Pyramiding Recessive Resistance Genes Enhances Bacterial Leaf Spot Resistance in Peppers by Suppressing in planta Bacterial Growth

Abstract

Bacterial spot of the pepper (BSP) and the tomato (BST) caused by multiple Xanthomonas spp. remains a major constraint to production of both crops worldwide. The widespread breakdown of dominant resistance genes, such as Bs2, due to the emergence of virulent races, like Xanthomonas euvesicatoria P6, has underscored the need for more durable, non-race-specific resistance. The recessive genes, bs5; bs6; and bs8, have emerged as promising alternatives, conferring broad-spectrum resistance without triggering a hypersensitive response. In this study, we systematically evaluated the individual and combinatorial effects of these three recessive resistance genes against three Xanthomonas species, X. euvesicatoria (Xe), X. hortorum pv. gardneri (Xhg), and X. perforans (Xp). Using near-isogenic lines (NILs) developed in the susceptible Early Calwonder (ECW) background, we assessed the in planta bacterial population growth and symptom development across a panel of eight genotypes carrying different gene combinations. Our results demonstrate that bs5, particularly when combined with either bs6 or bs8, significantly reduces bacterial growth and disease severity across all three Xanthomonas species. The triple-stacked line (ECW568 (i.e., bs5, bs6, and bs8)) consistently displayed the strongest suppression of pathogen proliferation and symptom development. By contrast, bs6 and bs8, alone or in combination, were largely ineffective. In some cases, combining bs6 with bs8 was less effective than bs8 alone. These findings reinforce the central role of bs5 in conferring quantitative resistance and highlight the additive benefit of pyramiding recessive resistance genes. Furthermore, we have demonstrated that these recessive resistance genes are effective in limiting the ability of the emerging pathogen, X. perforans, to grow in planta, and thus are predicted to offer a high level of resistance in the field. Our work provides key insights for breeding durable, broad-spectrum resistance into commercial pepper cultivars and offers a framework for integrated disease management strategies in the face of rapidly evolving bacterial pathogens

1. Introduction

Bacterial spot of the tomato (BST) and the pepper (BSP) caused by Xanthomonas spp. are very destructive diseases affecting pepper (Capsicum annuum) and tomato (Solanum lycopersicum L.) production worldwide [1,2]. BSP can lead to yield losses of up to 44% in peppers [3], whereas BST can cause yield losses close to 50% in tomatoes [4]. BSP and BST are caused by four bacterial species, Xe, Xv, Xp, and Xhg [2,5,6]. Historically, strains of Xe, Xv, and Xhg were considered pathogenic on both the pepper and the tomato, while Xp was thought to infect only the tomato [5]. However, the recent isolation of Xp strains from pepper fields in Alabama and Florida indicates a host range expansion for this species [6,7].

BSP manifests as brown, angular, water-soaked lesions on leaves, stems, and fruit, often resulting in defoliation and significant reductions in marketable fruit yield [8,9,10]. The disease is particularly severe in tropical and subtropical regions, where high temperatures and frequent rainfall favor its development [2,11]. The pathogen spreads via wind-driven rain, irrigation splash, and contaminated farm equipment, and it can persist in crop residues, weeds, and volunteer plants [12]. While copper-based bactericides have traditionally been used for BSP management, the emergence of copper-tolerant strains has reduced their efficacy. As a result, the development and deployment of resistant pepper varieties has become one of the most effective, environmentally sustainable, and economically viable strategies for controlling BSP [13].

Differential reactions in the pepper and tomato genotypes have delineated pathogenic races of Xanthomonas, with four races identified in the tomato and eleven races (P0 to P10) in the pepper [13]. To date, six monogenic dominant hypersensitive resistance genes (BsT, Bs1, Bs2, Bs3, Bs4C, Bs7) and three non-hypersensitive recessive resistance genes (bs5, bs6, bs8) have been identified in the pepper to combat bacterial leaf spot (BLS) [14]. Until the early 2000s, most commercial pepper cultivars relied on Bs2 resistance to manage BLS. However, as bacterial populations evolved, the effectiveness of Bs2-mediated resistance declined, leading to its breakdown within a few years of widespread use [13,15]. Understanding the limitations of relying on a single resistance gene, breeding programs focused on pyramiding resistance genes in combinations, such as Bs2 + Bs1 and Bs2 + Bs3, to improve durability [16]. However, the extensive use of these resistance genes exerted strong selective pressure on pathogen populations, leading to the adaptation of bacteria that either lacked the corresponding avr genes or carried mutated alleles to avoid recognition [15]. Despite these efforts, the emergence of race P6, which lacks avrBs1, avrBs2, and avrBs3, has rendered traditional dominant resistance genes in the pepper ineffective, making P6 virulent on all commercial pepper cultivars [17].

