolitanus (Ker Gawl.) Loisel., C. neglectus Peruzzi and Carta, C. siculus Tineo, C. tommasinianus Herb., and C. vernus (L.) Hill) and the allotetraploid complex of C. heuffelianus and C. vernus hybrids.
While disentangling the latter allopolyploid complex [4], a tetraploid “C. cf. vernus” 2n = 16 was found in Central and Northeastern Albania. Analysis of three chloroplast markers indicated that C. vernus 2n = 8 was the maternal parent [4]. However, it remained unclear whether this tetraploid emerged as an autoploid or alloploid. To address these issues, we added an additional analysis of genome-wide single nucleotide polymorphism (SNP) data obtained by genotyping-by-sequencing (GBS; [6]) and skimmed the genomes of C. bachofenii and nine other C. ser. Verni species for novel satellite repeats that can be used as cytogenetic markers. Such cytogenetic markers can provide insights into the polyploidy origin, i.e., autopolyploidy versus allopolyploidy, by revealing the number of chromosomes with similar chromosomal distribution patterns as a function of polysomic versus disomic inheritance, respectively [7,8]. Moreover, these cytogenetic markers could enlighten us about the complex karyotype evolution in C. ser. Verni, which is characterised by an extensive degree of chromosomal rearrangements resulting in different chromosome numbers. Therefore, we also characterise the karyotype. Genome skimming data were also used to compare the entire chloroplast of most C. ser. Verni species aimed to arrive at a higher resolution in comparison to [4].
Additionally, detailed morphological investigations were also lacking [4], which would have allowed a correct taxonomical treatment. Therefore, thorough morphological investigation and field studies were conducted to establish diagnostic characteristics essential for clear identification and circumscription of the distribution. Our morpho-anatomical investigation initially included the known species of C. ser. Verni within the geographical area surrounding the new species. So far in Albania, only C. bertiscensis and C. vernus, as well as the allotetraploid C. cf. heuffelianus, have been reported for C. series Verni, with their distribution in the alpine region of the Albanian Alps at altitudes ranging from 850 m to 2300 m a.s.l. [9,10]. Moreover, Meyer [11] also reported the occurrence of C. tommasinianus in Kunora e Lurës.

2. Results

2.1. Phylogenetic Affiliation

Crocus bachofenii shares the nearly identical chloroplast haplotype with the eastern C. vernus (Figure 1). A supernetwork was constructed using SplitsTree based on 500 rooted maximum likelihood trees obtained by IQ-tree. It depicts C. bachofenii positioned near the centre of the network, with C. vernus being the closest diploid species, followed by C. heuffelianus (based on the mean branch lengths of the 500 trees) (Figure 2).
Crocus bachofenii possesses 1674 private alleles out of 32,170 in the dataset (Table S1), which otherwise includes only diploid species from C. ser. Verni. Consequently, 30,378 alleles of C. bachofenii are shared with other C. ser. Verni species, of which 99.6% are found in either the cladeI (C. vernus, C. siculus, and C. neapolitanus) or cladeII (C. bertiscensis, C. heuffelianus, C. kosaninii, and C. tommasinianus). Crocus bachofenii shares 87% of its none-private SNPs with both cladeI and cladeII, respectively. Specifically, it shares 85% (25,851 SNPs) of its none-private SNPs with C. vernus, among which 1777 SNPs are exclusively shared between these two species (Table 1). Crocus heuffelianus and C. tommasinianus share 69% (21,187 SNPs) and 60% (18412 SNPs), respectively, with C. bachofenii, including 550 SNPs (with C. heuffelianus) and 289 SNPs (with C. tommasinianus) that are exclusively shared. All other diploid species share less than 50% of their SNPs with C. bachofenii (Table 1).
The shared heterozygosity was used to infer the degree of clonal reproduction in C. bachofenii. Only one clonemate pair was found within the Mt. Zeba population of C. bachofenii; otherwise, shared heterozygosity was 0.61 or lower (Figure 3).

2.2. Karyological Analysis

Crocus bachofenii has a chromosome number of 2n = 16 (Figure 4) and genome size of 2C = 12.25 ± 0.19 pg (Pisum sativum L. was used as standard; CV standard: 2.73–3.72; CV sample: 4.47–7.38) (taken from Table S3 published by [4]).
We identified three high-confidence satellite repeats named CroSat137, CroSat042, and CroSat144, each with consensus sequence lengths of 159, 178, and 186 bp (Figure S1), respectively, that were used in addition to the 5S rDNA, 45S rDNA, and TTAGGG telomeric repeat for FISH [12].
The six FISH probes showed a range of heterozygous distribution (Figure 4 and Figure S2). The 45S rDNA was localised in only one chromosome pair at the short arm of chromosome 8. Five signals were observed for the 5S rDNA, including one major pair at the short arm of chromosome 4, one minor pair at the short arm of chromosome 5, and a hemizygous locus at the long arm of chromosome 3. The TTAGGG telomeric repeat, while showing distinct signals at the ends of the chromosomes, showed a dispersed distribution along all chromosomes. The CroSat137 showed a putative centromeric distribution in 14 out of the 16 chromosomes. Six pairs (chrs. 2–4, 6–8) have CroSat137 signals in both chromosomes, whereas chrs. 1 and 5 have hemizygous signals. Moreover, signal intensities also varied within a pair. For example, chrs. 4 and 7 have one homolog with a significantly more intense CroSat137 signal than another homolog. The CroSat042 was detected in all chromosomes at subtelomeric, interstitial, and pericentromeric regions. The CroSat144 was detected in eight chromosomes, two homozygous loci (chrs. 6 and 8), and four hemizygous loci (chrs. 3, 5, and 7).

2.3. Taxonomic Treatment—Crocus bachofenii D. Shuka, Raca, and Harpke sp. nov.

2.3.1. Type

Type: —ALBANIA, Central Albania, Tirana district, Linos meadows and Mali me Gropa (ca. 25 km far from Tirana)., i It was found on Festuco-Brometea subalpine pastures and meadows on limestone substrate, 1300–1700 m a.s.l. on 9 May 2019, D. Shuka (holotype GAT-83183! isotypes, TIR-09749! and Shuka herb.—003245 (GAT—Herbarium of Leibniz Institute of Plant Genetics and Crop Plant Research (IPK), Gatersleben, Germany; TIR—National Herbarium of Tirana, Albania; Shuka—Herbarium of Lulëzim and Donald Shuka, Tirana, Albania)).

