Resistance Spectrum Analysis and Breeding Utilization of Rice Blast Resistance Gene Pigm-1
by
and
Yidan Jin
1,2, 
Niqing He
1,
Zhaoping Cheng
1,
Shaojun Lin
1,
Fenghuang Huang
1,
Wenxiao Wang
1,2,
Qingshun Q. Li
1,3 and
Dewei Yang
1,* 1
Institute of Rice, Fujian Academy of Agricultural Sciences, Fuzhou 350018, China
2
College of Agriculture, Fujian Agriculture and Forestry University, Fuzhou 350002, China
3
Biomedical Sciences, College of Dental Medicine, Western University of Health Sciences, Pomona, CA 91766, USA
*
Author to whom correspondence should be addressed.
Plants 2025, 14(4), 535; https://doi.org/10.3390/plants14040535
Submission received: 10 December 2024
/
Revised: 30 January 2025
/
Accepted: 7 February 2025
/
Published: 10 February 2025
(This article belongs to the Special Issue Crop Functional Genomics and Biological Breeding)
Abstract
:Rice blast is one of the most important diseases of rice, causing significant economic losses to agricultural production. A new gene, Pigm-1, which is allelic to Pigm, was cloned from Shuangkang 77009 using map based cloning. However, it is unclear whether there is a difference in the resistance spectrum between Pigm and Pigm-1. In this study, using 195 rice blast isolates collected from different areas of the Fujian Province, the Pigm-1 and Pigm single gene lines were inoculated to test their resistance. There was only one blast fungus JL-37 that showed a differential response in Pigm and Pigm-1 single gene lines, while the remaining 194 showed no difference. To further explore the application range of Pigm-1, the resistant rice R20-4 containing Pigm-1 was used as the donor, and a sensitive sticky rice S19-118 was used as the receptor. The hybrid F1 was first backcrossed with S19-118 using a molecular marker-assisted selection breeding method, and a strain containing the Pigm-1 gene was selected to continue to backcross with S19-118 until BC3F1. A new blast resistance rice material, Xiannuo 23, containing Pigm-1 was developed and confirmed by laboratory and field tests. This material can be broadly used for the future breeding of rice blast resistant cultivars to reduce the loss of rice production.
1. Introduction
Rice (Oryza sativa) is one of the most important food crops in the world, with about half of the world’s population using it as their staple food [1]. Rice blast is a worldwide disease caused by Magnaporthe oryzae [2], which can cause at least 10% yield loss of rice every year. In severe cases, the yield reduction in rice can be as high as 40% to 50%, or even total loss [3,4]. At present, the main method of rice blast control is chemical application, but excessive use of chemical agents has caused serious damage to the environment [5,6]. Under normal circumstances, new varieties that are resistant to rice blast will gradually lose resistance after 3 to 5 years of field production, mainly due to the narrow spectrum of resistance genes carried by cultivars. The physiological variants of rice blast have strong variability, leading to rapid disease development under suitable environmental conditions [7]. Rice blast resistance breeding is still the most effective and equitable means to limit the losses in rice production [8]. Therefore, it is of great significance to explore more blast resistance genes and analyze their resistance spectra, so as to create new resistant cultivars for ensuring food security [9].
So far, over 100 rice blast resistance loci have been genetically characterized, and more than 50 blast resistance genes have been identified [5,8]. These genes are distributed on different chromosomes of rice. At present, several major genes such as Pi2, Pi9 (Pi9-type-3/4/5/6/9/10/11), Piz-t (Pizh) and Pigm (Pi50) have been cloned at the Piz locus on chromosome 6 of rice [10,11,12]. Using molecular marker-assisted selection, the resistant rice varieties can be produced by introducing the broad-spectrum blast resistance genes into susceptible genotypes [13]. Different alleles of the blast resistance gene at one locus have different species-specific spectra [8]. For example, seven alleles with different resistance profiles were identified at Pik resistance sites [14,15]. Therefore, it is particularly important to explore and isolate more resistance genes and their alleles. Previously, our research team cloned a broad-spectrum blast resistance gene Pigm-1 from the disease-resistant resource material Shuangkang 77009 by map based cloning. This gene is a new allele of Pigm, which is different from PigmR by 3 bases [16]. In recent years, through molecular breeding, researchers have created a series of new restorer line materials containing Pigm and its allele Pigm-1 [16,17,18].
Pigm-1 and Pigm are alleles and differ from each other by only a few bases. It is not clear whether their resistance spectra are different. On the other hand, although we have used Pigm-1 to create a series of new disease-resistant materials, there are few reports on the creation of new special rice materials containing Pigm-1. In this study, different blast fungi were isolated from Shanghang County, Jianyang County and Jiangle County, Fujian Province, and inoculated with Pigm-1 and Pigm single gene lines in order to find the resistance spectrum of these resistance genes. At the same time, to further explore the application range of Pigm-1, this study created a new disease-resistant glutinous rice material containing Pigm-1 through molecular breeding methods, and provided excellent disease-resistant new materials for specialty rice breeding.
2. Results
2.1. Creation of Single Gene Lines Containing Pigm-1 and Pigm
To obtain Pigm-1 and Pigm single gene lines, the parent Shuangkang 77009 containing Pigm-1 and the parent Digu B containing Pigm were used as the donors, and 9311 as the acceptor. The F1 plants were generated from Shuangkang 77009 and Digu B as female and 9311 as male. The F1 plants were backcrossed with 9311 to produce the BC1F1 generation. The BC1F1 plants were backcrossed to 9311 to produce BC2F1, and the BC2F1 plants were backcrossed to 9311 to produce BC3F1, and then further backcrossed all the way to BC4F1. At the same time, Pigm-1 and the molecular marker corresponding to Pigm were detected in each backcross. From BC4F1 to BC4F5, molecular markers were tracked for detection in each generation and, finally, Pigm-1 and Pigm single gene lines were obtained, named 9311 (Pigm-1) and 9311 (Pigm), respectively (Figure 1).