To address this challenge, researchers have identified three recessive resistance genes, bs5, bs6, and bs8, which provide alternative mechanisms of resistance against multiple Xanthomonas spp. [14,17]. The two recessive genes, bs5 and bs6, confer broad-spectrum resistance against all races of Xe, including P6 and P10 [17], while bs8 provides resistance against Xhg [14]. Unlike dominant resistance genes, which rely on the hypersensitive response (HR)-mediated recognition of bacterial effectors, bs5, bs6, and bs8 suppress bacterial growth without triggering an HR, offering a durable, non-race-specific resistance mechanism [17,18]. Recent studies have fine-mapped these three recessive resistance genes in the pepper genome, providing essential insights for marker-assisted selection in breeding programs. The bs5 gene was derived from C. annum PI 271322, and localized to a ~535 Kbp interval on chromosome 3; while bs6, originating from the C44 pepper line series (PI 264281 and PI 163192), was mapped to a ~666 Kbp interval on chromosome 6 [19]. Similarly, bs8 was mapped to a 2.3-Mbp region on chromosome 11 [14].

Previous work has demonstrated the efficacy of bs5 and bs6 under specific conditions. For example, Vallejos et al. [18] showed that temperature has a significant impact on the effectiveness of these resistance genes. At 25 °C, both bs5 and bs6 restricted bacterial growth of Xe race P6 in near-isogenic lines ECW50R (bs5) and ECW60R (bs6), with bs5 providing stronger resistance. However, at 30 °C, the ability of either gene alone to limit bacterial growth was significantly reduced, with bs6 performing similarly to the susceptible control (ECW). Despite the negative effect of high temperature on single gene resistance, the combination of bs5 and bs6 demonstrated a synergistic effect, leading to enhanced resistance, even at 30 °C [18].

Recently, Xp has been isolated in pepper production fields, and is considered an emerging plant pathogen. Although copper bactericides are available, it will likely take a relatively short period of time before the strains acquire copper resistance, as has happened for the tomato pathogen [8]. Given it is genetically distinct from Xe [20], it is difficult to extrapolate how the available resistance in the pepper will behave when exposed to the new Xp strains on the pepper. Therefore, it is necessary to determine how Xp responds to the pepper genotypes containing bs5, bs6, and bs8.

In this study, we build on these insights by pyramiding bs5, bs6, and/ or bs8 in the pepper and evaluate their individual and combined contributions to bacterial spot resistance. We challenged a set of NILs, each containing different combinations of these recessive genes, with three Xanthomonas species (Xe, Xp and Xhg). Our objectives were to determine (i) the extent of resistance conferred by each gene alone, (ii) whether combining these genes yields additive or synergistic resistance effects, and (iii) the consistency of these effects across different Xanthomonas species. By conducting replicated experiments and comparing the results across two independent trials, we also aimed to assess the reproducibility of the resistance phenotypes. The findings are discussed in the context of breeding strategies for durable bacterial spot resistance in the pepper.

2. Materials and Methodology

2.1. Plant Genetic Materials

Near isogenic lines in the Early Calwonder (ECW) background carrying recessive resistance genes bs5, bs6, and bs8 were developed through marker-assisted selection. ECW is a bacterial spot-susceptible bell pepper cultivar lacking resistance genes. ECW50R (carrying bs5 introgressed from PI 271322) [18], ECW60R (bs6 introgressed from C. chinense C-44) [19], and ECW80R (bs8 introgressed from PI 163192) [14] were intercrossed to combine loci. First, ECW50R was crossed with ECW60R to obtain F₁ progeny heterozygous for bs5 and bs6. This F₁ was then crossed with ECW80R to introduce bs8, generating progeny heterozygous for all three loci. Self-pollination of these F₁ plants produced a segregating F₂ population, from which individuals homozygous for all three resistance alleles (bs5, bs6, bs8) were identified via molecular markers (

Table 1. Molecular markers used in this study.