2.3.2. Description

Early spring species with subglobose to globose corms, 7–13 (10.60 ± 2.77) mm in diameter, covered with three-to-six layers of reticulated and parallel fibres 0.09–0.11 (0.10 ± 0.04) mm thick. Some fibres in the first third of the upper part of the corm are thicker than those appearing in its lower part (Figure 5a). The outer layers of tunics consist of free reticulated fibres, while the inner ones are composed of parallel and/or reticulated fibres that are connected by two different membranes, which are semi-transparent and thicker (Figure S3a,b,c). The neck is indistinct.
Cataphylls (sheathing leaves) were 3–5 (3.60 ± 0.00), white togreenish, with green veins at the apex (Figure 5b). Prophyll was present. The bract was membranous, whitish and transparent, often extended above the perigone throat. Bracteole was absent.
The perigone tube was white-to-whitish underground and violet-to-deep violet aboveground, while the throat was pale lilac and hairy (Figure 5c). The flowers were solitary, rarely in pairs, with perigone segments 30–50 (38.50 ± 1.00) mm long and 10–20 (14.50 ± 1.50) mm wide (the perigone segment dimensions were derived from both outer and inner segments). The perigone segments were oblanceolate, and rarely subobtuse to subacute with faint violet veins, which were more prominent in the inner segments (Figure 5b,c). The outer segments were equal to or slightly longer than the inner ones (Figure 5b,c); the ¾ length of the outer segments overlaps with the inner ones (Figure 5b). The outer segments were lilac-to-violet, rarely pale lilac or deep violet, with the coloration paler compared to one occurring in the inner ones (Figure 5b,c). The basal markings (represented by the intensive coloration) were present, while the apical ones were lacking (Figure 5b).
Filaments were whitish, 10–15 (11.54 ± 1.90) mm long (Figure 5c), and glabrous. Anthers were yellow, 13–18 (15.67 ± 3.00) mm long (Figure 5c) with spherical pollen grains, and 0.07–0.82 (0.08 ± 0.01) mm in diameter (Figure 5d).
Styles were orange in the upper parts and divided into three lobes 25–33 (28.84 ± 4.50) mm long (Figure 5c); stigma sublobes with a length of 0.14–0.35 (0.24 ± 0.01) mm can be noticed as well. The stigma is usually longer for 1.47 ± 2.5 mm (90% of cases), or rarely equal when compared to anthers (Figure 5c).
Capsules were 10–15 (13.40 ± 3.00) mm long, while the seeds were brown and globose-to-obovate, 2.84 × 2.63 mm (Figure 5e).
The leaves were two-to-five (2.84 ± 0.50) in number and 1.50–7.00 (2.93 ± 0.30) mm wide, mostly shorter than flowers. They were rarely longer, green with papillae at the basal corners of the leaves, and each one was composed of one or two cells 0.033–0.07 mm long (Figure 6a,b). The details of the transverse cross-section are illustrated in Figure 6c. Of the total leaf diameter—4740.88 ± 835.32 μm, 1980.60 ± 338.66 μm represents the average arm length, and 792.87 ± 222.83 μm is the white stripe width. The ratio of the leaf diameter compared to the white stripe width is 6.19 ± 1.10, the height of the keel is 776.63 ± 128.69 μm, and the central parenchyma area is 285560.70 ± 114763.65 μm2. The adaxial epidermal layer is about 23.58 ± 4.52 μm thick, with its cells about 20.05 ± 3.14 μm wide. On the other hand, the value of 23.02 ± 3.10 μm represents the height of the abaxial epidermal layer, while the value of 25.22 ± 4.12 μm represents the abaxial cell width. The palisade tissue of the leaf mesophyll (62.73 ± 10.19 μm) is thinner compared to the spongy layer (72.80 ± 23.05 μm). The palisade cell height is 38.43 ± 4.20 μm, and the width is 19.16 ± 1.93 μm. Furthermore, the value of 22.31 ± 4.02 μm refers to the height and 29.33 ± 3.81 μm to the width of the cells of the mesophyll spongy layer. The number of vascular bundles ranges from 17 to 25. The xylem area (1603.18 ± 426.24 μm2) is more prominent when compared to the phloem one (1234.55 ± 289.74 μm2). Sclerenchyma caps are well developed (3118.72 ± 1289.11 μm2).
The closest relative of C. bachofenii is C. vernus from the eastern distribution range according to the chloroplast phylogeny, while the GBS data suggest a close affiliation to the three species from the C. vernus complex (C. vernus, C. neapolitanus, and C. siculus). Morphologically, it resamples more C. neapolitanus, as well as C. bertiscensis and C. tommasinianus (Figures S3a–e and S4a–e), which supports the progeny from an extinct species of the C. heuffelianus, C. tommasinianus, C. bertiscensis, and C. kosaninii clade, in addition to the C. vernus complex. Compared to C. vernus (Figures S3e and S4c), C. bachofenii can be distinguished by bigger flowers, the different coloration of perigone segments, and a stigma longer than anthers or rarely equal to (Table 2, Figure S4c). The new species shares affinities in several morphological characters with C. bertiscensis, excluding the presence of a dark violet heart (or V)-shaped apical mark and short perigone tubes (Table 2 and Figure S4d). Crocus bachofenii differs from C. tommasinianus by the absence of the layers with parallel and thinner fibres of the corm tunics, the white or whitish perigone tubes, smaller perigone segments, and the absence of starry-shaped perigones and longer stigma sublobes (Table 2, Figures S3d and S4e). Crocus neapolitanus can be distinguished from the new species by having tunics with thicker fibers, shorter bract, and stigma sublobes, as well as shorter perigone segments lacking faint violet veins (Table 2, Figure S4b). The Italian allotetraploid C. neglectus (probably C. neapolitanus × C. ilvensis [5]) shares the same chromosome number as C. bachofenii, which is also similar to C. bachofenii but can be distinguished by characters that C. neglectus and C. neapolitanus shared with each other. Crocus neapolitanus and C. neglectus have bigger corms (11.9 mm and 13.9 mm, respectively), wider leaves and fewer cataphylls (2–3), longer perigone tubes, and shorter anthers (11.8 mm and 12.6 mm, respectively) and stigma sublobes (0.06 mm and 0.13 mm, respectively) than C. bachofenii.

2.3.3. Etymology

The new species is named after Professor Reinhard Bachofen, from the Department of Plant and Microbial Biology at the University of Zürich, Switzerland, since the first record of the species refers to field trip investigations of L. Shuka and R. Bachofen in Kunora e Lurës (Lura-Mali i Dejës NP) on 15 April 2013.

2.3.4. Phenology

The flowering time is March–May, depending on the altitude and exposition.

2.3.5. Ecology and Distribution

Crocus bachofenii was only found in Albania and represents the southernmost distribution range of C. ser. Verni that could be confirmed up to now (Figure S5 and Table S2). It is growing in the subalpine calcareous rocky grasslands and meadows, or serpentinous pastures, of Central and Northeastern Albania (Figure S5). The new species prefers xerophilous and mesophilous grassland communities of the Festuco-Brometea class that occur in the alluvial depressions and meadows found in between openings of the beech belt at altitudes of 1300–1700 m a.s.l., which are characterized by a deep layer of soil. The grasslands and meadows of Mali me Gropa, Linos, Livadhet e Ketit, and Qafa e Qershisë (Dajti Mt), according to [13], are represented by Trisetetum flavescens-Plantago media and Anthoxantho-Agrostietum plant communities. In these meadows, C. bachofenii was accompanied by Agrostis capillaris L., Anthoxanthum odoratum L., Barbarea balcana Pančić, Bellis perennis L., Brachypodium sylvaticum (Huds.) P.Beauv., Briza media L., Carex echinata Murray, Carex sp. pl., Colchicum autumnale L., Crepis biennis L., Cynosurus cristatus L., Dactylis glomerata L., Dactylorhiza cordigera (Fr.) Soó, Galanthus reginae-olgae Orph., Galium verum L., Geranium sylvaticum L., Filipendula vulgaris Moench, Muscari botryoides (L.) Mill., Poa pratensis L., Plantago media L., Ranunculus polyanthemos L., Rumex sp., Poterium sanguisorba L., Taraxacum F.H. Wigg. sect. Taraxacum, Trifolium pratense L., Trifolium repens L., Trisetum flavescens (L.) P.Beauv., Veratrum nigrum L., Veronica chamaedrys L., and Viola aetolica Boiss. and Heldr. The xerophytic vegetation of the Festuco-Brometalia class in the Bjeshka e Oroshit, Mali me Gropa, and Zeba Mt localities belongs to the Brometum erecti and Festucetum valesiacae plant communities. The indicator plants in this habitat type are Aristolochia pallida Willd., Asphodelus albus Mill., B. pinnatum (L.) P. Beauv., Bromopsis erectas (Huds.) Fourr., Euphorbia cyparissias L., Festuca valesiaca Schleich. ex Gaudin, Gagea sp., Gymnadenia conopsea (L.) R. Br., Helleborus odorus Waldst. and Kit., Koeleria splendens C.Presl, Leucanthemum vulgare Lam., Lilium albanicum Griseb., Narcissus poeticus L., Orchis mascula (L.) L., O. quadripunctata Cirillo ex Ten., Ornithogalum sp., Pedicularis brachyodonta Schloss. and Vuk., Poa bulbosa L., Plantago lanceolata L., Potentilla sp., Primula veris L., Thymus striatus Vahl., and Viola schariensis Erben etc. Three localities of C. bachofenii in Mali me Gropa, Mali i Murrizës, and Qafa e Qershisë (Dajti Mt) are located within the Bovilla watershed and are strongly indicated by a Mediterranean climate [14]. The only locality reported from ultramafic substrates known so far occurs in Lura-Mali i Dejës National Park.

