Comparative Transcriptomic Analyses of Anthocyanin Biosynthesis Genes in Eggplant Under Low Temperature and Weak Light
Abstract
1. Introduction
2. Results
2.1. Anthocyanin Content in Different Parts of Eggplant at Seedling, Flowering, and Fruit Stages Under Low Temperature and Weak Light
2.2. Analysis of Transcriptome in Eggplant Pericarp Under Low-Temperature and Weak-Light Stress
2.3. Analysis of Differentially Expressed Genes in Eggplant Pericarp Under Low-Temperature and Weak-Light Stress
2.4. Expression Pattern of Anthocyanin Biosynthesis-Related Genes in Eggplant Under Low Temperature and Weak Light
2.5. Identification of Transcriptional Factors Regulating Anthocyanin Biosynthesis in Eggplant Under Low Temperature and Weak Light
2.6. Real-Time qPCR of DEGs Related to Anthocyanin Biosynthesis in Eggplant
3. Discussion
3.1. Anthocyanin Content of Eggplant Under Low Temperature and Weak Light
3.2. Regulation of Anthocyanin Biosynthesis of Eggplant Under Low Temperature and Weak Light
4. Materials and Methods
4.1. Experimental Materials
4.2. Experimental Methods
4.3. Index Testing
4.4. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Cammareri, M.; Frary, A.; Frary, A.; Grandillo, S. Genetic and Biotechnological Approaches to Improve Fruit Bioactive Content: A Focus on Eggplant and Tomato Anthocyanins. Int. J. Mol. Sci. 2024, 25, 6811. [Google Scholar] [CrossRef]
- Lu, Z.; Wang, X.; Jin, B. Plant Anthocyanins: Classification, Biosynthesis, Regulation, Bioactivity, and Health Benefits. Plant Physiol. Biochem. 2024, 217, 109268. [Google Scholar] [CrossRef]
- Holton, T.; Cornish, E. Genetics and Biochemistry of Anthocyanin Biosynthesis. Plant Cell 1995, 7, 1071–1083. [Google Scholar] [CrossRef]
- Al Sane, K.O.; Hesham, A.E.-L. Biochemical and Genetic Evidences of Anthocyanin Biosynthesis and Accumulation in a Selected Tomato Mutant. Rend. Lincei 2015, 26, 293–306. [Google Scholar] [CrossRef]
- Hong, L.; Qian, Q.; Tang, D.; Wang, K.; Li, M.; Cheng, Z. A Mutation in the Rice Chalcone Isomerase Gene Causes the Golden Hull and Internode 1 Phenotype. Planta 2012, 236, 141–151. [Google Scholar] [CrossRef]
- Wang, X.; Wu, J.; Guan, M.; Zhao, C.; Geng, P.; Zhao, Q. Arabidopsis MYB4 Plays Dual Roles in Flavonoid Biosynthesis. Plant J. 2020, 101, 637–652. [Google Scholar] [CrossRef] [PubMed]
- Yonekura-Sakakibara, K.; Higashi, Y.; Nakabayashi, R. The Origin and Evolution of Plant Flavonoid Metabolism. Front. Plant Sci. 2019, 10, 943. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Yu, Q.; Shen, W.; El, M.; Zhao, X.; Gmitter, F. Functional study of CHS gene family members in citrus revealed a novel CHS gene affecting the production of flavonoids. BMC Plant Biol. 2018, 18, 189. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; He, Y.-J.; Zhou, L.; Liu, Y.; Jiang, M.; Ren, L.; Chen, H. Transcriptome Profiling of Genes Related to Light-Induced Anthocyanin Biosynthesis in Eggplant (Solanum melongena L.) before Purple Color Becomes Evident. BMC Genom. 2018, 19, 201. [Google Scholar] [CrossRef]