2.2. Analysis of the Main Agronomic Traits of Pigm-1 and Pigm Single Gene Lines
To further analyze the changes in other agronomic traits of the improved line after the integration of blast resistance, we investigated the agronomic traits of 9311 (Pigm-1), 9311 (Pigm) and 9311 at maturity. The results showed that there was no difference between 9311 and 9311 (Pigm) in main agronomic traits, including plant height, panicle length, spikelets per panicle, seed setting rate, effective panicle number, grain length, grain width and 1000-grain weight. However, there was no difference in agronomic traits between 9311 and monogenic line 9311 (Pigm-1) except plant height, panicle length and spikelets per panicle (Table 1). These results indicate that the genetic background of single-gene line 9311 (Pigm-1) and 9311 (Pigm) basically restore the receptor parent 9311.
2.3. Analysis of Single Gene Line Pigm-1 and Pigm Blast Resistance Spectrum
These 195 isolates were used to inoculate 9311 (Pigm-1), 9311 (Pigm) and 9311. The results showed that the three materials were resistant to 5 blast isolates (JL-12, SH-17, SH-26, SH-68 and JY-7). However, 9311 (Pigm-1) and 9311 (Pigm) were resistant, but 9311 was susceptible, to other 189 isolates. Only one blast strain JL-37 showed differential virulence where 9311 (Pigm) shows resistance, but 9311 (Pigm-1) and 9311 were susceptible (Table 2 and Figure 2).
2.4. An Improved Breeding Line Containing Pigm-1 Gene Was Obtained
In this study, S19-118 was selected and used as the maternal parent, and R20-4, a selected restorer line containing Pigm-1, was used as the male parent for hybridization. Then the hybrid F1 was backcrossed with S19-118, and a single strain containing the Pigm-1 gene was selected and further backcrossed with S19-118 by combining molecular markers until BC3F1 was followed by selfing. Each generation was tracked by molecular markers and planting was continued for 3 generations until BC3F9. Other agronomic traits of the line were stable.
In the BC3F9, a line T22-23 with excellent comprehensive agronomic traits was selected and named Xiannuo 23. Finally, target molecular markers were used to genotype Xiannuo 23. The results showed that Xiannuo 23 contained the target gene Pigm-1 (Figure 3a).
2.5. Analysis of Rice Blast Resistance of Xiannuo 23 Improved Line
In order to phenotypically identify the rice blast resistance of the created Xiannuo 23, we used the rice blast fungus Guy11 for resistance identification at the seedling stage. The results showed that the recipient parent S19-118 was susceptible to the disease, and the donor parent R20-4 and the improved line Xiannuo 23 were resistant to the disease (Figure 3b). To further evaluate the resistance of the improved line Xiannuo 23 under natural conditions, recipient parent S19-118, donor parent R20-4 and improved line Xiannuo 23 were all planted in the National Blast Resistance Identification Center in Shanghang County, Fujian Province. The test results were consistent with the laboratory test results, and the improved line Xiannuo 23 showed resistance to the disease (Figure 3c).
2.6. Analysis of Main Agronomic Characters of Xiannuo 23
To further analyze the changes of other agronomic traits of Xiannuo 23 while improving resistance, we investigated and analyzed the agronomic traits of the donor parent R20-4, the recipient parent S19-118 and the improved line Xiannuo 23 at maturity. The results showed that, compared with the recipient parent S19-118, the improved line Xiannuo 23 had no change in plant height, panicle length, effective panicle, number of spiklets per panicle and grain length, but there were significant differences in seed setting rate, grain width and 1000-grain weight. Grain width and 1000-grain weight were significantly increased, while seed setting rate decreased. However, there was an increase in average yield per plant (Figure 4).
3. Discussion
3.1. Pigm-1 Antispectral Analysis
Studies have shown that different alleles of rice blast may have different resistance spectra and resistance levels [8]. Several alleles have been identified at the Piz locus, such as Pi2, Pi9, Piz-t (Pizh), Pigm (Pi50) and Pigm-1 [10,11,12,16]. Xie et al. [19] used 31 representative M. oryzae isolates from different regions to inoculate disease-resistant materials containing Pi9, Pi2 and Pigm and found that Gumei4 (Pigm) was resistant to all the isolates tested, C101A51 (Pi2) was susceptible to eight isolates and 75-1-127 (Pi9) was susceptible to five isolates. Peng et al. [20] used 444 representative M. oryzae isolates from the Hunan Province to inoculate monogenic rice lines carrying the resistance genes Pita, Pizt, Pikm, Pib or Pi9. The result shows that both Pi9 and Pikm conferred resistance to >75% of the tested isolates, while Pizt, Pita and Pib were effective against 55.63%, 15.31% and 3.15% of the isolates, respectively. Wu et al. [21] showed in a field inoculation that the resistance profiles of Pi40 and Pigm were higher than Pi2, while Pi2 was higher than Pi9. These results indicated that the resistance spectra of Pigm and Pi40 were higher than those of Pi9 and Pi2, and the resistance spectra of Pi9 and Pi2 were different in different regions or at different growth stages of rice.