3. Materials and Methods

3.1. Plant Material

Plant material was initially collected in the framework of our previous study [4] (Table S3). Additional material from Albania was included as well (Table S2). The collection trips were conducted during the flowering time in 2022, 2023, and 2024.

3.2. DNA Extraction

Total genomic DNA was extracted from silica gel-dried leaf tissue with the DNeasy Plant Mini Kit (Qiagen) according to the instructions of the manufacturer. After DNA extraction, the DNA quality and concentration were checked on 1% agarose gels.

3.3. Library Preparation and Sequencing

Genomes of the new species C. bachofenii (one individual), all other C. ser. Verni species (except for C. neapolitanus and C. siculus), and the sister species to C. ser. Verni C. malyi were sequenced at a targeted coverage of 1–5×. Thus, one individual each of C. bertiscensis, C. etrucus, C. ilvensis, C. cf. heuffelianus 2n = 18 BIH, C. cf. heuffelianus 2n = 18 ROU, and C. neglectus; two individuals of C. vernus; three individuals of C. heuffelianus; one individual of C. cf. heuffelianus 2n = 18 SVK; and three individuals of C. cf. heuffelianus (2n = 20 MNE) were sequenced (Table S3). They were either processed by BGI (BGI Tech Solutions Co., Ltd., Shenzhen, China) and sequenced in a DNBseq system (MGI Tech Co., Ltd., Shenzhen, China) using a short-insert library in a 2 × 150 cycle or sequenced in-house. For the latter, library preparation was conducted as described by [15]). One-to-two µg of DNA were fragmented to 400–600 bp using Covaris S220 Focused-ultrasonicator (Covaris, MA, USA). Fragment size distribution and DNA concentration were evaluated on an Agilent BioAnalyzer High-Sensitivity DNA Chip (Agilent Technologies, Santa Clara, CA, USA) using the Qubit DNA Assay Kit in a Qubit 2.0 Fluorometer (Thermo Fisher Scientific, Life Technologies brand, Waltham, MA, USA). Finally, the DNA concentration of the libraries was checked by a quantitative PCR run. Cluster generation on Illumina cBot and paired-end sequencing (2 × 250 bp) on the Illumina NovaSeq6000 platform (SP reagent kit, v1.5 chemistry) followed Illumina’s recommendation and included 1% Illumina PhiX library as internal control (Illumina, San Diego, CA, USA).
For GBS, library preparation was conducted for a newly collected population of C. tommasinianus from Albania, along with three samples of C. siculus, following the protocol outlined in [4].
Barcoded reads were de-multiplexed using the Casava pipeline 1.8 (Illumina). The obtained raw sequencing reads were quality-checked and overrepresented, i.e., clonal reads were detected with FastQC v.0.12.1 [16]. Adapter trimming of sequence reads was performed with Cutadapt v.3.3 [17], and reads shorter than 120 bp after adapter removal for WGS were discarded, or, within the IPYRAD v.0.9.58 [18] pipeline, reads shorter than 80 bp were discarded after adapter removal.

3.4. Assembly of Chloroplast Genomes

GetOrganelle v1.7.7.0 [19] was used to de novo assemble a first draft of the plastid genome. This toolkit implements Bowtie 2 [20] to initially find reads mapping to a plant chloroplast database and SPAdes [21] for de novo assembly and iterative extension. During the assembly and iteration process, Blast+ [22] is used to identify off-target contigs, which are then removed or trimmed. The resulting plastid genome was then used as a reference for mapping the original reads back using Genieous Prime v.2023.2.1 (Biomatters Ltd., Auckland, New Zealand), allowing only for mapping of paired reads mapped nearby with a minimum overlap of 75 bp and a minimum overlap identity of 98%. The result was manually examined and corrected where necessary. Annotation was performed using GeSeq [23] and manually edited in Geneious Prime v.2023.2.1. Plastide sequences were aligned using MAFFT [24]. The alignment was checked and edited manually, if necessary, using Genieous Prime v.2023.2.1.

3.5. Assembly of GBS Data

GBS reads were clustered using the IPYRAD v.0.9.58 [18] pipeline with a clustering threshold of 0.85, according to [4]. In the initial output files generated by IPYRAD, a loci had to be present in 40 out of 210 samples. The resulting vcf file was filtered using vcftools v 0.1.16 [25], removing all indels and keeping only sites with a minor allele frequency of 0.02, a minimum depth of 10, and a maximum depth of 300. For phylogenetic analysis, SNPs were further filtered. To reduce the number of potentially variable but uninformative variants SNP, they needed to be present at least three times in the nine C. bachofenii individuals and must not be present in all species. Furthermore, the dataset only included loci and positions that were present in C. bachofenii. To locate positions in the VCF file that met the specified criteria, the R packages adegenet [26,27], vcfR [28], and genomalicious [29] were used. We then utilised vcftools to create a vcf file including only these positions and create a subset with only one-to-three individuals per population, excluding the C. cf. heuffelianus allotetraploids from Raca et al. [4]. This sample-filtered vcf file was then converted into phylip format using the python script vcf2phylip.py [30] and subjected to phylogenetic analysis.

3.6. Phylogenetic Inference

Bayesian phylogenetic inference (BI) was conducted in MrBayes 3.2.7 [31] for the chloroplasts. Two runs, each with-four chains were run for 1 million generations, specifying the respective model of sequence evolution and defining C. malyi as an outgroup. A tree was sampled every 100 generations. Converging log-likelihoods, potential scale-reduction factors for each parameter, and the inspection of tabulated model parameters in MrBayes suggested that stationary had been reached in all cases. The first 25% of trees of each run were discarded as burn-in.
For the genotyping-by-sequencing data published by Raca et al. [4], one-to-three individuals per population were selected. A newly collected population of C. tommasinianus from Albania was added, along with three samples of C. siculus. Maximum likelihood trees were estimated by IQ-tree v2.2.6 [32,33], applying the TVM + F + G4 model with 1000 bootstrap replications [34]. Modelfinder [35] was used to find the best-fit model for phylogenetic inference by determining the Bayesian information criterion. The resulting trees were used to infer a supernetwork in SplitsTree v4.18.2 [36].