- Albert, N.; Davies, K.; Lewis, D.; Zhang, H.; Montefiori, M.; Brendolise, C.; Boase, M.; Ngo, H.; Jameson, P.; Schwinn, K. A conserved network of transcriptional activators and repressors regulates anthocyanin pigmentation in eudicots. Plant Cell 2014, 26, 962–980. [Google Scholar] [CrossRef]
- Xu, H.; Nan, W.; Liu, J.; Qu, C.; Chen, X. The molecular mechanism underlying anthocyanin metabolism in apple using the MdMYB16 and MdbHLH33 genes. Plant Mol. Biol. 2017, 94, 149–165. [Google Scholar] [CrossRef]
- Xie, X.-B.; Li, S.; Zhang, R.-F.; Zhao, J.; Chen, Y.C.; Zhao, Q.; Yao, Y.; You, C.; Zhang, X.; Hao, Y. The bHLH transcription factor MdbHLH3 promotes anthocyanin accumulation and fruit colouration in response to low temperature in apples. Plant Cell Environ. 2012, 35, 1884–1897. [Google Scholar] [CrossRef]
- Chen, L.; Hu, B.; Qin, Y.; Hu, G.; Zhao, J. Advance of the negative regulation of anthocyanin biosynthesis by MYB transcription factors. Plant Physiol. Biochem. 2019, 136, 178–187. [Google Scholar] [CrossRef] [PubMed]
- Shvarts, M.; Borochov, A.; Weiss, D. Low temperature enhances petunia flower pigmentation and induces chalcone synthase gene expression. Physiol. Plant. 1997, 99, 67–72. [Google Scholar] [CrossRef]
- Mori, K.; Sugaya, S.; Gemma, H. Decreased anthocyanin biosynthesis in grape berries grown under elevated night temperature condition. Sci. Hortic. 2005, 105, 319–330. [Google Scholar] [CrossRef]
- Liu, X.; Zhao, T.; Yuan, L. A Fruit-Expressed MYB Transcription Factor Regulates Anthocyanin Biosynthesis in Atropa belladonna. Int. J. Mol. Sci. 2024, 25, 4963. [Google Scholar] [CrossRef] [PubMed]
- Shi, S. R2R3-MYB transcription factor SmMYB75 promotes anthocyanin biosynthesis in eggplant (Solanum melongena L.). Sci. Hortic. 2021, 282, 110020. [Google Scholar] [CrossRef]
- Zhou, L.; He, Y.; Li, J.; Liu, Y.; Chen, H. CBFs Function in Anthocyanin Biosynthesis by Interacting with MYB113 in Eggplant (Solanum melongena L.). Plant Cell Physiol. 2019, 61, 416–426. [Google Scholar] [CrossRef] [PubMed]
- Yu, M.; Man, Y.; Wang, Y. Light- and Temperature-Induced Expression of an R2R3-MYB Gene Regulates Anthocyanin Biosynthesis in Red-Fleshed Kiwifruit. Int. J. Mol. Sci. 2020, 20, 5228. [Google Scholar] [CrossRef]
- An, J.; Zhang, X.; Bi, S.; You, C.; Wang, X.; Hao, Y. The ERF transcription factor MdERF38 promotes drought stress-induced anthocyanin biosynthesis in apple. Plant J. 2020, 101, 573–589. [Google Scholar] [CrossRef]
- Chen, Y.; Wu, P.; Zhao, Q.; Tang, Y.; Chen, Y.; Li, M.; Jiang, H.; Wu, G. Overexpression of a Phosphate Starvation Response AP2/ERF Gene From Physic Nut in Arabidopsis Alters Root Morphological Traits and Phosphate Starvation-Induced Anthocyanin Accumulation. Front. Plant Sci. 2018, 9, 1186. [Google Scholar] [CrossRef] [PubMed]