Name		Sequence	Position (CM334)	Position (UCD10x)	Polymorphism	Reference
bs5	JW1_F1	ACCGAGTCTCATGCTGTTTC	~760,000	~390,000	CCAAGAG>C delCAAGAG	This study
	JW1_R1	CAACACTTTGCGTACAGATCATT	~760,000	~390,000	CCAAGAG>C delCAAGAG
bs6	190.99_F1/6g_H178.55	TTCTCATTATCCGTATCATTACCC	190,990,000	178,550,000	AA>GG	Sharma et al. [19]
	190.99_R1/6g_H178.55	CGTTCCACAAACGACATCT	190,990,000	178,550,000	AA>GG
bs8	bsh_260.54_F1	GGGGTACTGAGAGTGACCCTA	260,544,417	232,640,000	A>G	This study
	bsh_260.54_R1	CAAAGCCACGTGGTTCCG	260,544,417	232,640,000	A>G

). After additional selfing and selection, a triple homozygous NIL designated ECW568R (bs5, bs6, bs8) was established.

To create a full panel of lines with different gene combinations, ECW568R was backcrossed to the wild-type ECW, and the resulting F1 (heterozygous for bs5, bs6, bs8) was selfed to produce a large F₂ population. Marker screening of the F₂ population identified plants homozygous for each possible combination of the three genes. Eight genotypic classes were selected as follows: (1) ECW5 (bs5), (2) ECW6 (bs6), (3) ECW8 (bs8), (4) ECW56 (bs5, bs6), (5) ECW58 (bs5, bs8), (6) ECW68 (bs6, bs8), (7) ECW568 (bs5, bs6, bs8), and (8) ECW (susceptible control).

2.2. Bacterial Strains and Inoculation

These eight genotypes were then inoculated, separately, with three different Xanthomonas species, Xe157, Xg444, and Xp706. Bacterial cultures were grown on nutrient agar (NA) (Difco^TM, Becton Dickinson & Co, Sparks, MD, USA) at 28 °C for 24 h. Cells from fresh cultures were suspended in sterile tap water and adjusted to 10⁸ CFU/mL by measuring the optical density at OD₆₀₀ = 0.3 using a Spectronic 20 Genesys spectrophotometer (Spectronic Instruments, Rochester, NY, USA). These bacterial suspensions were further diluted in sterile tap water to a final concentration of 10⁵ CFU/mL. Pepper plants (6–8 weeks old) were grown in a climate-controlled greenhouse or an ambient greenhouse. For each pepper genotype × bacterial strain combination, fully expanded young leaves were infiltrated on the abaxial side using a syringe and hypodermic needle with the appropriate bacterial suspension. Each leaf was infiltrated with a bacterial suspension to allow for sampling a small, infiltrated area (~1 cm²). Most experiments were conducted under a high temperature regimen (28–35 °C) to simulate typical warm field conditions conducive to bacterial spot development. However, for Xhg (Xg444), a second set of experiments was also performed in a greenhouse at a lower temperature (18–28 °C), given that Xhg is found in cooler environments [14].

2.3. Experimental Design and Data Collection

The experiment included eight pepper genotypes, each evaluated in most experiments at four time points 0, 3, 6, and 9 days post-inoculation (dpi), resulting in 32 individual plants per trial. For each genotype-day combination, one plant was used, and three leaves were sampled per plant to serve as replicates for bacterial quantification. Leaf samples (1 cm² disks from the infiltrated area) were harvested, and the infiltrated areas were macerated in 1 mL sterile tap water. Serial 10-fold dilutions were plated on NA, and after 3 days of incubation at 28 °C, bacterial colonies were counted to determine population size (CFU/cm² leaf area). Colony counts were log₁₀-transformed for statistical analysis. Symptom development was visually monitored, and representative leaves were photographed between 7–9 dpi to document disease severity (chlorosis/necrosis).

2.4. Statistical Analysis

Data from the two independent experiments were analyzed separately to evaluate the consistency of genotype effects across replicates. Since the relative performance of genotypes was consistent between trials, the results are presented separately in the Figures below to allow for a visual comparison, while the standard error bars in each graph represent variations among the biological replicates within each experiment. For each pathogen, the area under the population progress curve (AUPPC) was calculated for each genotype using the trapezoidal method [21] across 0, 3, 6, and 9 dpi. The resulting AUPPC values were subjected to one-way analysis of variance (ANOVA), followed by Student–Newman–Keuls (SNK) post hoc tests to determine the statistically significant differences among genotypes. All statistical analyses were conducted using the Agricole package of R studio V 4.1.0, and letter groupings (a, b, c, etc.) indicate statistically homogeneous subsets of genotypes at α = 0.05. Unless otherwise noted, data are reported as mean ± standard error, based on three biological replicates per genotype and time point within each experiment. The two experiments were conducted independently under similar conditions and produced reproducible results, confirming the robustness of the genotype performance patterns.