The rice blast resistance genes Pigm and Pigm-1 are both more broad-spectrum resistant in production [12,16], but it is not clear whether the resistance levels between them are different. In this study, 195 different blast fungi from the Fujian Province were isolated. The results showed that only one blast fungus JL-37 had differences in resistance to Pigm and Pigm-1, while the remaining 194 had no differences. In our previous studies, it was speculated that Pigm and Pigm-1 had certain structural differences, and it was also speculated that this difference might be related to the evolution of rice blast fungus and the recognition of different pathogens by the R protein [16]. However, the identification of resistance proteins Pigm and Pigm-1 with blast fungus JL-37 and the formation of a resistance mechanism still need to be further studied.
3.2. Analysis of Pigm-1 Breeding and Utilization Prospects
Since cloning Pigm-1, we have created a series of new restorer materials using this gene. For example, using Minghui 63 as the receptor and Shuangkang 77009, which carries the resistance gene Pigm-1, as the donor, six new materials for resistance to rice blast were created [16]. Using restorer line R20 as the receptor and Shuangkang 77009, which carries the resistance gene Pigm-1, as the donor, four new materials for resistance to rice blast were generated [22]. Five new materials for resistance to rice blast and white leaf blight were prepared using Shuangkang 77009 with rice blast resistance gene Pigm-1 and IRBBL23, with white leaf blight resistance gene Xa23 as the donor [23]. Among these materials, the setting rate is above 90%. The allele of Pigm-1, Pigm, has been applied in rice disease resistance molecular breeding by more than 30 seed subsidiaries and breeding units in China, and new varieties have participated in regional trials and variety approval [12,16,24,25], which indicates that Pigm-1 and Pigm have good application prospects in rice blast resistance breeding.
The latest study revealed that the PIBP4-Rab5a transport machine is involved in regulating the accumulation of the NLR protein PigmR in the cell membrane microregion, and the PigmR protein can activate the OsRac1 protein in the microregion, promote the production of reactive oxygen species and enhance the resistance of rice to blast disease [26]. The study identified a new NLR immune signaling pathway, providing a new perspective and target for PigmR disease resistance molecular breeding.
3.3. Further Study on the Relationship Between Pigm-1 and Waxy Genes
In this study, R20-4 containing Pigm-1 was more than 90%. However, when Xiannuo 23 containing Pigm-1 was cultivated with R20-4 containing Pigm-1 as the donor, the seed setting rate was below 90% (Figure 4e). At the same time, in the process of creating glutinous rice materials, it was found that the seed setting rate of glutinous rice lines containing Pigm-1 was generally lower than 90%, while the setting rate of glutinous rice lines without Pigm-1 was relatively higher (>90%). Moreover, studies have shown that some rice blast R genes are linked to adverse agronomic traits often at the expense of yield [27,28]. Therefore, it is still uncertain whether the reason for the decreased seed setting rate in this study is the adverse linkage of Pigm-1 and Waxy genes, and further research is needed to resolve this issue.
4. Materials and Methods
4.1. Isolation of Rice Blast Fungus
Rice blast fungus was isolated by referring to the method reported by Zhao et al. [29]. Fresh leaves with severe disease were collected from Shanghang County, Jianyang County and Jiangle County in the Fujian Province, and then brought to the experiment for single packet separation.
We collected blast fungi in areas with high blast incidence in the Fujian Province and isolated them by single packet isolation. Finally, we obtained 60 monospore blast fungi from Jiangle County (JL-1 to JL-60), 89 from Shanghang County (SH-1 to SH-89) and 46 from Jianyang County (JY-1 to JY-46, Table 2).
4.2. Rice Blast Fungus Incubation
For the internal resistance identification of rice blast, the inoculation method was improved with reference to the previous methods [30]. For spray inoculation, two-week-old rice seedling leaves were sprayed with a spore suspension (1 × 105 spores/mL). The inoculated rice was placed in a moist chamber at 28 °C for 24 h in darkness and then transferred to another moist chamber with a photoperiod of 12 h under light. Leaves of 4-week-old rice seedlings were lightly wounded with a mouse ear punch, and 5 µL of spore suspension (5 × 105 spores/mL) was added to the wound. The lesion size was measured after 5 days of incubation. Among the inoculated materials, there were 24 strains per material and 3 replicates were used.
The recipient parent S19-118, the donor parent R20-4 and the improved line Xiannuo 23 were incubated in the National Blast Resistance Identification Center in Shanghang County, Fujian Province on 18 May 2023. On 5 June 2023, the investigation and statistics of blast resistance of each strain at seedling stage were conducted. Plants were rated on a scale of 0–9 from the rice standard evaluation system (International Rice Research Institute 1996). Grades 0–3 were resistant, and grades 4–9 were susceptible.
4.3. Detection and Analysis of Pigm-1 and Pigm Functional Markers
The resistance function marker of Pigm-1 refers to the marker developed by Yang et al. [16]. Pigm-1F: TTATTTCGTTTGCTATG; Pigm-1R: GGACTATGTGATCGGTTA. Specific primers were designed based on the Pigm-1 sequence, and two bands of 163 bp and 131 bp were amplified with Pigm-1 (Figure 5).
The resistance function marker of Pigm refers to the marker developed by Chen et al. [31]. T-Pigm-O-F: TAAGAATTGAGGTGGTTAGTTGAACGGAGA; T-Pigm-O-R: TTGCATGGCTCCACTACCCACTATAAG. For the extraction of genomic DNA from rice leaves, and the detection and analysis of molecular marker genes, refer to Yang et al. [16].
