Unraveling Allelic Impacts on Pre-Harvest Sprouting Resistance in TaVP1-B of Chinese Wheat Accessions Using Pan-Genome
Abstract
:1. Introduction
2. Results
2.1. PHS Resistance of Wheat Cultivars
2.1.1. Evaluation of PHS Resistance in 20 Wheat Cultivars with Released Reference Genomes
2.1.2. Evaluation of PHS Resistance in 304 Chinese Wheat Cultivars
2.2. Haplotype Analysis of TaVP1-B by Wheat Pan-Genome
2.3. Association Analysis Between TaVP1-B Allelic and PHS Resistance in Released Wheat Cultivar Pan-Genomes
2.4. Validation of TaVP1-B Allelic and Effect on PHS Resistance in Chinese Wheat
2.4.1. Haplotypes Identification in Chinese Wheat Accessions
2.4.2. Validation of TaVP1-B in Chinese Wheat Accessions
2.4.3. Distribution of TaVP1-B Haplotypes in China
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Field Trials
4.2. Evaluation of PHS Resistance
4.3. DNA Isolation of Plant Materials
4.4. Gene Structure Analysis of TaVP1-B in Wheat Cultivars
4.5. KASP Marker Development and Genotyping 304 Wheat Cultivars
4.6. Statistical Analysis
5. Conclusions
6. Patents
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
CDS | coding sequence |
CS | Chinese Spring |
IWGSC | International Wheat Genome Sequencing Consortium |
KASP | kompetitive allele specific PCR |
PHS | pre-harvest sprouting |
SNP | single nucleotide polymorphism |
References
- Xiong, H.; Zhou, C.; Fu, M.; Guo, H.; Xie, Y.; Zhao, L.; Gu, J.; Zhao, S.; Ding, Y.; Li, Y.; et al. Cloning and functional characterization of Rht8, a “Green Revolution” replacement gene in wheat. Mol. Plant 2022, 15, 373–376. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Dai, X.; Liu, H.; Yu, S.; Mai, C.; Yu, L.; Yu, G.; Yang, L.; Zhou, Y.; Li, H.; et al. Identification of effective alleles and haplotypes conferring pre-harvest sprouting resistance in winter wheat cultivars. BMC Plant Biol. 2022, 22, 326. [Google Scholar]
- Li, Z.; Chen, Y.; Ou, X.; Wang, M.; Wang, N.; Li, W.; Deng, Y.; Diao, Y.; Sun, Z.; Luo, Q.; et al. Identification of a stable major-effect quantitative trait locus for pre-harvest sprouting in common wheat (Triticum aestivum L.) via high-density SNP-based genotyping. Theor. Appl. Genet. 2022, 135, 4183–4195. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Liu, H.; Siddique, K.H.M.; Yan, G. Transcriptomic profiling of wheat near-isogenic lines reveals candidate genes on chromosome 3A for pre-harvest sprouting resistance. BMC Plant Biol. 2021, 21, 53. [Google Scholar] [CrossRef]
- Lang, J.; Fu, Y.; Zhou, Y.; Cheng, M.; Deng, M.; Li, M.; Zhu, T.; Yang, J.; Guo, X.; Gui, L.; et al. Myb10-D confers PHS-3D resistance to pre-harvest sprouting by regulating NCED in ABA biosynthesis pathway of wheat. New Phytol. 2021, 230, 1940–1952. [Google Scholar] [CrossRef]
- Tai, L.; Wang, H.J.; Xu, X.J.; Sun, W.H.; Ju, L.; Liu, W.T.; Li, W.Q.; Sun, J.; Chen, K.M. Pre-harvest sprouting in cereals: Genetic and biochemical mechanisms. J. Exp. Bot. 2021, 72, 2857–2876. [Google Scholar] [CrossRef]