An unstructured correlation structure was also applied to the residuals to account for the repeated measures of leaves coming from the same genotype and for variances across time. If significant interactions were found, a slice test and Tukey’s pairwise comparison procedure were used on the data to further test the significance of interactions (Supplementary Figure and Table S5–S19).

3. Results

3.1. Effect of Recessive Resistance Gene Combinations on Bacterial Multiplication and Disease Development Caused by X. euvesicatoria

Under high-temperature conditions (28–35 °C) conducive to aggressive infection by Xe, significant reductions in bacterial growth were observed in the pepper genotypes carrying bs5. By 6 dpi, ECW5 (bs5 alone) showed a ~33-fold reduction in the in planta Xe population compared to the susceptible ECW control (Figure 1). Stacking bs5 with bs6 or bs8 further enhanced resistance, with ECW56 (bs5 + bs6) and ECW58 (bs5 + bs8) suppressing bacterial growth by ~52-fold and ~35-fold, respectively. The triple-stack ECW568 (bs5 + bs6 + bs8) demonstrated the highest resistance, achieving around a ~60-fold reduction in bacterial titers at 6 dpi. By contrast, genotypes lacking bs5, such as ECW6 (bs6 alone) and ECW68 (bs6 + bs8), supported high bacterial populations statistically indistinguishable from the susceptible control, highlighting the critical role of bs5 in restricting Xe growth. A quantitative analysis using the AUPPC confirmed these observations. ECW568 had the lowest AUPPC values, followed closely by ECW56 and ECW58, with significant statistical separation between genotypes based on a Student–Newman–Keuls (SNK) analysis (

Table 2. Area under the population progress curve (AUPPC) for the Xanthomonas euvesicatoria strain Xe157 in the pepper genotypes incubated under greenhouse conditions ranging from 28 to 35 °C. The AUPPC was calculated from 0 to 9 days post-inoculation using the trapezoidal method. Genotypes include ECW (susceptible control), ECW5 (bs5), ECW6 (bs6), ECW8 (bs8), ECW56 (bs5 + bs6), ECW58 (bs5 + bs8), ECW68 (bs6 + bs8), and ECW568 (bs5 + bs6 + bs8). Different letters indicate statistically significant differences among genotypes based on Student–Newman–Keuls (SNK) multiple comparisons at α = 0.05. Supplementary Table S1 provides the AUPPC data from Experiment 2 to illustrate the reproducibility of the results.

Genotype	AUPPC	SNK Group
ECW568	40.26	c
ECW5	41.53	c
ECW56	42.00	c
ECW58	42.10	c
ECW8	49.11	b
ECW6	50.55	ab
ECW68	50.78	ab
ECW	51.66	a

). A second independent experiment, which further confirms these observations and demonstrates reproducibility, is provided in Supplementary Figure S1 and Supplementary Table S1.

Visual disease symptoms mirrored the bacterial count data. As shown in Figure 2, ECW plants exhibited prominent chlorosis and lesion development at 7 days post-inoculation. By comparison, ECW5 (bs5) and ECW58 (bs5 + bs8) showed moderate symptom reduction. Notably, ECW568 (bs5 + bs6 + bs8) demonstrated near-complete suppression of visible symptoms, remaining green and healthy in appearance. These qualitative symptom observations aligned closely with the quantitative bacterial counts, emphasizing that, although bs5 alone confers strong resistance, stacking it with bs6 or bs8 significantly enhances overall disease suppression. The consistent and reproducible performance of ECW568 across independent trials strongly validates the effectiveness of this gene pyramid.