3.7. Origin of Crocus bachofenii

Shared and species-specific alleles (private alleles) were inferred in R using the packages adegenet [26,27], vcfR [28], data.table [37], dplyr [38], tidyr [39], and tibble [40]. The vcf file, including all 210 individuals, was read in and converted into a genpop object. The latter one is a table including the position ID, SNP, and the count for the respective SNP per species. First, private alleles were determined for all species, as well as for the five different C. vernus and C. heuffelianus hybrids: C. cf. heuffelianus 2n = 18 SCC (Southern Carpathian clade), C. cf. heuffelianus 2n = 18 WCC (Western Carpathian clade), C. cf. heuffelianus 2n = 18 PIC (Pannonian–Illyric clade), C. cf. heuffelianus 2n = 20, and C. cf. heuffelianus 2n = 22. To focus on the composition of C. bachofenii, we then excluded all hybrids and the allotetraploid C. neglectus and kept only the diploid species, in addition to C. bachofenii. For this subset of private alleles, alleles shared by C. bachofenii with any of the other species, along with alleles exclusively shared by C. bachofenii with any of the other species (i.e., only present in two species), were counted. The same was done for the C. bachofenii and the three main clades consisting of C. vernus, C. siculus, and C. neapolitanus (cladeI), C. bertiscensis, C. heuffelianus, C. kosaninii, and C. tommasinianus (cladeII), and C. etruscus and C. ilvensis (cladeIII).

3.8. Inference of Clonal Reproduction

The shared heterozygosity (SH) index was calculated to infer the degree of clonal reproduction within C. bachofenii as described by [41]. It is based on the proportion of shared identically heterozygous SNPs of a pair of samples. The SH index was inferred for all samples within one species or allopolyploid lineage and plotted with ggplot2 [42] in R.

3.9. Cytological Analysis

Ten C. bachofenii individuals from Linos, Albania were cultivated in pots at IPK Gatersleben, and root tips were harvested in autumn. Metaphase spreads for FISH analysis were prepared following the methods described in Waminal et al. [43]. We skimmed the genome of C. bachofenii and nine other species in the C. ser. Verni for novel satellite repeats that can be used as cytogenetic markers. We used <1× whole-genome sequence short reads as input to the RepeatExplorer pipeline [44]. We developed oligonucleotide FISH probes for these three repeats by conjugating Cy3 (CroSat137), Cy5 (CroSat042), and FAM/FITC (CroSat144), respectively, at both the 5′ and 3′ ends of the oligonucleotides. In addition, we used the vertebrate-type (TTAGGG) telomeric repeat, which showed abundance in the genus Crocus [12], and the universal FISH probes for 45S rDNA and 5SrDNA (Table 3). The FISH was performed using a rapid method described by Waminal et al. [45].

3.10. Morphological Analysis

The morphological analysis was performed on 50 individuals per population, including the new species C. bachofenii (eight populations) and its morphologically similar relatives: C. vernus (three populations), C. bertiscensis (three populations), and C. tommasinianus (five populations). The data on C. neapolitanus [46] and C. neglectus morphology [5] were taken from the relevant literature source. Detailed information about the populations included in the morphological analysis is provided in Table S2. Quantitative analysis was derived from the measurements of 10 characters (corm width, fibre width, leaf width, perigone tube length, perigone segment length and width, stigma/anther ratio, anther length, stigma lobe, and sublobe length). Three meristic features were analysed as well (number of leaves, number of cataphylls, and number of flowers), while five qualitative characters were checked for their constancy (perigone tube color, outer perigone segment color, position of the stigma, anther color, and stigma color). Images and measurements were taken by a stereomicroscope Leica M205C, Wetzlar, Germany, equipped with Flexacam C3, Wetzlar, Germany and Leica Application Suite X software, Wetzlar, Germany.

3.11. Anatomical Analysis

The slides of the leaf cross-sections of C. bachofenii were made on a manual microtome [47]. The sections of 10 individuals from the type population were double-stained with safranin (1g of dye diluted in 100 mL of 50% ethanol) and alcian blue (1g of dye dissolved in 100 mL of distilled water, with a couple of phenolic crystals and three drops of glacial acetic acid). Stained sections were then dehydrated (series of 50%–70%–96%–100% alcohols), examined, and photographed on a Leica DM 1000 (Leica Microsystem, Wetzlar, Germany) microscope [10,48,49,50]. A total of 20 anatomical features were measured in ImageJ software, Madison, WI, USA [51]; the precise values are expressed in μm and μm2. The characters were related to the leaf blade (section height and width, arm length, white stripe width, section width/white stripe width ratio, and central parenchyma area), epidermal (adaxial epidermal cell height and width; abaxial epidermal cell height and width), mesophyll (palisade cell height and width, palisade tissue height; spongy cell height and width, spongy tissue height), and vascular tissue (number of vascular bundles, xylem, phloem, and sclerenchyma cap area surface).