- Tai, L.; Wu, J.; Jing, Y.; Liu, H.; Zeng, Q.; Xu, X.; Shi, S.; Wang, H.; Liu, W.; Sun, J.; et al. A genome-wide association study uncovers that TaPI4K-2A regulates pre-harvest sprouting in wheat. Plant Commun. 2024, 5, 100739. [Google Scholar] [CrossRef]
- Liu, S.; Wang, D.; Lin, M.; Sehgal, S.K.; Dong, L.; Wu, Y.; Bai, G. Artificial selection in breeding extensively enriched a functional allelic variation in TaPHS1 for pre-harvest sprouting resistance in wheat. Theor. Appl. Genet. 2021, 134, 339–350. [Google Scholar] [CrossRef]
- Singh, C.; Kamble, U.R.; Gupta, V.; Singh, G.; Sheoran, S.; Gupta, A.; Tyagi, B.S.; Kumar, P.; Mishra, C.N.; Krishannapa, G.; et al. Pre-harvest sprouting in wheat: Current status and future prospects. J. Cereal Res. 2021, 13, 1–22. [Google Scholar] [CrossRef]
- Mares, D.; Mrva, K.; Cheong, J.; Williams, K.; Watson, B.; Storlie, E.; Sutherland, M.; Zou, Y. A QTL located on chromosome 4A associated with dormancy in white- and red-grained wheats of diverse origin. Theor. Appl. Genet. 2005, 111, 1357–1364. [Google Scholar] [CrossRef]
- Mori, M.; Uchino, N.; Chono, M.; Kato, K.; Miura, H. Mapping QTLs for grain dormancy on wheat chromosome 3A and the group 4 chromosomes and their combined effect. Theor. Appl. Genet. 2005, 110, 1315–1323. [Google Scholar] [CrossRef] [PubMed]
- Okamoto, M.; Kuwahara, A.; Seo, M.; Kushiro, T.; Asami, T.; Hirai, N.; Kamiya, Y.; Koshiba, T.; Nambara, E. CYP707A1 and CYP707A2, which encode abscisic acid 8′-hydroxylases, are indispensable for proper control of seed dormancy and germination in Arabidopsis. Plant Physiol. 2006, 141, 97–107. [Google Scholar] [CrossRef] [PubMed]
- Liton, M.; McCartney, C.A.; Hiebert, C.W.; Kumar, S.; Jordan, M.C.; Ayele, B.T. Identification of loci for pre-harvest sprouting resistance in the highly dormant spring wheat RL4137. Theor. Appl. Genet. 2021, 134, 113–124. [Google Scholar] [CrossRef] [PubMed]
- Groos, C.; Gay, G.; Perretant, M.R.; Gervais, L.; Bernard, M.; Dedryver, F.; Charmet, G. Study of the relationship between pre-harvest sprouting and grain color by quantitative trait loci analysis in a white×red grain bread-wheat cross. Theor. Appl. Genet. 2002, 104, 39–47. [Google Scholar] [CrossRef] [PubMed]
- Himi, E.; Mares, D.J.; Yanagisawa, A.; Noda, K. Effect of grain colour gene (R) on grain dormancy and sensitivity of the embryo to abscisic acid (ABA) in wheat. J. Exp. Bot. 2002, 53, 1569–1574. [Google Scholar] [CrossRef]
- Miura, H.; Sato, N.; Kato, K.; Amano, Y. Detection of chromosomes carrying genes for seed dormancy of wheat using the backcross reciprocal monosomic method. Plant Breed. 2002, 121, 394–399. [Google Scholar] [CrossRef]
- Osa, M.; Kato, K.; Mori, M.; Shindo, C.; Torada, A.; Miura, H. Mapping QTLs for seed dormancy and the Vp1 homologue on chromosome 3A in wheat. Theor. Appl. Genet. 2003, 106, 1491–1496. [Google Scholar] [CrossRef]
- Himi, E.; Noda, K. Red grain colour gene (R) of wheat is a Myb-type transcription factor. Euphytica 2005, 143, 239–242. [Google Scholar] [CrossRef]