3.2. Effect of Recessive Resistance Gene Combinations on Multiplication and Disease Development Caused by X. hortorum pv. gardneri

Under cooler incubation conditions (18–28 °C), all pepper genotypes carrying bs5, bs8, or their combinations exhibited substantial reductions in bacterial populations of the Xhg strain Xg444 relative to the susceptible control ECW at 6 dpi. ECW5 (bs5) and ECW8 (bs8) individually reduced bacterial growth by approximately 117-fold and 32-fold, respectively. Combining these genes showed moderate resistance, as ECW58 (bs5 + bs8) showed an approximately 10-fold reduction (Figure 3). The triple-stacked genotype ECW568 (bs5 + bs6 + bs8) displayed the greatest resistance, with a ~140-fold suppression in bacterial multiplication. By comparison, ECW56 (bs5 + bs6) showed significant suppression at ~68-fold, indicating an additive or synergistic interaction. By contrast, genotypes carrying bs6 alone (ECW6) or in combination with bs8 (ECW68) showed limited to no suppression of Xhg; notably, ECW68 even exhibited a slight increase in bacterial populations relative to ECW, suggesting a negative interaction when combining bs6 and bs8 in the absence of bs5.

The AUPPC values reinforced these trends, with ECW568 and ECW56 having the lowest values (

Table 3. Area under the population progress curve (AUPPC) for the Xanthomonas hortorum pv. gardneri strain Xg444 in the pepper genotypes incubated under greenhouse conditions ranging from 18 to 28 °C. The AUPPC was calculated from 0 to 9 days post-inoculation using the trapezoidal method. Genotypes include ECW (susceptible control), ECW5 (bs5), ECW6 (bs6), ECW8 (bs8), ECW56 (bs5 + bs6), ECW58 (bs5 + bs8), ECW68 (bs6 + bs8), and ECW568 (bs5 + bs6 + bs8). Different letters indicate statistically significant differences among genotypes based on Student–Newman–Keuls (SNK) multiple comparisons at α = 0.05. Supplementary Table S2 provides the AUPPC data from Experiment 2 to illustrate the reproducibility of the results.

Genotype	AUPPC	SNK Group
ECW568	46.95	c
ECW5	47.46	c
ECW56	49.00	c
ECW8	50.80	c
ECW58	55.09	b
ECW	56.08	b
ECW6	59.10	ab
ECW68	60.9	a

); a statistical analysis using SNK tests confirmed significant differences among these genotypes (α = 0.05). A second independent experiment, which further confirms these observations and demonstrates reproducibility, is provided in Supplementary Figure S2 and Supplementary Table S2. Overall, these results demonstrate that bs5 and bs8 are effective individually, but their combination offers additive or synergistic protection. By contrast, bs6 appears to have minimal or inconsistent effects under low-temperature conditions. The high reproducibility across experiments reinforces the robustness of bs5- and bs8-mediated resistance to Xhg in cooler environments.

These findings were corroborated by symptom observations on inoculated leaves. By 7 dpi, ECW plants exhibited characteristic water-soaked spots, coalescing into large chlorotic and necrotic patches (Figure 4). ECW5 (bs5) leaves showed only moderate disease with fewer and smaller lesions than ECW. ECW58 (bs5 + bs8) and ECW568 (bs5 + bs6 + bs8) had dramatically reduced symptoms, showing limited to faint chlorotic lesions. These visual results reinforce the quantitative data, highlighting the additive contribution of bs5 and bs8 in suppressing both bacterial growth and symptom expression.

However, in an experiment where plants were challenged with Xg444 under higher temperature conditions (25–35 °C), overall disease severity increased, and even the resistant lines showed elevated bacterial growth. Under those conditions, only the triple combination ECW568 maintained substantially lower Xhg populations compared to ECW and other combinations. Genotypes carrying bs5 alone or in combination with bs8 showed partial suppression, whereas genotypes lacking bs5, including ECW6, ECW8, and ECW68 were essentially ineffective (Supplementary Figure S3). Across both temperature scenarios, ECW568 consistently maintained the lowest in planta bacterial populations.

3.3. Effect of Recessive Resistance Gene Combinations on Multiplication and Disease Development Caused by X. perforans

Under high-temperature conditions (28–35 °C), the pepper genotypes carrying bs5, alone or stacked with bs6 and/or bs8, exhibited significantly lower Xp populations compared to the susceptible control ECW (Figure 5). At 9 dpi, ECW5 (bs5 alone) displayed approximately a 3600-fold reduction. Resistance was enhanced in dual-gene combinations, with ECW58 (bs5 + bs8) and ECW56 (bs5 + bs6) reducing bacterial populations by about 1555-fold and 1606-fold, respectively. The triple-stacked genotype ECW568 (bs5 + bs6 + bs8) exhibited robust bacterial suppression, showing around a 7771-fold reduction relative to ECW. Genotypes lacking bs5, including ECW6 (bs6), ECW8 (bs8), and ECW68 (bs6 + bs8), provided negligible bacterial suppression.