4.4. Investigation of Agronomic Traits
In July 2023, experimental materials, such as R20-4, S19-118, Xiannuo 23, 9311 (Pigm-1), 9311 (Pigm) and 9311, were planted in the experimental farm of the Rice Research Institute of Fujian Academy of Agricultural Sciences. The materials were all planted in the same plot, 3 replicates were set in each plot, 5 rows in each plot and 8 plants in each row. Field cultivation techniques are managed according to conventional cultivation techniques.
The main agronomic traits of rice, such as plant height, panicle length and seed setting rate, were investigated and analyzed with reference to Beena et al. [32].
Author Contributions
All the authors contributed to the conception and design of the study. D.Y. planned the project, performed the experiments and data collection and wrote the manuscript with input from all authors. The collection and analysis of the data were performed by Y.J., N.H., Z.C., S.L., F.H., W.W. and D.Y. The first draft of the manuscript was written by D.Y., N.H., Y.J. and Q.Q.L. All authors discussed the results and contributed to the final manuscript. All authors have read and agreed to the published version of the manuscript.
Funding
The work was supported by the Fujian public welfare competitive project (No. 2024R1055), the Special Fund for Agro-scientific Research in the Public Interest of Fujian Province (2023R1021006; 2024R1022001), the Free Exploration Project of Fujian Academy of Agricultural Sciences (No. ZYTS2023001), the National Natural Science Foundation of China (No. 32402387), the National Natural Science Foundation project extension research project (No. GJYS202302), 5511 Collaborative Engineering Project (No. XTCXGC2021001), the Fujian Provincial Natural Science Foundation of China (No. 2022J01450 and 2024J01171), and the Hundred Talent Plans of Fujian Province.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
Data are contained within the article.
Conflicts of Interest
The authors declare that they have no competing interests.
References
- Elert, E. Rice by the numbers: A good grain. Nature 2014, 514, 50–51. [Google Scholar] [CrossRef] [PubMed]
- Kamarudin, S.A.A.; Ahmad, F.; Hasan, N.; Hisham, S.N.; Yusof, S.N.; Abu, H.A.; Hussein, S.; Harun, A.R.; Wan, C.W.D.; Md, S.M.; et al. Whole genome resequencing data and grain quality traits of the rice cultivar Mahsuri and its blast disease resistant mutant line, Mahsuri Mutant. Data Brief 2023, 52, 109974. [Google Scholar] [CrossRef] [PubMed]
- Zhou, H.P.; Zhang, F.; Chen, K.; Shen, C.C.; Zhu, S.B.; Qiu, X.J.; Xu, J.L. Identification of rice blast resistance in xian and geng germplasms by genomewide association study. Acta Agron. Sin. 2023, 49, 1170–1183. [Google Scholar]
- He, F.; Zhang, H.; Liu, J.L.; Wang, Z.L.; Wang, G.L. Recent advances in understanding the innate immune mechanisms and developing new disease resistance breeding strategies against the rice blast fungus Magnaporthe oryzae in rice. Yi Chuan 2014, 36, 756–765. [Google Scholar] [PubMed]
- Kou, Y.J.; Shi, H.B.; Qiu, J.H.; Tao, Z.; Wang, W.M. Effectors and environment modulating rice blast disease: From understanding to effective control. Trends Microbiol. 2024, 32, 1007–1020. [Google Scholar] [CrossRef] [PubMed]
- Annegowda, D.C.; Prasannakumar, M.K.; Mahesh, H.B.; Siddabasappa, C.B.; Devanna, P.; Banakar, S.N.; Manojkumar, H.B.; Prasad, S.R. Rice blast disease in India: Present status and future challenges. Integr. Adv. Rice Res. 2021, 98847, 157–197. [Google Scholar]
- An, Z.S.; Liu, G.L.; Mei, H.W.; Li, L.T.; Wang, J.H.; Luo, L.J. Improving blast resistance of parental lines of drought resistant hybrid rice by marker-assisted selection. Mol. Plant Breed. 2010, 8, 1172–1176. [Google Scholar]
- Greenwood, J.R.; Lacorte-Apostol, V.; Kroj, T.; Padilla, J.; Telebanco-Yanoria, M.J.; Glaus, A.N.; Roulin, A.; Padilla, A.; Zhou, B.; Keller, B.; et al. Genome-wide association analysis uncovers rice blast resistance alleles of Ptr and Pia. Commun. Biol. 2024, 7, 607. [Google Scholar] [CrossRef] [PubMed]
- Mutiga, S.K.; Orwa, P.; Nganga, E.M.; Kyallo, M.M.; Rotich, F.; Gichuhi, E.; Kimani, J.M.; Mwongera, D.T.; Were, V.M.; Yanoria, M.J.; et al. Characterization of blast resistance in a diverse rice panel from sub-saharan africa. Phytopathology 2023, 113, 1278–1288. [Google Scholar] [CrossRef]
- Xiao, N.; Wu, Y.Y.; Li, A.H. Strategy for use of rice blast resistance genes in rice molecular breeding. Rice Sci. 2020, 4, 263–277. [Google Scholar]