- Singh, M.; Lewis, P.E.; Hardeman, K.; Bai, L.; Rose, J.K.C.; Mazourek, M.; Chomet, P.; Brutnell, T.P. Activator mutagenesis of the pink scutellum1/viviparous7 locus of maize. Plant Cell 2003, 15, 874–884. [Google Scholar] [CrossRef]
- Kottearachchi, N.S.; Uchino, N.; Kato, K.; Miura, H. Increased grain dormancy in white-grained wheat by introgression of preharvest sprouting tolerance QTLs. Euphytica 2006, 152, 421–428. [Google Scholar] [CrossRef]
- Yang, Y.; Ma, Y.Z.; Xu, Z.S.; Chen, X.M.; He, Z.H.; Yu, Z.; Xia, L.Q. Isolation and characterization of Viviparous-1 genes in wheat cultivars with distinct ABA sensitivity and pre-harvest sprouting tolerance. J. Exp. Bot. 2007, 58, 2863–2871. [Google Scholar] [CrossRef] [PubMed]
- Fofana, B.; Humphreys, D.G.; Rasul, G.; Cloutier, S.; Brûlé-Babel, A.; Woods, S.; Lukow, O.M.; Somers, D.J. Mapping quantitative trait loci controlling pre-harvest sprouting resistance in a red × white seeded spring wheat cross. Euphytica 2008, 165, 509–521. [Google Scholar] [CrossRef]
- Liu, S.; Cai, S.; Graybosch, R.; Chen, C.; Bai, G. Quantitative trait loci for resistance to pre-harvest sprouting in US hard white winter wheat Rio Blanco. Theor. Appl. Genet. 2008, 117, 691–699. [Google Scholar] [CrossRef]
- Ogbonnaya, F.C.; Imtiaz, M.; Ye, G.; Hearnden, P.R.; Hernandez, E.; Eastwood, R.F. Genetic and QTL analyses of seed dormancy and preharvest sprouting resistance in the wheat germplasm CN10955. Theor. Appl. Genet. 2008, 116, 891–902. [Google Scholar] [CrossRef]
- Torada, A.; Koike, M.; Ikeguchi, S.; Tsutsui, I. Mapping of a major locus controlling seed dormancy using backcrossed progenies in wheat (Triticum aestivum L.). Genome 2008, 51, 426–432. [Google Scholar] [CrossRef]
- Munkvold, J.D.; Tanaka, J.; Benscher, D.; Sorrells, M.E. Mapping quantitative trait loci for preharvest sprouting resistance in white wheat. Theor. Appl. Genet. 2009, 119, 1223–1235. [Google Scholar] [CrossRef]
- Lin, M.; Zhang, D.D.; Liu, S.B.; Zhang, G.R.; Yu, J.M.; Fritz, A.K.; Bai, G.H. Genome-wide association analysis on pre-harvest sprouting resistance and grain color in U.S. winter wheat. BMC Genom. 2016, 17, 794. [Google Scholar] [CrossRef]
- Zhang, Y.; Xia, X.; He, Z. The seed dormancy allele TaSdr-A1a associated with pre-harvest sprouting tolerance is mainly present in Chinese wheat landraces. Theor. Appl. Genet. 2017, 130, 81–89. [Google Scholar] [CrossRef]
- Zhu, Y.; Wang, S.; Zhang, H.; Zhao, L.; Wu, Z.; Jiang, H.; Cao, J.; Liu, K.; Qin, M.; Lu, J.; et al. Identification of major loci for seed dormancy at different post-ripening stages after harvest and validation of a novel locus on chromosome 2AL in common wheat. Mol. Breed. 2016, 36, 174. [Google Scholar] [CrossRef]
- Zhou, Y.; Tang, H.; Cheng, M.P.; Dankwa, K.O.; Chen, Z.X.; Li, Z.Y. Genome-wide association study for pre-harvest sprouting resistance in a large germplasm collection of Chinese wheat landraces. Front. Plant Sci. 2017, 8, 401. [Google Scholar] [CrossRef]