These quantitative findings were confirmed by cumulative bacterial growth measurements (AUPPC;

Table 4. Area under the population progress curve (AUPPC) for the Xanthomonas perforans strain Xp706 in the pepper genotypes under 28–35 °C incubation. The AUPPC was calculated from 0 to 9 days post-inoculation using the trapezoidal method. Genotypes include ECW (susceptible control), ECW5 (bs5), ECW6 (bs6), ECW8 (bs8), ECW56 (bs5 + bs6), ECW58 (bs5 + bs8), ECW68 (bs6 + bs8), and ECW568 (bs5 + bs6 + bs8). Different letters indicate statistically significant differences among genotypes based on Student–Newman–Keuls (SNK) multiple comparisons at α = 0.05. Supplementary Table S4 provides the AUPPC data from Experiment 2 to illustrate the reproducibility of results.

Genotype	AUPPC	SNK Group
ECW568	40.13	d
ECW5	40.22	d
ECW56	42.14	d
ECW58	45.13	c
ECW8	50.45	b
ECW68	58.87	a
ECW6	59.95	a
ECW	60.47	a

), with ECW5 and ECW568 consistently showing the lowest cumulative bacterial populations, followed closely by ECW56 and ECW58. Whereas ECW6, ECW8, and ECW68 showed high AUPPC values similar to the susceptible ECW. A statistical analysis using SNK multiple comparisons confirmed significant differences among the genotypes (α = 0.05). A second independent experiment, which further confirms these observations and demonstrates reproducibility, is provided in Supplementary Figure S4 and Supplementary Table S4. Visual symptom assessments at 9 dpi mirrored these quantitative values (Figure 6). ECW leaves developed severe chlorosis and necrosis, while bs5-containing lines displayed visibly reduced symptoms. ECW5 showed moderate disease, whereas ECW56, ECW58, and particularly ECW568, had minimal lesion development. By contrast, ECW68 was indistinguishable from ECW, reinforcing that stacking bs6 and bs8 without bs5 is ineffective.

4. Discussion

This study demonstrates the effectiveness of pyramiding recessive resistance genes (bs5, bs6, and bs8) to combat bacterial spot disease in the pepper caused by multiple Xanthomonas species. Furthermore, we provide information for the first time on the use of these resistance genes for control of the emerging pepper pathogen, X. perforans. Across two independent experiments with three Xanthomonas spp., we found that bs5 was the critical player in recessive resistance under both moderate and elevated temperature regimes. When combined with bs6 or bs8, bs5 consistently conferred enhanced protection, substantially reducing bacterial populations and minimizing visible disease symptoms. The triple-stacked genotype (ECW568), carrying bs5, bs6, and bs8, exhibited the most robust and consistent suppression of the in planta bacterial multiplication for all three Xanthomonas pathogens, regardless of environmental conditions. These findings underscore the additive or synergistic benefits of gene pyramiding and highlight the utility of recessive resistance alleles in developing durable, broad-spectrum bacterial spot resistance in the pepper.

Although the presence of bs5 was consistently associated with significant reductions in the in planta bacterial multiplication across all three Xanthomonas species (Xe, Xhg, and Xp), particularly under high-temperature conditions, bs6 and bs8 alone provided limited or inconsistent protection. These results align with the findings of Vallejos et al. [18], who demonstrated that, while bs5 alone provided strong partial resistance at moderate temperatures (~25 °C), its effectiveness was significantly compromised at elevated temperatures (30 °C), and that only the combined presence of bs5 and bs6 conferred near-complete resistance under heat stress, indicative of positive epistasis at high temperature. Our findings similarly reinforce their conclusion that gene stacking, especially combining bs5 with other recessive genes, is essential for maintaining stable, effective resistance under challenging environmental conditions.