4. Discussion

Since its taxonomic status was unclear at that point, we previously [4] referred to C. bachofenii as C. cf. vernus. The findings from this study indicated that C. bachofenii is a tetraploid involving C. vernus from the eastern distribution range in its origin. Phylogenetic trees based on GBS consistently grouped C. bachofenii as sister to C. vernus, C. neapolitanus, and C. siculus. Various methods, including GBS and phylogenetic markers, as reported by [4], did not indicate contributions from any lineage outside the C. vernus clade. The only indication for a contribution outside the C. vernus clade is the decreasing support value for the clade comprising C. bertiscensis, C. heuffelianus, C. kosaninii, and C. tommasinianus as soon as C. bachofenii is included. This led [4] to the hypothesis that C. bachofenii is likely an allotetraploid of C. vernus and an extinct parent, closely related to C. vernus and its two closest allies C. siculus and C. neapolitanus. Our investigations involving complete chloroplast sequences (instead of just a little part of it) confirmed the maternal contribution from eastern C. vernus.
Following a very conservative approach, we then checked with which species precisely C. bachofenii is sharing alleles. It is evident that the highest proportion of shared alleles is found in the C. vernus clade, including C. siculus and C. neapolitanus (Clade I), as well as in the clade comprising C. heuffelianus, C. tommasinianus, C. bertiscensis, and C. kosaninii (Clade II) (Table 1).
Propagation of C. bachofenii is mainly sexual, as indicated by the shared heterozygosity, which falls below the threshold of 0.9 (Figure 3). Shared heterozygosity above 0.9 typically characterises clonally propagated individuals [41]. The predominant sexual propagation of the tetraploid C. bachofenii indicates genetic divergence between parental subgenomes. This subgenome difference implies stable meiosis indicative of allopolyploidy. For autopolyploids, we would expect lower heterozygosity, indicating subgenome homogeneity and more problematic chromosome pairing. Moreover, the disomic pairing of chromosomes observed in the C. bachofenii karyotype also supports its allopolyploid origin. Nevertheless, definitive cytogenomic evidence of allopolyploidy could be obtained through genomic in situ hybridization using parental genomes as probes [52], or using comparative repeat profiles from chromosome-level whole-genome assemblies [53]. Numerous hemizygous repeat loci indicate chromosomal rearrangements, which may have existed in the parental genomes, since C. vernus exhibits heteromorphic karyotypes across different populations [12,54] or may be novel following allopolyploidization of C. bachofenii.
The new species, C. bachofenii, shares the same chromosome number (2n = 16; [4]) with C. tommasinianus and C. neglectus (2n = 16; [54]), differing from C. bertiscensis and C. vernus (2n = 12, [10] and 2n = 8 [54], respectively).
The distribution range, habitats, and/or elevation of C. bachofenii differ from all other C. ser. Verni species. Crocus bachofenii thrives in the clearings of beech forests, rocky pastures, or meadows, while C. bertiscensis inhabits the alpine pastures and meadows above 1700 m a.s.l., in siliceous substrate [10,55,56]. Crocus vernus can be found in calcareous pastures within the beech belt, as well as C. bachofenii. However, its distribution range is shifted to the north of the Albanian Alps (1200–1700 m a.s.l.), sharing its habitat altitudinally with C. bertiscensis in this region [9,10,56]. Geographically, the closest locality of C. bachofeni is about 65 km away from the closest locality of C. vernus and 73 km away from the closest locality of C. bertiscensis. Of the species of C. ser. Verni, only C. tommasinianus is located ca. 3.5 km away from the closest locality of C. bachofenii. However, C. bachofenii is growing above (1300–1700 m a.s.l.) the distribution range of C. tommasinianus (300–1000 m a.s.l.). An occurrence at a higher elevation [11] was reported for C. tommasinianus in Albania based on a specimen (nr. 4715) collected from Kunora e Lurës on 2 August 1959. However, the species’ typical habitat at lower elevations casts doubt on its occurrence in the high-altitude of Lura Mt. Specimens collected later on 15 April 2013, by L. Shuka and R. Bachofen, and again on 13 April 2024, by D. Shuka in this area underwent detailed morpho-anatomical and genetic examinations. These studies identified the specimens as C. bachofenii, contradicting Meyer’s [11] report. Consequently, the localities in Figure S5 represent the first confirmed record of C. tommasinianus occurrence in Albania.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants14050741/s1, Figure S1: Comparative repeat quantification in C. ser. Verni as generated by RepeatExplorer. Satellite repeats that were used as FISH probes are noted; Figure S2: Distribution of six DNA repeats in C. bachofenii root metaphase chromosomes. This image was used to generate the karyogram presented in Figure 4. (A) 45S rDNA, (B) 5S rDNA, (C) vertebrate-type (TTAGGG) telomeric repeat, (D) CroSat137, (E) CroSat042, and (F) CroSat144. Bar = 10 µm; Figure S3: The corms and tunic details of C. bachofenii: fibres connected with thin (semitransparent) (a,b) and thicker membranes (c), C. tommasinianus (d), and C. vernus (e); Figure S4: The comparative herba collage of C. bachofenii (a) and its relatives: C. neapolitanus (b), C. vernus (c), C. bertiscensis (d), and C. tommasinianus (e); Figure S5: The distribution map of the species of C. ser. Verni in Albania; Table S1: Private alleles; Table S2: Information on the populations of various species in C. ser. Verni included in the morphological analysis; Table S3: Information about the individuals of C. ser. Verni that underwent genotyping-by-sequencing (GBS).

Author Contributions

Conceptualization, D.H., L.S. and I.R.; methodology, all authors; software, D.H.; validation, all authors; formal analysis, all authors; investigation, all authors; resources, all authors; data curation, D.H.; writing—original draft preparation, I.R. and D.H.; writing—review and editing, all authors; visualization, all authors; supervision, D.H.; project administration, all authors; funding acquisition, D.H., I.R., D.S. and L.S. All authors have read and agreed to the published version of the manuscript.

Funding

The research costs were covered by the grants of the Ministry of Science, Technological Development, and Innovations of the Republic of Serbia (contract numbers: 451-03-66/2024-03/200124 and 451-03-136/2025-03/200124) to I.R., Deutscher Akademischer Austauschdienst (DAAD) to I.R., International Association for Plant Taxonomy (IAPT) to I.R., Deutsche Forschungsgemeinschaft (DFG grant HA 7550/2 and HA 7550/4) to D.H, and National Agency for Scientific Research and Innovation (AKKSHI) to D.S. and L.S.

Data Availability Statement

All data are available within the article and its Supplementary Materials.