- Shao, M.; Bai, G.; Rife, T.W.; Poland, J.; Lin, M.; Liu, S. QTL mapping of pre–harvest sprouting resistance in a white wheat cultivar Danby. Theor. Appl. Genet. 2018, 131, 1683–1697. [Google Scholar] [CrossRef] [PubMed]
- Sani Shawai, R.; Liu, D.; Li, L.; Chen, T.; Li, M.; Cao, S.; Xia, X.; Liu, J.; He, Z.; Zhang, Y. QTL mapping for pre-harvest sprouting in a recombinant inbred line population of elite wheat varieties Zhongmai 578 and Jimai 22. Crop J. 2023, 11, 863–869. [Google Scholar] [CrossRef]
- Guo, G.; Xu, S.; Chen, H.; Hao, Y.; Mao, H. QTL Mapping for Wheat Seed Dormancy in a Yangmai16/Zhongmai895 Double Haploid Population. Plants 2023, 12, 759. [Google Scholar] [CrossRef] [PubMed]
- Dhariwal, R.; Hiebert, C.W.; Sorrells, M.E.; Spaner, D.; Graf, R.J.; Singh, J.; Randhawa, H.S. Mapping pre-harvest sprouting resistance loci in AAC Innova x AAC Tenacious spring wheat population. BMC Genom. 2021, 22, 900. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Wang, S.; Wei, W.; Xie, H.; Liu, K.; Zhang, C.; Ma, C. Genome-wide association study of pre-harvest sprouting tolerance using a 90K SNP array in common wheat (Triticum aestivum L.). Theor. Appl. Genet. 2019, 132, 2947–2963. [Google Scholar] [CrossRef]
- Yang, J.; Tan, C.; Lang, J.; Tang, H.; Hao, M.; Tan, Z.; Wang, J. Identification of qPHS.sicau-1B and qPHS.sicau-3D from synthetic wheat for pre-harvest sprouting resistance wheat improvement. Mol. Breed. 2019, 39, 132. [Google Scholar] [CrossRef]
- Rabieyan, E.; Bihamta, M.R.; Moghaddam, M.E.; Mohammadi, V.; Alipour, H. Genome-wide association mapping and genomic prediction for preharvest sprouting resistance, low alpha-amylase and seed color in Iranian bread wheat. BMC Plant Biol. 2022, 22, 300. [Google Scholar] [CrossRef]
- Kumar, M.; Kumar, S.; Sandhu, K.S.; Kumar, N.; Saripalli, G.; Prakash, R.; Nambardar, A.; Sharma, H.; Gautam, T.; Balyan, H.S.; et al. GWAS and genomic prediction for pre-harvest sprouting tolerance involving sprouting score and two other related traits in spring wheat. Mol. Breed. 2023, 43, 14. [Google Scholar] [CrossRef]
- Vetch, J.M.; Stougaard, R.N.; Martin, J.M.; Giroux, M.J. Review: Revealing the genetic mechanisms of pre-harvest sprouting in hexaploid wheat (Triticum aestivum L.). Plant Sci. 2019, 281, 180–185. [Google Scholar] [CrossRef]
- Ali, A.; Cao, J.; Jiang, H.; Chang, C.; Zhang, H.-P.; Sheikh, S.; Shah, L.; Ma, C. Unraveling Molecular and Genetic Studies of Wheat (Triticum aestivum L.) Resistance against Factors Causing Pre-Harvest Sprouting. Agronomy 2019, 9, 117. [Google Scholar] [CrossRef]
- Gupta, P.K.; Balyan, H.S.; Sharma, S.; Kumar, R. Genetics of yield, abiotic stress tolerance and biofortification in wheat (Triticum aestivum L.). Theor. Appl. Genet. 2020, 133, 1569–1602. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Sehgal, V.S.; Li, J.; Lin, M.; Gill, B.S.; Harold, T.; Bai, G. Cloning and characterization of a critical regulator for pre-harvest sprouting in wheat. Genetics 2013, 195, 263–273. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, S.; Abe, F.; Kawahigashi, H.; Nakazono, K.; Tagiri, A.; Matsumoto, T.; Utsugi, S.; Ogawa, T.; Handa, H.; Ishida, H.; et al. A wheat homolog of MOTHER OF FT AND TFL1 acts in the regulation of germination. Plant Cell 2011, 23, 3215–3229. [Google Scholar] [CrossRef]