- Luo, L.; Molthoff, J.; Li, Q.; Liu, Y.; Luo, S.; Li, N.; Xuan, S.; Wang, Y.; Shen, S.; Bovy, A.G.; et al. Identification of candidate genes associated with less-photosensitive anthocyanin phenotype using an EMS mutant (pind) in eggplant (Solanum melongena L.). Front. Plant Sci. 2023, 14, 1282661. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Zhang, A.; Wu, X.; Zhu, Z.; Yang, Z.; Zhu, Y.; Zha, D. Transcriptome analysis revealed expression of genes related to anthocyanin biosynthesis in eggplant (Solanum melongena L.) under high-temperature stress. BMC Plant Biol. 2019, 19, 387. [Google Scholar] [CrossRef] [PubMed]
- Andrea, M.; Francesco, E.F.; Sergio, I.; Alessandra, G.; Maria, A.M.; Cinzia, C.; Lorenzo, B.; Arianna, M.; Cecilia, C.; Patrizia, R.; et al. Identification of a New R3 MYB Type Repressor and Functional Characterization of the Members of the MBW Transcriptional Complex Involved in Anthocyanin Biosynthesis in Eggplant (S. melongena L.). PLoS ONE 2020, 15, e0232986. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Wang, Z.; Ge, H.; Liu, Y.; Chen, H. Weighted Gene Co-Expression Network Analysis Identifies Genes Related to Anthocyanin Biosynthesis and Functional Verification of Hub Gene SmWRKY44. Plant Sci. 2021, 309, 110935. [Google Scholar] [CrossRef] [PubMed]
- Shao, W.; Liu, Y.; Han, H.; Chen, H. Cloning and Expression Analysis of an Anthocyanin-related Transcription Factor Gene SmMYB in Eggplant. Acta Hortic. Sin. 2013, 40, 467–478. [Google Scholar] [CrossRef]
- Zhang, Q.; Zhai, J.; Shao, L.; Lin, W.; Peng, C. Corrigendum: Accumulation of Anthocyanins: An Adaptation Strategy of Mikania micrantha to Low Temperature in Winter. Front. Plant Sci. 2020, 10, 1796. [Google Scholar] [CrossRef] [PubMed]
- Naing, A.H.; Lee, J.H.; Park, K.I.; Kim, K.; Chung, M.Y.; Kim, C.K. Transcriptional Control of Anthocyanin Biosynthesis Genes and Transcription Factors Associated with Flower Coloration Patterns in Gerbera Hybrida. 3 Biotech 2018, 8, 65. [Google Scholar] [CrossRef]
- Gaiotti, F.; Pastore, C.; Filippetti, I.; Lovat, L.; Belfiore, N.; Tomasi, D. Low Night Temperature at Veraison Enhances the Accumulation of Anthocyanins in Corvina Grapes (Vitis vinifera L.). Sci. Rep. 2018, 8, 8719. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.; Yuan, Y.; Tang, Z.; Huang, Y.; Xu, Q. Retrotransposon promoter of Ruby1 controls both light- and cold-induced accumulation of anthocyanins in blood orange. Plant Cell Environ. 2019, 42, 3092–3104. [Google Scholar] [CrossRef] [PubMed]
- Guan, L.; Dai, Z.; Wu, B.-H.; Wu, J.; Merlin, I.; Hilbert, G.; Renaud, C.; Gomès, E.; Edwards, E.; Li, S.-H.; et al. Anthocyanin Biosynthesis Is Differentially Regulated by Light in the Skin and Flesh of White-Fleshed and Teinturier Grape Berries. Planta 2016, 243, 23–41. [Google Scholar] [CrossRef] [PubMed]
- Weber, S.; Damerow, L.; Kunz, A. Anthocyanin synthesis and light utilisation can be enhanced by reflective mulch—Visualisation of light penetration into a tree canopy. J. Plant Physiol. 2019, 233, 52–57. [Google Scholar] [CrossRef]