- Wu, Y.Y.; Xiao, N.; Yu, L.; Pan, C.H.; Li, Y.H.; Zhang, X.X.; Liu, G.Q.; Dai, Z.Y.; Pan, X.B.; Li, A.H. Combination patterns of major R genes determine the level of resistance to the M. oryzae in rice (Oryza sativa L.). PLoS ONE 2015, 10, e126130. [Google Scholar] [CrossRef] [PubMed]
- Deng, Y.W.; Zhai, K.R.; Xie, Z.; Yang, D.Y.; Zhu, X.D.; Liu, J.Z.; Wang, X.; Qin, P.; Yang, Y.Z.; Zhang, G.M.; et al. Epigenetic regulation of antagonistic receptors confers rice blast resistance with yield balance. Science 2017, 355, 962–965. [Google Scholar] [CrossRef]
- Zhou, Y.; Wan, T.; Yuan, B.; Lei, F.; Chen, M.J.; Wang, Q.; Huang, P.; Kou, S.Y.; Qiu, W.X.; Liu, L. Improving rice blast resistance by mining broad-spectrum resistance genes at the Pik locus. Rice Sci. 2022, 29, 133–142. [Google Scholar]
- Yoshida, K.; Saitoh, H.; Fujisawa, S.; Kanzaki, H.; Matsumura, H.; Yoshida, K.; Tosa, Y.; Chuma, I.; Takano, Y.; Win, J.; et al. Association genetics reveals three novel avirulence genes from the rice blast fungal pathogen Magnaporthe oryzae. Plant Cell 2009, 21, 1573–1591. [Google Scholar] [CrossRef] [PubMed]
- Kanzaki, H.; Yoshida, K.; Saitoh, H.; Fujisaki, K.; Hirabuchi, A.; Alaux, L.; Fournier, E.E.; Tharreau, D.; Terauchi, R. Arms race co-evolution of Magnaporthe oryzae AVR-Pik and rice Pik genes driven by their physical interactions. Plant J. 2012, 72, 894–907. [Google Scholar] [CrossRef]
- Yang, D.W.; Li, S.P.; Lu, L.; Fang, J.B.; Wang, W.; Cui, H.T.; Tang, D.Z. Identification and application of the Pigm-1 gene in rice disease-resistance breeding. Plant Biol. 2020, 22, 1022–1029. [Google Scholar] [CrossRef]
- Feng, Z.M.; Li, M.Y.; Xu, Z.W.; Gao, P.; Wu, Y.Y.; Wu, K.T.; Zhao, J.H.; Wang, X.Q.; Wang, J.N.; Li, M.C.; et al. Development of rice variety with durable and broad-spectrum resistance to blast disease through marker-assisted introduction of Pigm gene. Front. Plant Sci. 2022, 13, 937767. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Xiao, N.; Li, Y.; Gao, Q.; Ning, Y.; Yu, L.; Cai, Y.; Pan, C.; Zhang, X.; Huang, N.; et al. Identification and fine mapping of qPBR10-1, a novel locus controlling panicle blast resistance in Pigm-containing P/TGMS line. Mol. Breed. 2021, 41, 75. [Google Scholar] [CrossRef] [PubMed]
- Xie, Z.; Yan, B.X.; Shou, J.Y.; Tang, J.; Wang, X.; Zhai, K.R.; Liu, J.Y.; Li, Q.; Luo, M.Z.; Deng, Y.W.; et al. A nucleotide-binding site-leucine-rich repeat receptor pair confers broad-spectrum disease resistance through physical association in rice. Philos. Trans. R. Soc. London Biol. Sci. 2019, 4, 374. [Google Scholar] [CrossRef]
- Peng, Z.R.; Li, L.; Wu, S.H.; Chen, X.L.; Shi, Y.F.; He, Q.; Shu, F.; Zhang, W.H.; Sun, P.Y.; Deng, H.F.; et al. Frequencies and variations of Magnaporthe oryzae avirulence genes in Hunan province, China. Plant Dis. 2021, 105, 3829–3834. [Google Scholar] [CrossRef]
- Wu, Y.Y.; Chen, Y.; Pan, C.H.; Xiao, N.; Yu, L.; Li, Y.H.; Zhang, X.X.; Pan, X.B.; Chen, X.J.; Liang, C.Z.; et al. Development and evaluation of near-isogenic lines with different blast resistance alleles at the Piz locus in japonica rice from the lower region of the Yangtze River, China. Plant Dis. 2017, 101, 1283–1291. [Google Scholar] [CrossRef]
- He, N.Q.; Yang, D.W.; Zheng, X.H.; Huang, F.H.; Cheng, C.P.; Ye, N. Improving blast resistance of R20 by molecular marker-assisted selection of Pigm-1 gene. J. Nucl. Agric. Sci. 2022, 36, 245–250. [Google Scholar]
- Yang, D.W.; He, N.Q.; Huang, F.H. Pyramiding Pigm-1 and Xa23 genes in rice (Oryza sativa L.) by marker-assisted selection. J. Northwest A F Univ. (Nat. Sci. Ed.) 2023, 51, 37–45. [Google Scholar]
- Peng, P.; Jiang, H.Y.; Luo, L.H.; Ye, C.R.; Xiao, Y.H. Pyramiding of multiple genes to improve rice blast resistance of photo-thermo sensitive male sterile line, without yield penalty in hybrid rice production. Plants 2023, 12, 1389. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.P.; Wang, G.; Qin, R.; Gong, C.Q.; Zhou, D.; Li, D.K.; Luo, B.J.; Jin, J.H.; Deng, Q.M.; Wang, S.Q.; et al. Improvement of quality and disease resistance for a heavy-panicle hybrid restorer line, R600, in rice (Oryza sativa L.) by gene pyramiding breeding. Curr. Issues Mol. Biol. 2024, 46, 10762–10778. [Google Scholar] [CrossRef]
- Liang, D.; Yang, D.Y.; Li, T.; Zhu, Z.; Yan, B.X.; He, Y.; Li, X.Y.; Zhai, K.R.; Liu, J.Y.; Kawano, Y.; et al. A PRA-Rab trafficking machinery modulates NLR immune receptor plasma membrane microdomain anchoring and blast resistance in rice. Sci. Bull. 2024, 9, S2095-9273(24)00911-3. [Google Scholar] [CrossRef]