- Torada, A.; Koike, M.; Ogawa, T.; Takenouchi, Y.; Tadamura, K.; Wu, J.; Matsumoto, T.; Kawaura, K.; Ogihara, Y. A Causal Gene for Seed Dormancy on Wheat Chromosome 4A Encodes a MAP Kinase Kinase. Curr. Biol. 2016, 26, 782–787. [Google Scholar] [CrossRef]
- Zhang, Y.J.; Miao, X.L.; Xia, X.C.; He, Z.H. Cloning of seed dormancy genes (TaSdr) associated with tolerance to pre-harvest sprouting in common wheat and development of a functional marker. Theor. Appl. Genet. 2014, 127, 855–866. [Google Scholar] [CrossRef]
- Wei, W.; Min, X.; Shan, S.; Jiang, H.; Cao, J.; Li, L.; Wang, J.; Wang, S.; Zhu, Y.; Lu, J.; et al. Isolation and characterization of TaQsd1 genes for period of dormancy in common wheat (Triticum aestivum L.). Mol. Breed. 2019, 39, 150. [Google Scholar] [CrossRef]
- Ashikawa, I.; Mori, M.; Nakamura, S.; Abe, F. A transgenic approach to controlling wheat seed dormancy level by using Triticeae DOG1-like genes. Transgenic Res. 2014, 23, 621–629. [Google Scholar] [CrossRef]
- Yang, Y.; Zhao, X.L.; Xia, L.Q.; Chen, X.M.; Xia, X.C.; Yu, Z.; He, Z.H.; Roder, M. Development and validation of a Viviparous-1 STS marker for pre-harvest sprouting tolerance in Chinese wheats. Theor. Appl. Genet. 2007, 115, 971–980. [Google Scholar] [CrossRef]
- McCarty, D.R.; Hattori, T.; Carson, C.B.; Vasil, V.; Lazar, M.; Vasil, I.K. The Viviparous-1 developmental gene of maize encodes a novel transcriptional activator. Cell 1991, 66, 895–905. [Google Scholar] [CrossRef]
- Liu, S.; Li, L.; Wang, W.; Xia, G.; Liu, S. TaSRO1 interacts with TaVP1 to modulate seed dormancy and pre-harvest sprouting resistance in wheat. J. Integr. Plant Biol. 2024, 66, 36–53. [Google Scholar] [CrossRef]
- Chen, W.; Wang, W.; Lyu, Y.; Wu, Y.; Huang, P.; Hu, S.; Wei, X.; Jiao, G.; Sheng, Z.; Tang, S.; et al. OsVP1 activates Sdr4 expression to control rice seed dormancy via the ABA signaling pathway. Crop J. 2021, 9, 68–78. [Google Scholar] [CrossRef]
- Chang, C.; Feng, J.M.; Si, H.Q.; Yin, B.; Zhang, H.P.; Ma, C.X. Validating a novel allele of viviparous-1 (Vp-1Bf) associated with high seed dormancy of Chinese wheat landrace. Mol. Breed. 2010, 25, 517–525. [Google Scholar] [CrossRef]
- Yang, Y.; Zhang, C.L.; Liu, S.X.; Sun, Y.Q.; Meng, J.Y.; Xia, L.Q. Characterization of the rich haplotypes of Viviparous-1A in Chinese wheats and development of a novel sequence-tagged site marker for pre-harvest sprouting resistance. Mol. Breed. 2014, 33, 75–88. [Google Scholar] [CrossRef]
- Appels, R.; Eversole, K.; Stein, N.; Feuillet, C.; Keller, B.; Rogers, J.; Pozniak, C.J.; Choulet, F.; Distelfeld, A.; Poland, J.; et al. Shifting the limits in wheat research and breeding using a fully annotated reference genome. Science 2018, 361, eaar7191. [Google Scholar]