Recent transcriptomic analyses provide mechanistic insights supporting the broad-spectrum and temperature-resilient nature of bs5-mediated resistance [22]. Specifically, bs5 was found to rapidly activate a robust basal defense network characterized by the upregulation of key genes involved in pathogen-associated molecular pattern-triggered immunity (PTI) [23]. Among these were the pattern recognition receptor FLS2, calcium-dependent signaling components (CDPKs, CaM/CML), NADPH oxidase (RbohD), MAP kinase cascades (MPK3, MPK4), and defense-associated transcription factors (WRKY29, WRKY33, and WRKY22). These genes collectively promote a rapid oxidative burst and an enhanced expression of defense-related genes, such as PR-1, without relying on a classical hypersensitive response. This PTI-centered defense signature, driven by bs5, helps in explaining the stable and non-race-specific nature of resistance observed across the various Xanthomonas spp. Furthermore, the activation of stress-responsive pathways, including jasmonate and ethylene signaling early in infection, along with the modulation of salicylic acid signaling, supports the hypothesis that bs5 resistance remains effective under thermal stress conditions. This mechanistic understanding aligns closely with our observed field phenotypes, providing a robust molecular basis for breeding strategies centered around bs5.

Interestingly, the combination of bs6 and bs8 (ECW68) not only failed to improve resistance but in some cases appeared to enhance bacterial growth, particularly against Xhg at lower temperatures. This suggests a possible antagonistic or epistatic interaction between bs6 and bs8 in the absence of bs5. Such interactions highlight the importance of empirical validation when combining resistance loci, as not all combinations yield additive effects. Breeders should be cautious when deploying gene stacks and consider the functional compatibility of resistance alleles, especially those whose mechanisms are not yet fully characterized.

In contrast to ECW68, the triple-stacked genotype ECW568 showed an approximately 2.5 log-fold reduction in bacterial populations compared to the susceptible control ECW against Xhg, closely matching the performance reported by [14] in their study with genotype PI163192, which also carries the recessive resistance genes bs5, bs6, and bs8. This similarity strongly supports the reproducibility and reliability of resistance mediated by these recessive gene combinations.

The effectiveness of bs5-based combinations against Xp is particularly noteworthy. Once considered a tomato-specific pathogen, Xp has expanded its host range to the pepper in recent years [6,7]. The aggressive nature of this species, coupled with its increasing prevalence in warm production regions, poses a serious challenge to disease management. In our study, the triple-gene combination (ECW568) reduced Xp populations by nearly eight thousand fold in one experiment at day 9 (Figure 4) and consistently outperformed all other genotypes. This result reinforces the need for forward-looking breeding strategies that anticipate pathogen evolution and emerging threats.

Our use of replicated, independently conducted experiments strengthens the reliability of these findings. While quantitative reductions in pathogen load varied somewhat between experiments, particularly for Xp, the relative performance of genotypes remained stable. This consistency supports the robustness of bs5-mediated resistance and validates the use of the AUPPC and the log-transformed bacterial counts as quantitative disease metrics in pepper–Xanthomonas interaction studies.

Overall, this study provides strong evidence for the strategic use of bs5, particularly when combined with bs6 and/or bs8, in pepper breeding programs. The deployment of multiple recessive resistance genes, rather than a reliance on dominant, HR-based single genes, offers a more sustainable approach to managing bacterial spot. Recessive genes are less likely to exert strong selection pressure on pathogen populations, and gene pyramiding can buffer against partial breakdowns of individual alleles. As climate change accelerates and pathogen populations become increasingly diverse and aggressive, stacking multiple quantitative resistance loci may prove to be one of the most reliable defenses available to breeders and growers. Future work should explore the molecular basis of observed interactions between resistance genes, assess the long-term stability of these combinations under field conditions, and integrate marker-assisted selection for the efficient deployment of bs5-centered gene stacks. By leveraging these insights, breeders can accelerate the development of durable, broad-spectrum bacterial spot resistance in commercial pepper cultivars.

5. Conclusions

This study demonstrates that pyramiding recessive resistance genes, particularly bs5 with bs6 and bs8, provides strong, additive suppression of BSP caused by diverse Xanthomonas species. While bs5 alone significantly reduces bacterial growth and symptom development, combining it with additional resistance loci enhances overall protection and broadens effectiveness across pathogens. The triple-stacked line (bs5 + bs6 + bs8) consistently exhibited the strongest resistance, including under elevated temperature conditions where single- and two-gene combinations often failed. These findings reinforce the importance of gene stacking to stabilize resistance expression, especially in the face of environmental variability and evolving pathogen populations. Ultimately, bs5-centered pyramiding offers a promising framework for breeding pepper cultivars with more durable, broad-spectrum resistance. Further integration with marker-assisted selection and field-level evaluation will be key to translating this strategy into sustainable disease management solutions for growers.