- Nelson, R.; Wiesner-Hanks, T.; Wisser, R.; Balint-Kurti, P. Navigating complexity to breed disease-resistant crops. Nat. Rev. Genet. 2018, 19, 21–33. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Zhou, L.; Shi, H.; Chern, M.; Yu, H.; Yi, H.; He, M.; Yin, J.J.; Zhu, X.B.; Li, Y.; et al. A single transcription factor promotes both yield and immunity in rice. Science 2018, 361, 1026–1028. [Google Scholar] [CrossRef]
- Zhao, D.D.; Chung, H.; Jang, Y.H.; Farooq, M.; Choi, S.Y.; Du, X.X.; Kim, K.M. Analysis of rice blast fungus genetic diversity and identification of a novel blast resistance OsDRq12 gene. Phytopathology 2024, 114, 1917–1925. [Google Scholar] [CrossRef] [PubMed]
- Yang, D.W.; Li, S.P.; Lu, L.; Zheng, Z.C.; Tang, D.Z.; Cui, H.T. Transcriptome analysis of rice response to blast fungus identified core genes involved in immunity. Plant Cell Environ. 2021, 44, 3103–3121. [Google Scholar] [CrossRef] [PubMed]
- Chen, T.; Sun, X.C.; Zhang, S.L.; Liang, W.H.; Zhou, L.H.; Zhao, Q.Y.; Yao, S.; Zhao, L.; Zhao, C.F.; Zhu, Z.; et al. Development and application of Pigm-specific molecular markers for broad-spectrum resistance gene in rice blast. Chin. J. Rice Sci. 2020, 34, 28–36. [Google Scholar]
- Beena, R.; Kirubakaran, S.; Nithya, N.; Manickavelu, A.; Sah, R.P.; Abida, P.S.; Sreekumar, J.; Jaslam, P.M.; Rejeth, R.; Jayalekshmy, V.G.; et al. Association mapping of drought tolerance and agronomic traits in rice (Oryza sativa L.) landraces. BMC Plant Biol. 2021, 21, 484. [Google Scholar] [CrossRef] [PubMed]
Figure 1.
Construction roadmap of Pigm-1 and Pigm monogenic lines. BC, backcross; F, familial.
Figure 2.
The disease symptoms of the rice cultivars 9311 (Pigm-1) and 9311 (Pigm) infected by blast fungi. (a) Blast resistance of 9311 (Pigm-1) and 9311 (Pigm) plants using spraying inoculation in a greenhouse. Representative leaves obtained 7 days after inoculation with blast strain JL-37. (b) Lesion numbers cm2 on the rice leaves (M ± SD, n > 10 leaves) in (a), Asterisk (**) indicates statistical significance (p < 0.01) determined by Student’s t test.
Figure 2.
The disease symptoms of the rice cultivars 9311 (Pigm-1) and 9311 (Pigm) infected by blast fungi. (a) Blast resistance of 9311 (Pigm-1) and 9311 (Pigm) plants using spraying inoculation in a greenhouse. Representative leaves obtained 7 days after inoculation with blast strain JL-37. (b) Lesion numbers cm2 on the rice leaves (M ± SD, n > 10 leaves) in (a), Asterisk (**) indicates statistical significance (p < 0.01) determined by Student’s t test.
Figure 3.
Detection of molecular markers in improved lines and phenotype of blast resistance. (a) The results of Pigm-1 molecular marker detection showed that Xiannuo 23 contained Pigm-1 that had two expected bands of 163 bp and 131 bp, while S19-118 without Pigm-1 had only one band of 163 bp. (b) The greenhouse test results of the improved lines showed that S19-118 was susceptible to rice blast, while R20-4 and Xiannuo 23 were resistant to rice blast. (c) The field test results of the improved line showed that S19-118 was susceptible to, but R20-4 and Xiannuo 23 were resistant to, the rice blast variant Guy 11. (d) Lesion numbers per cm2 on the rice leaves (M ± SD, n > 10 leaves) in (b). (e) The incidence scores of the strains are based on the results in (c), the disease score of S19-118 is 9, while both R20-4 and Xiannuo 23 have a score of 1. Asterisks (**) indicate statistical significance (p < 0.01) determined by Student’s t test.
Figure 3.
Detection of molecular markers in improved lines and phenotype of blast resistance. (a) The results of Pigm-1 molecular marker detection showed that Xiannuo 23 contained Pigm-1 that had two expected bands of 163 bp and 131 bp, while S19-118 without Pigm-1 had only one band of 163 bp. (b) The greenhouse test results of the improved lines showed that S19-118 was susceptible to rice blast, while R20-4 and Xiannuo 23 were resistant to rice blast. (c) The field test results of the improved line showed that S19-118 was susceptible to, but R20-4 and Xiannuo 23 were resistant to, the rice blast variant Guy 11. (d) Lesion numbers per cm2 on the rice leaves (M ± SD, n > 10 leaves) in (b). (e) The incidence scores of the strains are based on the results in (c), the disease score of S19-118 is 9, while both R20-4 and Xiannuo 23 have a score of 1. Asterisks (**) indicate statistical significance (p < 0.01) determined by Student’s t test.
Figure 4.