- Zhu, T.; Wang, L.; Rimbert, H.; Rodriguez, J.C.; Deal, K.R.; De Oliveira, R.; Choulet, F.; Keeble-Gagnère, G.; Tibbits, J.; Rogers, J.; et al. Optical maps refine the bread wheat Triticum aestivum cv. Chinese Spring genome assembly. Plant J. 2021, 107, 303–314. [Google Scholar] [CrossRef]
- Sato, K.; Abe, F.; Mascher, M.; Haberer, G.; Gundlach, H.; Spannagl, M.; Shirasawa, K.; Isobe, S. Chromosome-scale genome assembly of the transformation-amenable common wheat cultivar ‘Fielder’. DNA Res. 2021, 28, dsab008. [Google Scholar] [CrossRef]
- Shi, X.; Cui, F.; Han, X.; He, Y.; Zhao, L.; Zhang, N.; Zhang, H.; Zhu, H.; Liu, Z.; Ma, B.; et al. Comparative genomic and transcriptomic analyses uncover the molecular basis of high nitrogen-use efficiency in the wheat cultivar Kenong 9204. Mol. Plant 2022, 15, 1440–1456. [Google Scholar] [CrossRef]
- Jia, J.; Zhao, G.; Li, D.; Wang, K.; Kong, C.; Deng, P.; Yan, X.; Zhang, X.; Lu, Z.; Xu, S.; et al. Genome resources for the elite bread wheat cultivar Aikang 58 and mining of elite homeologous haplotypes for accelerating wheat improvement. Mol. Plant 2023, 16, 1893–1910. [Google Scholar] [CrossRef]
- Jiao, C.; Xie, X.; Hao, C.; Chen, L.; Xie, Y.; Garg, V.; Zhao, L.; Wang, Z.; Zhang, Y.; Li, T.; et al. Pan-genome bridges wheat structural variations with habitat and breeding. Nature 2025, 637, 384–393. [Google Scholar] [CrossRef]
- Li, G.; Ren, Y.; Yang, Y.; Chen, S.; Zheng, J.; Zhang, X.; Li, J.; Chen, M.; Sun, X.; Lv, C.; et al. Genomic analysis of Zhou8425B, a key founder parent, reveals its genetic contributions to elite agronomic traits in wheat breeding. Plant Commun. 2024, 6, 101222. [Google Scholar] [CrossRef]
- Ma, S.; Wang, M.; Wu, J.; Guo, W.; Chen, Y.; Li, G.; Wang, Y.; Shi, W.; Xia, G.; Fu, D.; et al. WheatOmics: A platform combining multiple omics data to accelerate functional genomics studies in wheat. Mol. Plant 2021, 14, 1965–1968. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Pang, Y.; Dong, L.; Li, A.; Kong, L.; Liu, S. Allelic impacts on pre-harvest sprouting resistance and favorable haplotypes in TaPHS1 of Chinese wheat accessions. Crop J. 2020, 8, 515–521. [Google Scholar] [CrossRef]
- Huang, T.; Qu, B.; Li, H.-P.; Zuo, D.-Y.; Zhao, Z.-X.; Liao, Y.-C. A maize viviparous 1 gene increases seed dormancy and preharvest sprouting tolerance in transgenic wheat. J. Cereal Sci. 2012, 55, 166–173. [Google Scholar] [CrossRef]
- Vetch, J.M.; Stougaard, R.N.; Martin, J.M.; GirouT, M. Allelic impacts of TaPHS1, TaMKK3, and Vp1B3 on preharvest sprouting of Northern Great plains winter wheats. Crop Sci. 2019, 59, 140–149. [Google Scholar] [CrossRef]
Cultivars | Reference Genomes | Cultivars | Reference Genomes |
---|---|---|---|
AK58 | doi:10.1016/j.molp.2023.10.015 | KN9204 | doi:10.1016/j.molp.2022.07.008 |
AMN | doi:10.1038/s41586-024-08277-0 | MZM | doi:10.1038/s41586-024-08277-0 |
BJ8 | doi:10.1038/s41586-024-08277-0 | S4185 | doi:10.1038/s41586-024-08277-0 |
CM104 | doi:10.1038/s41597-024-03527-2 | XN6028 | doi:10.1038/s41586-024-08277-0 |
CM42 | doi:10.1038/s41586-024-08277-0 | XY6 | doi:10.1038/s41586-024-08277-0 |