Acknowledgments

We are grateful to I. Faustmann, C. Koch, B. Kraenzlin, and P. Oswald for their lab assistance and plant cultivation; A. Himmelbach and S. König for Illumina sequencing; and L. Peruzzi, H. Kerndorff, K. Hegedüšová, P. Vantara, T. Huber, S. Milanović, M. Slovák, N. Sarajlić, B. Štulović, M. Mihajlović, and D. Jakšić for providing Crocus materials for molecular and phylogenetic analysis and/or assistance during fieldwork. We are also thankful to the authorities of the Ministry of Tourism and Environment, Albania for supporting our work with a collection permit.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Doyle, J.J.; Sherman-Broyles, S. Double trouble: Taxonomy and definitions of polyploidy. New Phytol. 2017, 213, 487–493. [Google Scholar] [CrossRef] [PubMed]
  2. Żabicka, J.; Kirschey, T.; Migdałek, G.; Słomka, A.; Kuta, E. Genetic variation versus morphological variability in European peatland violets (Viola epipsila—V. palustris group). Biology 2023, 12, 362. [Google Scholar] [CrossRef] [PubMed]
  3. Edger, P.P.; McKain, M.R.; Bird, K.A.; Vanburen, R. Subgenome assignment in allopolyploids: Challenges and future directions. Curr. Opin. Plant Biol. 2018, 42, 76–80. [Google Scholar] [CrossRef]
  4. Raca, I.; Blattner, F.R.; Waminal, N.E.; Kerndorff, H.; Ranđelović, V.; Harpke, D. Disentangling Crocus series Verni and its polyploids. Biology 2023, 12, 303. [Google Scholar] [CrossRef]
  5. Harpke, D.; Carta, A.; Tomović, G.; Ranđelović, V.; Ranđelović, N.; Blattner, F.R.; Peruzzi, L. Phylogeny, karyotype evolution and taxonomy of Crocus series Verni (Iridaceae). Plant Syst. Evol. 2015, 301, 309–325. [Google Scholar] [CrossRef]
  6. Elshire, R.J.; Glaubitz, J.C.; Sun, Q.; Poland, J.A.; Kawamoto, K.; Buckler, E.S.; Mitchell, S.E. A robust, simple genotyping-by-sequencing (GBS) approach for high diversity species. PLoS ONE 2011, 6, e19379. [Google Scholar] [CrossRef] [PubMed]
  7. Le Comber, S.C.; Ainouche, M.L.; Kovarik, A.; Leitch, A.R. Making a functional diploid: From polysomic to disomic inheritance. New Phytol. 2010, 186, 113–122. [Google Scholar] [CrossRef]
  8. Lv, Z.; Addo Nyarko, C.; Ramtekey, V.; Behn, H.; Mason, A.S. Defining autopolyploidy: Cytology, genetics, and taxonomy. Am. J. Bot. 2024, 111, e16292. [Google Scholar] [CrossRef]
  9. Shuka, L.; Zekaj, Z.; Mullaj, A. Biogeographical records of species of the genus Crocus L. in Albania. In Proceedings of the 5th Balkan Botanical Congress, Belgrade, Serbia, 7–11 September 2009; pp. 52–53. [Google Scholar]
  10. Raca, I.; Harpke, D.; Shuka, L.; Ranđelović, V. A new species of Crocus ser. Verni (Iridaceae) with 2n = 12 chromosomes from the Balkans. Plant Biosyst.-Int. J. Deal. All Asp. Plant Biol. 2022, 156, 36–42. [Google Scholar] [CrossRef]
  11. Meyer, F.K. Beitrage zur Flora von Albanien; The Thuringian Botanical: Jena, Germany, 2011. [Google Scholar]
  12. Waminal, N.E.; Blattner, F.; Harpke, D. The Crocus panrepeatome reveals the links between whole-genome duplications, repeat bursts, and descending dysploidy. Res. Sq. 2024. [Google Scholar] [CrossRef]
  13. Buzo, K. Bimësia e Kullotave dhe e Livadheve Natyrore të Shqiperisë; Publishing House of the Universities Books: Tirana, Albania, 1991. [Google Scholar]
  14. Shuka, L.; Çullaj, A.; Shumka, S.; Miho, A.; Duka, S.; Bachofen, R. The spatial and temporal variability of limnological properties of Bovilla Reservoir (Albania). Water Resour. Manag. 2011, 25, 3027–3039. [Google Scholar] [CrossRef]
  15. Meyer, M.; Kircher, M. Illumina sequencing library preparation for highly multiplexed target capture and sequencing. Cold Spring Harb. Protoc. 2010, 2010, pdb.prot5448. [Google Scholar] [CrossRef]
  16. Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data. 2010. Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 24 February 2025).
  17. Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.J. 2011, 17, 10. [Google Scholar] [CrossRef]
  18. Eaton, D.A.R.; Overcast, I. ipyrad: Interactive assembly and analysis of RADseq datasets. Bioinformatics 2020, 36, 2592–2594. [Google Scholar] [CrossRef] [PubMed]
  19. Jin, J.-J.; Yu, W.-B.; Yang, J.-B.; Song, Y.; Depamphilis, C.W.; Yi, T.-S.; Li, D.-Z. GetOrganelle: A fast and versatile toolkit for accurate de novo assembly of organelle genomes. Genome Biol. 2020, 21, 241. [Google Scholar] [CrossRef] [PubMed]
  20. Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [PubMed]
  21. Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef] [PubMed]
  22. Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST+: Architecture and applications. BMC Bioinform. 2009, 10, 421. [Google Scholar] [CrossRef]
  23. Tillich, M.; Lehwark, P.; Pellizzer, T.; Ulbricht-Jones, E.S.; Fischer, A.; Bock, R.; Greiner, S. GeSeq—Versatile and accurate annotation of organelle genomes. Nucleic Acids Res. 2017, 45, W6–W11. [Google Scholar] [CrossRef]
  24. Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
  25. Danecek, P.; Auton, A.; Abecasis, G.; Albers, C.A.; Banks, E.; Depristo, M.A.; Handsaker, R.E.; Lunter, G.; Marth, G.T.; Sherry, S.T.; et al. The variant call format and VCFtools. Bioinformatics 2011, 27, 2156–2158. [Google Scholar] [CrossRef]
  26. Jombart, T.; Ahmed, I. adegenet 1.3-1: New tools for the analysis of genome-wide SNP data. Bioinformatics 2011, 27, 3070–3071. [Google Scholar] [CrossRef]
  27. Jombart, T. adegenet: A R package for the multivariate analysis of genetic markers. Bioinformatics 2008, 24, 1403–1405. [Google Scholar] [CrossRef] [PubMed]
  28. Knaus, B.J.; Grünwald, N.J. VCFR: A package to manipulate and visualize variant call format data in R. Mol. Ecol. Resour. 2017, 17, 44–53. [Google Scholar] [CrossRef] [PubMed]
  29. Thia, J.A. genomalicious: Serving up a smorgasbord of R functions for performing and teaching population genomic analyses. BioRxiv 2019. [Google Scholar] [CrossRef]
  30. Ortiz, E.M. vcf2phylip v2.0: Convert a VCF Matrix into Several Matrix Formats for Phylogenetic Analysis. 2019. Available online: https://zenodo.org/records/2540861 (accessed on 24 February 2025).
  31. Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [PubMed]
  32. Nguyen, L.-T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2014, 32, 268–274. [Google Scholar] [CrossRef]
  33. Minh, B.Q.; Schmidt, H.A.; Chernomor, O.; Schrempf, D.; Woodhams, M.D.; von Haeseler, A.; Lanfear, R. IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Mol. Biol. Evol. 2020, 37, 1530–1534. [Google Scholar] [CrossRef]
  34. Hoang, D.T.; Chernomor, O.; von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: Improving the ultrafast bootstrap approximation. Mol. Biol. Evol. 2017, 35, 518–522. [Google Scholar] [CrossRef]
  35. Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef]