Comparison of main agronomic traits between parents and improved line Xiannuo 23. (a) Plant height. (b) Panicle length. (c) Number of effective panicle. (d) Spikelets per panicle. (e) Seed setting rate. (f) Grain length (g) Grain width. (h) 1,000-grain weight. (i) Yield per plant. NS: no statistically significant difference; * and ** show significant at p < 0.05 and 0.01 levels, respectively.
Figure 4.
Comparison of main agronomic traits between parents and improved line Xiannuo 23. (a) Plant height. (b) Panicle length. (c) Number of effective panicle. (d) Spikelets per panicle. (e) Seed setting rate. (f) Grain length (g) Grain width. (h) 1,000-grain weight. (i) Yield per plant. NS: no statistically significant difference; * and ** show significant at p < 0.05 and 0.01 levels, respectively.
Figure 5.
Primers designed for detecting the Pigm-1 gene. The bases in red represent the location of the designed primer. (a) The Pigm-1 specific primers amplified 163 bp bands. (b) The Pigm-1 specific primers simultaneously amplified 131 bp bands.
Figure 5.
Primers designed for detecting the Pigm-1 gene. The bases in red represent the location of the designed primer. (a) The Pigm-1 specific primers amplified 163 bp bands. (b) The Pigm-1 specific primers simultaneously amplified 131 bp bands.
Table 1.
Comparison of the main agronomical traits between 9311 (Pigm-1), 9311 (Pigm) and 9311.
| Traits | 9311 (Pigm-1) | 9311 (Pigm) | 9311 |
|---|---|---|---|
| Plant height (cm) | 115.4 ± 2.24 * | 107.3 ± 2.14 | 106.8 ± 2.11 |
| Panicle length (cm) | 23.1 ± 0.34 * | 20.7 ± 0.31 | 19.4 ± 0.30 |
| Number of effective panicle | 7.68 ± 1.06 | 7.91 ± 1.13 | 7.84 ± 1.19 |
| Spikelets per panicle | 197.6 ± 6.46 ** | 163.7 ± 5.96 | 160.8 ± 5.16 |
| Seed setting rate (%) | 91.06 ± 2.23 | 90.15 ± 1.92 | 88.85 ± 1.62 |
| 1000-grain weight (g) | 32.13± 0.91 | 30.98± 0.81 | 31.16± 0.81 |
| Grain length (mm) | 9.75 ± 0.18 | 9.68 ± 0.21 | 9.71 ± 0.21 |
| Grain width (mm) | 3.26 ± 0.10 | 3.23 ± 0.10 | 3.24 ± 0.11 |
* and ** indicate the significance levels of the differences between 9311 (Pigm-1), 9311 (Pigm) and 9311 were revealed by the t-test at p < 0.05 and p < 0.01, respectively. The data were derived from the trial that was performed at the Fuzhou experimental station in October 2023.
Table 2.
The results of indoor inoculation of single gene line 9311 (Pigm-1), 9311 (Pigm) and 9311 by M. oryzae isolates collected from different areas of the Fujian Province.
Table 2.
The results of indoor inoculation of single gene line 9311 (Pigm-1), 9311 (Pigm) and 9311 by M. oryzae isolates collected from different areas of the Fujian Province.
| Name | 9311 (Pigm-1) | 9311 (Pigm) | 9311 | Name | 9311 (Pigm-1) | 9311 (Pigm) | 9311 |
|---|---|---|---|---|---|---|---|
| JL-1 | R | R | S | SH-41 | R | R | S |
| JL-2 | R | R | S | SH-42 | R | R | S |
| JL-3 | R | R | S | SH-43 | R | R | S |
| JL-4 | R | R | S | SH-44 | R | R | S |
| JL-5 | R | R | S | SH-45 | R | R | S |
| JL-6 | R | R | S | SH-46 | R | R | S |
| JL-7 | R | R | S | SH-47 | R | R | S |
| JL-8 | R | R | S | SH-48 | R | R | S |
| JL-9 | R | R | S | SH-49 | R | R | S |
| JL-10 | R | R | S | SH-50 | R | R | S |
| JL-11 | R | R | R | SH-51 | R | R | S |
| JL-12 | R | R | R | SH-52 | R | R | S |
| JL-13 | R | R | S | SH-53 | R | R | S |
| JL-14 | R | R | S | SH-54 | R | R | S |
| JL-15 | R | R | S | SH-55 | R | R | S |
| JL-16 | R | R | S | SH-56 | R | R | S |
| JL-17 | R | R | S | SH-57 | R | R | S |
| JL-18 | R | R | S | SH-58 | R | R | S |
| JL-19 | R | R | S | SH-59 | R | R | S |
| JL-20 | R | R | S | SH-60 | R | R | S |
| JL-21 | R | R | S | SH-61 | R | R | S |
| JL-22 | R | R | S | SH-62 | R | R | S |
| JL-23 | R | R | S | SH-63 | R | R | S |
| JL-24 | R | R | S | SH-64 | R | R | S |
| JL-25 | R | R | S | SH-65 | R | R | S |
| JL-26 | R | R | S | SH-66 | R | R | S |
| JL-27 | R | R | S | SH-67 | R | R | S |
| JL-28 | R | R | S | SH-68 | R | R | R |
| JL-29 | R | R | S | SH-69 | R | R | S |