- Liu, Y.; Lin-Wang, K.; Deng, C.; Warran, B.; Wang, L.; Yu, B.; Yang, H.; Wang, J.; Espley, R.; Zhang, J. Comparative Transcriptome Analysis of White and Purple Potato to Identify Genes Involved in Anthocyanin Biosynthesis. PLoS ONE 2015, 10, e0129148. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Li, K.; Li, Y.; Zhao, X.; Wang, L. MYB Transcription Factors as Regulators of Secondary Metabolism in Plants. Biology 2020, 9, 61. [Google Scholar] [CrossRef]
- Chen, J.; Jiang, S.; Yang, F. The MYB Transcription Factor SmMYB113 Directly Regulates Ethylene-Dependent Flower Abscission in Eggplant. Plant Physiol. Biochem. 2024, 209, 108544. [Google Scholar] [CrossRef]
- Ito, M. Conservation and diversification of three-repeat Myb transcription factors in plants. J. Plant Res. 2005, 118, 61–69. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Zhang, X.; Wu, C.; Li, P.; Zhu, B. The role of MYB proto-oncogene like 2 in tamoxifen resistance in breast cancer. J. Mol. Histol. 2020, 52, 21–30. [Google Scholar] [CrossRef]
- Wang, L.; Pan, D.; Meng, L.; Yakubu, A.; Li, J.; Lin, J.; Chen, S.; Chen, W. Regulation of Anthocyanin Biosynthesis in Purple Leaves of Zijuan Tea (Camellia sinensis var. kitamura). Int. J. Mol. Sci. 2017, 18, 833. [Google Scholar] [CrossRef]
- Meng, F.; Yang, C.; Cao, J.; Chen, H.; Pang, J.; Zhao, Q.; Wang, Z.; Fu, Z.; Liu, J. A bHLH transcription activator regulates defense signaling by nucleo-cytosolic trafficking in rice. J. Integr. Plant Biol. 2020, 62, 1552–1573. [Google Scholar] [CrossRef] [PubMed]
- Zhao, R.; Song, X.; Yang, N.; Chen, L.; Zhao, K. Expression of the subgroup IIIf bHLH transcription factor CpbHLH1 from Chimonanthus praecox (L.) in transgenic model plants inhibits anthocyanin accumulation. Plant Cell Rep. 2020, 39, 891–907. [Google Scholar] [CrossRef]
- Zhang, S.; Qian, Z.; Liu, J.; Zhang, X.; Si, J. Analysis on stability and antioxidant capacity of color-related components from Dendrobium officinale flower. China J. Chin. Mater. Medica 2018, 43, 2025–2031. [Google Scholar] [CrossRef]
- Wrolstad, R.E.; Durst, R.W.; Lee, J. Tracking Color and Pigment Changes in Anthocyanin Products. Trends Food Sci. Technol. 2005, 16, 423–428. [Google Scholar] [CrossRef]
- FULEKI, T.; FRANCIS, F.J. Quantitative Methods for Anthocyanins. 4. Determination of Individual Anthocyanins in Cranberry and Cranberry Products. J. Food Sci. 1968, 33, 471–478. [Google Scholar] [CrossRef]
Sample | Total Raw Reads (M) | Total Clean Reads (M) | Clean Base (G) | Mapped to Genome (%) | Unique Mapped (%) | Clean Reads Q30 (%) | Clean Reads’ GC Content (%) |
---|---|---|---|---|---|---|---|
CK1 | 69.68 | 65.95 | 9.89 | 95.38 | 92.25 | 90.68 | 43.09 |
CK2 | 48.78 | 45.78 | 6.87 | 95.09 | 92.16 | 89.7 | 43.16 |
CK3 | 64.04 | 58.07 | 8.71 | 94.98 | 91.88 | 89.99 | 43.09 |
LT1 | 56.33 | 53.49 | 8.02 | 95.01 | 91.94 | 89.91 | 42.86 |