  36. Huson, D.H.; Bryant, D. Application of phylogenetic networks in evolutionary studies. Mol. Biol. Evol. 2006, 23, 254–267. [Google Scholar] [CrossRef]
  37. Barrett, T.; Dowle, M.; Srinivasan, A.; Gorecki, J.; Chirico, M.; Hocking, T.; Schwendinger, B.; Krylov, I. data.table: Extension of ‘data.frame’, R Package Version 1.15.99. 2024. Available online: https://Rdatatable.gitlab.io/data.table (accessed on 24 February 2025).
  38. Wickham, H.; François, R.; Henry, L.; Müller, K.; Vaughan, D. dplyr: A Grammar of Data Manipulation, R Package Version 1.1.4. 2023. Available online: https://github.com/tidyverse/dplyr (accessed on 24 February 2025).
  39. Wickham, H.; Vaughan, D.; Girlich, M. tidyr: Tidy Messy Data, R Package Version 1.3.1. 2024. Available online: https://tidyr.tidyverse.org (accessed on 24 February 2025).
  40. Müller, K.; Wickham, H. tibble: Simple Data Frames. 2023. Available online: https://tibble.tidyverse.org/ (accessed on 24 February 2025).
  41. Yu, L.; Stachowicz, J.J.; Dubois, K.; Reusch, T.B.H. Detecting clonemate pairs in multicellular diploid clonal species based on a shared heterozygosity index. Mol. Ecol. Resour. 2023, 23, 592–600. [Google Scholar] [CrossRef]
  42. Wickham, H. ggplot2: Elegant Graphics for Data Analysis; Springer: New York, NY, USA, 2016; pp. 1–189. [Google Scholar]
  43. Waminal, N.E.; Pellerin, R.J.; Kang, S.-H.; Kim, H.H. Chromosomal mapping of tandem repeats revealed massive chromosomal rearrangements and insights into Senna tora dysploidy. Front. Plant Sci. 2021, 12, 629898. [Google Scholar] [CrossRef] [PubMed]
  44. Novák, P.; Neumann, P.; Macas, J. Global analysis of repetitive DNA from unassembled sequence reads using RepeatExplorer2. Nat. Protoc. 2020, 15, 3745–3776. [Google Scholar] [CrossRef] [PubMed]
  45. Waminal, N.E.; Pellerin, R.J.; Kim, N.-S.; Jayakodi, M.; Park, J.Y.; Yang, T.-J.; Kim, H.H. Rapid and efficient FISH using pre-labeled oligomer probes. Sci. Rep. 2018, 8, 8224. [Google Scholar] [CrossRef] [PubMed]
  46. Milović, M. Rod Crocus L. (Iridaceae) u flori Hrvatske. J. Croat. Bot. Soc. 2016, 4, 4–20. [Google Scholar]
  47. Gligorijević, S.; Pejčinović, D. Contribution to the methodology of anatomical sections preparation. Acta Biol. Et Med. Exp. 1983, 8, 43–45. [Google Scholar]
  48. Raca, I.; Ljubisavljević, I.; Jušković, M.; Ranđelović, N.; Ranđelović, V. Comparative anatomical study of the taxa from series Verni Mathew (Crocus L.) in Serbia. Biol. Nyssana 2017, 8, 15–22. [Google Scholar]
  49. Raca, I.; Jovanovic, M.; Ljubisavljevic, I.; Juskovic, M.; Randelovic, V. Morphological and leaf anatomical variability of Crocus cf. heuffelianus Herb.(Iridaceae) populations from the different habitats of the Balkan Peninsula. Turk. J. Bot. 2019, 43, 645–658. [Google Scholar] [CrossRef]
  50. Raca, I. Taxonomy and Phylogeny of Series Verni Mathew (Crocus L.) in Southeastern Europe—Morpho-Anatomical, Cytological and Molecular Approach. Ph.D. Thesis, University of Nis, Niš, Serbia, 2021. [Google Scholar]
  51. Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef]
  52. Keller, E.R.J.; Schubert, I.; Fuchs, J.; Meister, A.J.T.; Genetics, A. Interspecific crosses of onion with distant Allium species and characterization of the presumed hybrids by means of flow cytometry, karyotype analysis and genomic in situ hybridization. Theor. Appl. Genet. 1996, 92, 417–424. [Google Scholar] [CrossRef]
  53. Session, A.M.; Rokhsar, D.S. Transposon signatures of allopolyploid genome evolution. Nat. Commun. 2023, 14, 3180. [Google Scholar] [CrossRef] [PubMed]
  54. Brighton, C.A. Cytological problems in the genus Crocus (Iridaceae): I. Crocus vernus aggregate. Kew Bull. 1976, 31, 33. [Google Scholar] [CrossRef]
  55. Shuka, D.; Tan, K.; Hallaçi, B.; Shuka, L. Additions to the flora of North Albania. Phytol. Balc. 2020, 26, 517–522. [Google Scholar]
  56. Shumka, S.; Shumka, L.; Špoljar, M.; Shuka, L. Evidence of climate change and the conservation needed to halt the further deterioration of small glacial lakes. Climate 2024, 12, 124. [Google Scholar] [CrossRef]
Plants 14 00741 g001
Figure 1. The phylogenetic tree was constructed using Bayesian inference implemented in MrBayes 3.2.7 based on whole chloroplast genome data. Posterior probabilities, representing the statistical confidence of each node, are indicated at each branching point. Each species is labeled with the DNA extraction ID preceding the species name, followed by the country ISO code for the sample origin, ploidy level, and chromosome number.
Figure 1. The phylogenetic tree was constructed using Bayesian inference implemented in MrBayes 3.2.7 based on whole chloroplast genome data. Posterior probabilities, representing the statistical confidence of each node, are indicated at each branching point. Each species is labeled with the DNA extraction ID preceding the species name, followed by the country ISO code for the sample origin, ploidy level, and chromosome number.
Plants 14 00741 g001
Plants 14 00741 g002
Figure 2. SuperNetwork generated in SplitsTree 4.18.2 shows gene tree incongruence based on 500 maximum likelihood trees estimated by IQ-tree v2.2.6 using SNP data (74 sequences, 19,435 SNPs, 10,831 parsimony informative sites).
Figure 2. SuperNetwork generated in SplitsTree 4.18.2 shows gene tree incongruence based on 500 maximum likelihood trees estimated by IQ-tree v2.2.6 using SNP data (74 sequences, 19,435 SNPs, 10,831 parsimony informative sites).
Plants 14 00741 g002
Plants 14 00741 g003
Figure 3. Heterozygosity point plot based on all intraspecific sample pairs. Each data point represents one pair of samples. The sample pairs of each species and the different C. cf. heuffelianus allotetraploids, respectively, are indicated by different colours. For tetraploids C. cf. heuffelianus with 2n = 4x = 18, the geographic affiliation is also provided, as Pannonian–Illyric Clade (PIC), Southern Carpathian Clade (SCC), and Western Carpathian Clade (WCC). The pink line indicates the threshold of 90% to clone pairs from none-clone pairs.
Figure 3. Heterozygosity point plot based on all intraspecific sample pairs. Each data point represents one pair of samples. The sample pairs of each species and the different C. cf. heuffelianus allotetraploids, respectively, are indicated by different colours. For tetraploids C. cf. heuffelianus with 2n = 4x = 18, the geographic affiliation is also provided, as Pannonian–Illyric Clade (PIC), Southern Carpathian Clade (SCC), and Western Carpathian Clade (WCC). The pink line indicates the threshold of 90% to clone pairs from none-clone pairs.
Plants 14 00741 g003
Plants 14 00741 g004
Figure 4. FISH karyogram of C. bachofenii using six cytogenetic markers. Note the hemizygous distribution of 5S rDNA at the long arm of chromosome 3, CroSat137 in chromosomes 1 and 5, and CroSat144 in chromosomes 3, 5, and 7. Bar = 10 µm.