CS | doi:10.1126/science.aar7191 | YM158 | doi:10.1038/s41586-024-08277-0 |
Fielder | doi:10.1093/dnares/dsab008 | Zhou8425B | doi:10.1016/j.xplc.2024.101222 |
HD6172 | doi:10.1038/s41586-024-08277-0 | ZM16 | doi:10.1038/s41586-024-08277-0 |
JM22 | doi:10.1038/s41586-024-08277-0 | ZM22 | doi:10.1038/s41586-024-08277-0 |
JM47 | doi:10.1038/s41586-024-08277-0 | ZM366 | doi:10.1038/s41586-024-08277-0 |
Source | DF | SS | MS | F-Value | p-Value |
---|---|---|---|---|---|
Gen | 19 | 190,574.97 | 10,030.26 | 316.31 | 0 |
Env | 3 | 340.96 | 113.65 | 3.58 | 1.53 × 10−2 |
GE_interaction | 57 | 29,690.11 | 520.88 | 16.43 | 0 |
H2 per mean | 0.95 |
Source | DF | SS | MS | F-Value | p-Value |
---|---|---|---|---|---|
Gen | 303 | 1872960.25 | 6181.39 | 105.18 | 0 |
Env | 2 | 416.57 | 208.29 | 3.54 | 2.91 × 10−2 |
GE_interaction | 606 | 561658.50 | 926.83 | 15.77 | 0 |
H2 per mean | 0.87 |
Markers | Sequence (5′-3′) | Note |
---|---|---|
TaVP1-B_CDS1548_HEX | GATGGATGGCAAGAGGTGTTC | hap1 genotype (TGG) |
TaVP1-B_CDS1548_FAM | GATGGATGGCAAGAGGTGTTT | hap2 genotype (GAA) |
TaVP1-B_CDS1548_R | CAGGCGTCGGCTTCCAAT | Common marker |
Accessions | Haplotype 1 | SR_ZK22 (%) | SR_ZK23 (%) | SR_XY23 (%) |
---|---|---|---|---|
Huayu3568 | hap1 | 5.31 | 9.74 | 2.68 |
Lunxuan162 | hap1 | 0.00 | 1.52 | 0.00 |
Neixiang184 | hap1 | 7.06 | 3.61 | 2.11 |
Ningmai16 | hap1 | 3.58 | 0.72 | 0.00 |
Pingan3 | hap1 | 2.57 | 0.00 | 0.00 |
Qimin6 | hap1 | 8.95 | 2.21 | 0.00 |
Shengxuan6 | hap1 | 6.95 | 6.36 | 1.56 |
Shuangji2 | hap1 | 8.40 | 1.92 | 6.25 |
Sui1615 | hap1 | 0.00 | 0.00 | 0.00 |
Taimai1218 | hap1 | 2.93 | 2.59 | 4.87 |
Tianmai159 | hap1 | 5.64 | 1.75 | 0.00 |
Tianmin116 | hap1 | 3.27 | 0.00 | 0.00 |
Zhongxin18 | hap1 | 0.72 | 8.36 | 6.57 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, D.; Xie, J.; Wang, J.; Mu, M.; Xiong, H.; Ma, F.; Li, P.; Jia, M.; Li, S.; Li, J.; et al. Unraveling Allelic Impacts on Pre-Harvest Sprouting Resistance in TaVP1-B of Chinese Wheat Accessions Using Pan-Genome. Plants 2025, 14, 504. https://doi.org/10.3390/plants14040504
Wang D, Xie J, Wang J, Mu M, Xiong H, Ma F, Li P, Jia M, Li S, Li J, et al. Unraveling Allelic Impacts on Pre-Harvest Sprouting Resistance in TaVP1-B of Chinese Wheat Accessions Using Pan-Genome. Plants. 2025; 14(4):504. https://doi.org/10.3390/plants14040504
Chicago/Turabian StyleWang, Danfeng, Jinjin Xie, Jingwen Wang, Mengdi Mu, Haifeng Xiong, Fengshuo Ma, Peizhen Li, Menghan Jia, Shuangjing Li, Jiaxin Li, and et al. 2025. "Unraveling Allelic Impacts on Pre-Harvest Sprouting Resistance in TaVP1-B of Chinese Wheat Accessions Using Pan-Genome" Plants 14, no. 4: 504. https://doi.org/10.3390/plants14040504
APA StyleWang, D., Xie, J., Wang, J., Mu, M., Xiong, H., Ma, F., Li, P., Jia, M., Li, S., Li, J., Zhu, M., Li, P., Guan, H., Zhang, Y., & Li, H. (2025). Unraveling Allelic Impacts on Pre-Harvest Sprouting Resistance in TaVP1-B of Chinese Wheat Accessions Using Pan-Genome. Plants, 14(4), 504. https://doi.org/10.3390/plants14040504