LT2 | 68.61 | 64.29 | 9.64 | 95.14 | 92.06 | 90.45 | 42.9 |
LT3 | 69.25 | 64.30 | 9.64 | 94.92 | 91.80 | 90.19 | 42.86 |
WL1 | 59.45 | 56.08 | 8.41 | 95.06 | 92.04 | 89.89 | 43.00 |
WL2 | 50.79 | 47.42 | 7.11 | 95.00 | 91.79 | 89.86 | 42.88 |
WL3 | 58.67 | 55.79 | 8.37 | 95.06 | 92.06 | 89.93 | 42.87 |
LW1 | 56.23 | 53.55 | 8.03 | 95.15 | 91.89 | 89.85 | 42.91 |
LW2 | 57.93 | 54.39 | 8.16 | 94.84 | 91.75 | 89.42 | 42.95 |
LW3 | 67.68 | 64.27 | 9.64 | 95.22 | 92.04 | 90.19 | 42.97 |
Genes | Product Length | Primer | Primer Sequence (5′-3′) | Tm |
---|---|---|---|---|
Actin | 145 | F | GTCGGAATGGGACAGAATG | 60.61 |
R | GTGCCTCAGTCAGGGAACAGGGT | 58.22 | ||
Smechr1002213 | 101 | F | TGCTTCGGATGAAGTGGATCT | 60.14 |
R | ACCAGCAATAAGTGACCATCTG | 60.61 | ||
Smechr0601485 | 255 | F | TTACCGGGACGAACAGAT | 59.82 |
R | GATGAAAGTTGTGGTGAGCT | 60.04 | ||
Smechr0202922 | 213 | F | ACGGCTAGTGAAAATGGGA | 59.83 |
R | CTTGTGGGTTACGGGGTC | 59.83 | ||
Smechr0201820 | 190 | F | GAGTTGTAGGCTTCGTTGGAC | 58.93 |
R | AGATCAAGAAGATCAAGGCG | 55.25 | ||
Smechr0700238 | 201 | F | TGGCTTGGAAGGTTTTCGC | 60.01 |
R | GAAGAACCAACAACATCTGCCAC | 60.01 | ||
Smechr0602425 | 92 | F | CTTCAAGCTCTTCTTGGAAATCG | 60.18 |
R | AAGCCTCCTTTCCCATTGTCC | 60.25 | ||
Smechr0800233 | 89 | F | CTTAAGCCGGGACTCAAG | 60.18 |
R | ACCATCGACTACCCAAAAG | 59.96 | ||
Smechr0201643 | 162 | F | TCTTCGTCCGTCACAGTCCATAG | 59.76 |
R | AGCCGTCTCAAACGTGCCTAG | 60.13 | ||
Smechr0401071 | 129 | F | CTGAAGCTGCTGCTAGAGCT | 60.13 |
R | GATCATTTCCAGCGCCT | 58.64 | ||
Smechr0400178 | 114 | F | AAGGACTAGAGCTGAATCATGC | 59.45 |
R | TCAAGAAGCGCTGCCAA | 60.04 | ||
Smechr0802561 | 135 | F | AGTCTGTATCACCAGCGCAG | 59.83 |
R | ACATAGGAGCCGGAACTGT | 58.01 | ||
Smechr1002540 | 101 | F | ACATTCCACCTGAAGTTACAGC | 60 |
R | GATTGGAGTACTAAAGGGCC | 60.18 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shen, B.; Wu, H.; Xie, X.; Zhao, B.; Chen, P.; Ao, D.; Pan, H.; Lin, B. Comparative Transcriptomic Analyses of Anthocyanin Biosynthesis Genes in Eggplant Under Low Temperature and Weak Light. Plants 2025, 14, 478. https://doi.org/10.3390/plants14030478
Shen B, Wu H, Xie X, Zhao B, Chen P, Ao D, Pan H, Lin B. Comparative Transcriptomic Analyses of Anthocyanin Biosynthesis Genes in Eggplant Under Low Temperature and Weak Light. Plants. 2025; 14(3):478. https://doi.org/10.3390/plants14030478
Chicago/Turabian StyleShen, Baoying, Hongqi Wu, Xinxin Xie, Bo Zhao, Peiqiang Chen, Deyong Ao, Heli Pan, and Biying Lin. 2025. "Comparative Transcriptomic Analyses of Anthocyanin Biosynthesis Genes in Eggplant Under Low Temperature and Weak Light" Plants 14, no. 3: 478. https://doi.org/10.3390/plants14030478
APA StyleShen, B., Wu, H., Xie, X., Zhao, B., Chen, P., Ao, D., Pan, H., & Lin, B. (2025). Comparative Transcriptomic Analyses of Anthocyanin Biosynthesis Genes in Eggplant Under Low Temperature and Weak Light. Plants, 14(3), 478. https://doi.org/10.3390/plants14030478