| JL-30 | R | R | S | SH-70 | R | R | S |
| JL-31 | R | R | S | SH-71 | R | R | S |
| JL-32 | R | R | S | SH-72 | R | R | S |
| JL-33 | R | R | S | SH-73 | R | R | S |
| JL-34 | R | R | S | SH-74 | R | R | S |
| JL-35 | R | R | S | SH-75 | R | R | S |
| JL-36 | R | R | S | SH-76 | R | R | S |
| JL-37 | S | R | S | SH-77 | R | R | S |
| JL-38 | R | R | S | SH-78 | R | R | S |
| JL-39 | R | R | S | SH-79 | R | R | S |
| JL-40 | R | R | S | SH-80 | R | R | S |
| JL-41 | R | R | S | SH-81 | R | R | S |
| JL-42 | R | R | S | SH-82 | R | R | S |
| JL-43 | R | R | S | SH-83 | R | R | S |
| JL-44 | R | R | S | SH-84 | R | R | S |
| JL-45 | R | R | S | SH-85 | R | R | S |
| JL-46 | R | R | S | SH-86 | R | R | S |
| JL-47 | R | R | S | SH-87 | R | R | S |
| JL-48 | R | R | S | SH-88 | R | R | S |
| JL-49 | R | R | S | SH-89 | R | R | S |
| JL-50 | R | R | S | JY-1 | R | R | S |
| JL-51 | R | R | S | JY-2 | R | R | S |
| JL-52 | R | R | S | JY-3 | R | R | S |
| JL-53 | R | R | S | JY-4 | R | R | S |
| JL-54 | R | R | S | JY-5 | R | R | S |
| JL-55 | R | R | S | JY-6 | R | R | S |
| JL-56 | R | R | S | JY-7 | R | R | R |
| JL-57 | R | R | S | JY-8 | R | R | S |
| JL-58 | R | R | S | JY-9 | R | R | S |
| JL-59 | R | R | S | JY-10 | R | R | S |
| JL-60 | R | R | S | JY-11 | R | R | S |
| SH-1 | R | R | S | JY-12 | R | R | S |
| SH-2 | R | R | S | JY-13 | R | R | S |
| SH-3 | R | R | S | JY-14 | R | R | S |
| SH-4 | R | R | S | JY-15 | R | R | S |
| SH-5 | R | R | S | JY-16 | R | R | S |
| SH-6 | R | R | S | JY-17 | R | R | S |
| SH-7 | R | R | S | JY-18 | R | R | S |
| SH-8 | R | R | S | JY-19 | R | R | S |
| SH-9 | R | R | S | JY-20 | R | R | S |
| SH-10 | R | R | S | JY-21 | R | R | S |
| SH-11 | R | R | S | JY-22 | R | R | S |
| SH-12 | R | R | S | JY-23 | R | R | S |
| SH-13 | R | R | S | JY-24 | R | R | S |
| SH-14 | R | R | S | JY-25 | R | R | S |
| SH-15 | R | R | S | JY-26 | R | R | S |
| SH-16 | R | R | S | JY-27 | R | R | S |
| SH-17 | R | R | R | JY-28 | R | R | S |
| SH-18 | R | R | S | JY-29 | R | R | S |
| SH-19 | R | R | S | JY-30 | R | R | S |
| SH-20 | R | R | S | JY-31 | R | R | S |
| SH-21 | R | R | S | JY-32 | R | R | S |
| SH-22 | R | R | S | JY-33 | R | R | S |
| SH-23 | R | R | S | JY-34 | R | R | S |
| SH-24 | R | R | S | JY-35 | R | R | S |
| SH-25 | R | R | S | JY-36 | R | R | S |
| SH-26 | R | R | R | JY-37 | R | R | S |
| SH-27 | R | R | S | JY-38 | R | R | S |
| SH-28 | R | R | S | JY-39 | R | R | S |
| SH-29 | R | R | S | JY-40 | R | R | S |
| SH-30 | R | R | S | JY-41 | R | R | S |
| SH-31 | R | R | S | JY-42 | R | R | S |
| SH-32 | R | R | S | JY-43 | R | R | S |
| SH-33 | R | R | S | JY-44 | R | R | S |
| SH-34 | R | R | S | JY-45 | R | R | S |
| SH-35 | R | R | S | JY-46 | R | R | S |
| SH-36 | R | R | S | ||||
| SH-37 | R | R | S | ||||
| SH-38 | R | R | S | ||||
| SH-39 | R | R | S | ||||
| SH-40 | R | R | S |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Jin, Y.; He, N.; Cheng, Z.; Lin, S.; Huang, F.; Wang, W.; Li, Q.Q.; Yang, D. Resistance Spectrum Analysis and Breeding Utilization of Rice Blast Resistance Gene Pigm-1. Plants 2025, 14, 535. https://doi.org/10.3390/plants14040535
AMA Style
Jin Y, He N, Cheng Z, Lin S, Huang F, Wang W, Li QQ, Yang D. Resistance Spectrum Analysis and Breeding Utilization of Rice Blast Resistance Gene Pigm-1. Plants. 2025; 14(4):535. https://doi.org/10.3390/plants14040535
Chicago/Turabian StyleJin, Yidan, Niqing He, Zhaoping Cheng, Shaojun Lin, Fenghuang Huang, Wenxiao Wang, Qingshun Q. Li, and Dewei Yang. 2025. "Resistance Spectrum Analysis and Breeding Utilization of Rice Blast Resistance Gene Pigm-1" Plants 14, no. 4: 535. https://doi.org/10.3390/plants14040535
APA StyleJin, Y., He, N., Cheng, Z., Lin, S., Huang, F., Wang, W., Li, Q. Q., & Yang, D. (2025). Resistance Spectrum Analysis and Breeding Utilization of Rice Blast Resistance Gene Pigm-1. Plants, 14(4), 535. https://doi.org/10.3390/plants14040535
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