Figure 4. FISH karyogram of C. bachofenii using six cytogenetic markers. Note the hemizygous distribution of 5S rDNA at the long arm of chromosome 3, CroSat137 in chromosomes 1 and 5, and CroSat144 in chromosomes 3, 5, and 7. Bar = 10 µm.
Plants 14 00741 g004
Plants 14 00741 g005
Figure 5. The morphology of C. bachofenii generative organs: (a) corm details; (b) the flower and habitus; (c) the hairy throat and ratio between anthers and stigma; (d) pollen grains; (e) the capsule with seeds.
Figure 5. The morphology of C. bachofenii generative organs: (a) corm details; (b) the flower and habitus; (c) the hairy throat and ratio between anthers and stigma; (d) pollen grains; (e) the capsule with seeds.
Plants 14 00741 g005
Plants 14 00741 g006
Figure 6. Leaves of C. bachofenii: (a) abaxial side appearance; (b) abaxial papillae detail; (c) transverse cross-section.
Figure 6. Leaves of C. bachofenii: (a) abaxial side appearance; (b) abaxial papillae detail; (c) transverse cross-section.
Plants 14 00741 g006
Table 1. Alleles shared with C. bachofenii.
Table 1. Alleles shared with C. bachofenii.
SpeciesNo. of Shared Alleles No. of Exclusively Shared Alleles
C. vernus (32)25,851(84.77%)1777(5.83%)
C. heuffelianus (18)21,187(69.47%)550(1.80%)
C. tommasinianus (29)18,412(60.38%)289(0.95%)
C. bertiscensis (7)15,078(49.44%)155(0.51%)
C. neapolitanus (2)13,391(43.91%)66(0.22%)
C. siculus (4)11,193(36.70%)39(0.13%)
C. kosaninii (3)10,328(33.87%)85(0.28%)
C. etruscus (2)9247(30.32%)18(0.06%)
C. ilvensis (2)8695(28.51%)4(0.01%)
C. longiflorus (1)3829(12.56%)47(0.15%)
CladesNo. of shared allelesNo. of exclusively shared alleles
CladeI: C. vernus—C. neapolitanus—C. siculus (38)26,483(86.84%)3276(10.74%)
CladeII: C. heuffelianus—C. bertiscensis—C. tommasinianus—C. kosaninii (57)26,671(87.46%)2690(8.82%)
CladeIII: C. etruscus—C. ilvensis (4)10,909(35.77%)70(0.23%)
CladeI + CladeII30,378(99.61%)17,482(57.33%)
Number of samples is provided in parenthesis.
Table 2. Morphological comparison of C. bachofenii with C. vernus, C. bertiscensis, C. tommasinianus, C. neapolitanus, and C. neglectus.
Table 2. Morphological comparison of C. bachofenii with C. vernus, C. bertiscensis, C. tommasinianus, C. neapolitanus, and C. neglectus.
C. bachofeniiC. vernusC. bertiscensisC. tommasinianusC. neapolitanusC. neglectus
Corm width (mm)10.60 ± 2.7712.80 ± 2.706.80 ± 0.8010.40 ± 1.7011–1313.9 ± 1.9
Fibre width (mm)0.10 ± 0.040.08 ± 0.030.08 ± 0.030.11 ± 0.020.06–0.020.10 ± 0.02
Number of leaves2–5, usually 32–4, usually 31–3, usually 22–5, usually 32–4, usually 3–
Leaf width (mm)2.93 ± 0.301.83 ± 0.503.20 ± 0.501.76 ± 0.90(2–) 4–8–
Number of cataphylls3–5, usually 43–4, usually 32–4, usually 33–4, usually 32–3–
Perigone tube length (mm)44.30 ± 7.5043.60 ± 10.6033.10 ± 5.9062.30 ± 10.60)40–10060.7 ± 21.9
Perigone tube colorDeep violet-to-violetLilac or whiteLilac or deep purpleWhite or whitishLilac in upper partConcolor
Number of flowers1, rarely 21, rarely 211, rarely 21 (–2)1 (–2)
Perigone segment length (mm)38.50 ± 1.0021.90 ± 0.5027.22 ± 3.1426.7 ± 2.0025–5534.8 ± 4.7
Perigone segment width (mm)14.50 ± 1.506.40 ± 1.008.88 ± 1.2511.27 ± 1.509–20–
Outer perigone segment colorLilac-to-deep lilac at the base and lilac-to-violet aboveWhite, white with lilac stripes, or completely lilacLilac at the base, with a dark violet heart- or V-shaped patch at the apex of perigone segmentsPale lilac-to-lilacPurple-to-deep purpleLilac, rarely white
Position of the stigmaLonger than anthers (rarely equal to)Shorter than anthersEqual to or longer than anthers (rarely shorter)Equal to or longer than anthers (rarely shorter)Equal to or longer than anthersLonger than anthers (rarely equal to)
Stigma/anther ratio (mm)1.47 ± 2.50−8.40 ± 3.901.11 ± 3.801.20 ± 2.301.10 ± 3.903.7 ± 2.1
Anther length (mm)15.67 ± 3.009.30 ± 1.608.13 ± 1.1110.40 ± 1.5011.80 ± 0.2912.6 ± 1.7
Anther color (mm)Yellow-to-orangeYellowYellowYellowYellowYellow
Stigma lobes length (mm)2.34 ± 0.531.38 ± 0.751.62 ± 0.551.00 ± 0.09––
Stigma sublobes length (mm)Incised for 0.24 ± 0.01Incised for 0.23 ± 0.22Incised for 0.31 ± 0.30Incised for 0.90 ± 0.32Incised for 0.06 ± 0.02Incised for 0.13 ± 0.08
Stigma colorOrange (rarely yellow)OrangeOrangeOrangeOrangeOrange
Measurements are expressed through the Mean ± StDev, or Min–Max values.
Table 3. List of oligonucleotide FISH probes used in this study.
Table 3. List of oligonucleotide FISH probes used in this study.
NameLength (bp)Sequence5′ Modification3′ ModificationReference
CroSat137a30RAGCTGCTTAGAGTGCTATAGRAATGCAACCy3Cy3This study
Crosat137b30GCTTSGATCAAACTGGGCYAAGATGCTCCCCy3Cy3This study
CroSat042a30CATGACTTGTAAAAACRGAGTYTTGCAAGCCy5Cy5This study
CroSat042b30GAAGATATCTACTCAAATCACACTAAAATACy5Cy5This study
CroSat144a30TCTCCCGGAAACTCGTTTCGAGGCCTACCTFAMFITCThis study
CroSat144b30CATCGCGGACGGTTTCGGTCGTTACGTTGAFAMFITCThis study
TTAGGG29TTAGGGTTAGGGTTAGGGTTAGGGTTAGGCy3Cy3This study
18SrDNA_UniOP_128CCGGAGAGGGAGCCTGAGAAACGGCTACCy5Cy5Waminal et al. (2018) [45]
18SrDNA_UniOP_226ATCCAAGGAAGGCAGCAGGCGCGCAACy5Cy5Waminal et al. (2018) [45]
18SrDNA_UniOP_328GGGCAAGTCTGGTGCCAGCAGCCGCGGTCy5Cy5Waminal et al. (2018) [45]
18SrDNA_UniOP_427TCGAAGACGATYAGATACCGTCSTAGTCy5Cy5Waminal et al. (2018) [45]
5SrDNA_UniOP_130GGGTGCGATCATACCAGCACTAGAGCACCGFAMFITCWaminal et al. (2018) [45]
5SrDNA_UniOP_229CCCATCAGAACTCCGAAGTTAAGCGTGCTFAMFITCWaminal et al. (2018) [45]
5SrDNA_UniOP_324GCGAGAGTAGTACTAGGATGGGTGFAMFITCWaminal et al. (2018) [45]
5SrDNA_UniOP_426CCTGGGAAGTMCTCGTGTTGCAYYCCFAMFITCWaminal et al. (2018) [45]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Raca, I.; Shuka, D.; Shuka, L.; Waminal, N.E.; Harpke, D. An Integrative Systematic Approach Reveals a New Species of Crocus Series Verni (Iridaceae) Endemic to Albania. Plants 2025, 14, 741. https://doi.org/10.3390/plants14050741

AMA Style

Raca I, Shuka D, Shuka L, Waminal NE, Harpke D. An Integrative Systematic Approach Reveals a New Species of Crocus Series Verni (Iridaceae) Endemic to Albania. Plants. 2025; 14(5):741. https://doi.org/10.3390/plants14050741

Chicago/Turabian Style

Raca, Irena, Donald Shuka, Lulëzim Shuka, Nomar Espinosa Waminal, and Dörte Harpke. 2025. "An Integrative Systematic Approach Reveals a New Species of Crocus Series Verni (Iridaceae) Endemic to Albania" Plants 14, no. 5: 741. https://doi.org/10.3390/plants14050741

APA Style

Raca, I., Shuka, D., Shuka, L., Waminal, N. E., & Harpke, D. (2025). An Integrative Systematic Approach Reveals a New Species of Crocus Series Verni (Iridaceae) Endemic to Albania. Plants, 14(5), 741. https://doi.org/10.3390/plants14050741

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop