Nitrogen Fertilizer Reduction in Rice–Eel Co-Culture System Improves the Soil Microbial Diversity and Its Functional Stability
Abstract
1. Introduction
2. Results
2.1. Effects on Soil Physical and Chemical Properties
2.2. Effects on Soil Enzyme Activities
2.3. Effects on Soil Microorganism Gene Copies
2.4. Effects on Bacterial Community Composition
2.5. Functional Prediction of Soil Microbial Community
3. Discussion
3.1. The Changes in the Physical and Chemical Properties of Soil
3.2. The Changes in Soil Bacterial Diversity and Symbiotic Networks
3.3. Soil Microbial Community Composition
3.4. The Changes of Soil-Specific Microbial Communities
3.5. Key Environmental Factors Affecting Bacterial Communities
3.6. Prediction of Soil Microbial Functionality
4. Materials and Methods
4.1. Site Description and Experimental Design
4.2. Soil Sampling
4.3. Indicator Measurement and Methodology
4.3.1. Determination of Soil Aggregates
4.3.2. Determination of Soil Nutrients and Enzyme Activity
4.3.3. DNA Extraction and High-Throughput Sequencing
4.4. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Abbreviations
| RT | Conventional regular fertilization treatment |
| IT | Co-culture + regular fertilization treatment |
| IT90 | Co-culture + 10% nitrogen reduction fertilization |
| IT70 | Co-culture + 30% nitrogen reduction fertilization |
| IT50 | Co-culture + 50% nitrogen reduction fertilization |
| R0.25 | Water-stable macroaggregate |
| MWD | Mean weight diameter |
| GMD | Geometric mean diameter |
| TN | Soil total nitrogen |
| TP | Soil total phosphorus |
| TK | Soil total potassium |
| AN | Soil available nitrogen |
| AP | Soil available phosphorus |
| AK | Soil available potassium |
| SOM | Soil organic matter |
| SOC | Soil organic carbon |
| EC | Electrical conductivity |
| RDA | Redundancy analysis |
| LDA | Linear discriminant analysis |
References
- Tan, S.; Zhang, Y.; Liu, Q.; Zhang, Q. Factors Limiting the Sustainable Implementation of the Rice-Crayfish System in Hubei Province, China. Agric. Syst. 2024, 218, 104007. [Google Scholar] [CrossRef] [Scilit]
- Frei, M.; Becker, K. Integrated Rice–Fish Production and Methane Emission under Greenhouse Conditions. Agric. Ecosyst. Environ. 2005, 107, 51–56. [Google Scholar] [CrossRef] [Scilit]
- Li, W.; Liu, S.; Ye, X.; Gao, H. Effects of the Co-Culture of Rice and Aquatic Animals on Soil Eco-System: A Review. J. Ecol. Rural. Environ. 2021, 37, 1292–1300. [Google Scholar] [CrossRef]
- Wang, R.; Ma, W.; Wu, D.; Zhang, Y.; Ma, X.; Lv, G.; Ding, J.; Fu, Z.; Chen, C.; Huang, H. Soil Bacterial Community Composition in Rice-Turtle Coculture Systems with Different Planting Years. Sci. Rep. 2023, 13, 22708. [Google Scholar] [CrossRef] [Scilit]
- Zhang, W.; Xu, M.; Lu, J.; Ren, T.; Cong, R.; Lu, Z.; Li, X. Integrated Rice-Aquatic Animals Culture Systems Promote the Sustainable Development of Agriculture by Improving Soil Fertility and Reducing Greenhouse Gas Emissions. Field Crops Res. 2023, 299, 108970. [Google Scholar] [CrossRef] [Scilit]
- Ibrahim, L.A.; Shaghaleh, H.; Abu-Hashim, M.; Elsadek, E.A.; Hamoud, Y.A. Exploring the Integration of Rice and Aquatic Species: Insights from Global and National Experiences. Water 2023, 15, 2750. [Google Scholar] [CrossRef] [Scilit]
- Ma, L.; Shao, M.; Fan, J.; Wang, J.; Li, Y. Effects of Earthworm (Metaphire Guillelmi) Density on Soil Macropore and Soil Water Content in Typical Anthrosol Soil. Agric. Ecosyst. Environ. 2021, 311, 107338. [Google Scholar] [CrossRef] [Scilit]
- Tufa, A. Vermicompost and NPSZnB Fertilizer Levels on Maize (Zea mays L.) Growth, Yield Component, and Yield at Guto Gida, Western Ethiopia. Int. J. Agron. 2023, 2023, 7123826. [Google Scholar] [CrossRef] [Scilit]
- Li, S.-X.; Jiang, J.; Lv, W.-G.; Siemann, E.; Woodcock, B.A.; Wang, Y.-Q.; Cavalieri, A.; Bai, N.-L.; Zhang, J.-Q.; Zheng, X.-Q.; et al. Rice-Fish Co-Culture Promotes Multiple Ecosystem Services Supporting Increased Yields. Agric. Ecosyst. Environ. 2025, 381, 109417. [Google Scholar] [CrossRef] [Scilit]
- Hallam, J.; Holden, J.; Robinson, D.A.; Hodson, M.E. Effects of Winter Wheat and Endogeic Earthworms on Soil Physical and Hydraulic Properties. Geoderma 2021, 400, 115126. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Wu, Y.; Wang, S.; Peng, H.; Zheng, F.; Pan, G.; Liu, Y.; Liu, H. Rational Nitrogen Reduction Helps Mitigate the Nitrogen Pollution Risk While Ensuring Rice Growth in a Tropical Rice–Crayfish Coculture System. Agriculture 2024, 14, 1816. [Google Scholar] [CrossRef] [Scilit]
- Guo, L.; Zhao, L.; Ye, J.; Ji, Z.; Tang, J.-J.; Bai, K.; Zheng, S.; Hu, L.; Chen, X. Using Aquatic Animals as Partners to Increase Yield and Maintain Soil Nitrogen in the Paddy Ecosystems. Elife 2022, 11, e73869. [Google Scholar] [CrossRef] [Scilit]
- Huang, S.; Zhao, C.; Zhu, Z.; Zhou, L.; Zheng, Q.; Wang, C. Characterization of Eating Quality and Starch Properties of Two Wx Alleles Japonica Rice Cultivars under Different Nitrogen Treatments. J. Integr. Agric. 2020, 19, 988–998. [Google Scholar] [CrossRef] [Scilit]
- Singh, B. Long-Term Fertilizer Nitrogen Management—Soil Health Conundrum. Pedosphere 2024, 34, 23–25. [Google Scholar] [CrossRef] [Scilit]
- Jeong, H.; Jang, T.; Seong, C.; Park, S. Assessing Nitrogen Fertilizer Rates and Split Applications Using the DSSAT Model for Rice Irrigated with Urban Wastewater. Agric. Water Manag. 2014, 141, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Devi, S.; Soni, R. Relevance of Microbial Diversity in Implicating Soil Restoration and Health Management. In Soil Health Restoration and Management; Springer: Singapore, 2020; pp. 161–202. [Google Scholar]
- Zhang, Y.; Chen, L.; Wang, M.; Lu, J.; Zhang, H.; Héroux, P.; Wang, G.; Tang, L.; Liu, Y. Evaluating Micro-Nano Bubbles Coupled with Rice-Crayfish Co-Culture Systems: A Field Study Promoting Sustainable Rice Production Intensification. Sci. Total Environ. 2024, 933, 173162. [Google Scholar] [CrossRef] [Scilit]
- Ren, L.; Liu, P.; Xu, F.; Gong, Y.; Zhai, X.; Zhou, M.; Wang, J.; Wang, Z. Rice–Fish Coculture System Enhances Paddy Soil Fertility, Bacterial Network Stability and Keystone Taxa Diversity. Agric. Ecosyst. Environ. 2023, 348, 108399. [Google Scholar] [CrossRef] [Scilit]
- Diao, W.; Yuan, J.; Jia, R.; Hou, Y.; Zhang, L.; Li, B.; Zhu, J. Integrated Rice–Fish Culture Alters the Bacterioplankton Community and Its Assembly Processes. Fishes 2024, 9, 254. [Google Scholar] [CrossRef] [Scilit]
- Tomie, J.; Cairns, D.; Courtenay, S. How American Eels Anguilla Rostrata Construct and Respire in Burrows. Aquat. Biol. 2013, 19, 287–296. [Google Scholar] [CrossRef] [Scilit]
- Saher, N.U.; Siddiqui, A.S.; Qureshi, N.A. The Identification, Characteristic Feature and Role of Burrow (Neoichnological) Structure in Bioturbation Activities of Ocypodoid and Grapsoid Crabs of Pakistan; Nova Science Publishers, Inc.: Hauppauge, NY, USA, 2019. [Google Scholar]
- Fruscella, L.; Kotzen, B.; Paradelo, M.; Milliken, S. Investigating the Effects of Fish Effluents as Organic Fertilisers on Onion (Allium Cepa) Yield, Soil Nutrients, and Soil Microbiome. Sci. Hortic. 2023, 321, 112297. [Google Scholar] [CrossRef] [Scilit]
- Kumar, A.; Vishwajeet; Keshari, N. The Generalist vs. The Specialist Predator: Their Roles in Biological Control; Nova Science Publishers Inc.: Delhi, India, 2025. [Google Scholar]
- Zhang, X.; Shen, S.; Xue, S.; Hu, Y.; Wang, X. Long-Term Tillage and Cropping Systems Affect Soil Organic Carbon Components and Mineralization in Aggregates in Semiarid Regions. Soil Tillage Res. 2023, 231, 105742. [Google Scholar] [CrossRef] [Scilit]
- Aoyama, J.; Shinoda, A.; Sasai, S.; Miller, M.J.; Tsukamoto, K. First Observations of the Burrows of Anguilla Japonica. J. Fish Biol. 2005, 67, 1534–1543. [Google Scholar] [CrossRef] [Scilit]
- Pelíšek, I. Investigation of Soil Water Infiltration at a Scale of Individual Earthworm Channels. Soil Water Res. 2018, 13, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.; Du, L.; Xiao, Z.; Li, C.; Wang, Z.; Zhou, P.; Sun, G.; Ye, Y.; Hu, T.; Wang, H. Rice-Crayfish Farming Increases Soil Organic Carbon. Agric. Ecosyst. Environ. 2022, 329, 107857. [Google Scholar] [CrossRef] [Scilit]
- De Schepper, N.; De Kegel, B.; Adriaens, D. Pisodonophis Boro (Ophichthidae: Anguilliformes): Specialization for Head-first and Tail-first Burrowing? J. Morphol. 2007, 268, 112–126. [Google Scholar] [CrossRef] [Scilit]
- Xie, T.; Li, J.; Lin, S.; Ju, X.; Li, T. Integrating Organic Amendments and Enhanced Efficiency Fertilizers for Sustainable Rice Production—A Case Study in a Tropic Paddy System. J. Clean. Prod. 2025, 516, 145765. [Google Scholar] [CrossRef] [Scilit]
- Li, P.-P.; Han, Y.-L.; He, J.-Z.; Zhang, S.-Q.; Zhang, L.-M. Soil Aggregate Size and Long-Term Fertilization Effects on the Function and Community of Ammonia Oxidizers. Geoderma 2019, 338, 107–117. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Li, W.; Ding, K.; Shi, X.; Kalkhajeh, Y.K.; Wei, Z.; Zhang, Z.; Ma, C. Co-Culture of Rice and Aquatic Animals Enhances Soil Organic Carbon: A Meta-Analysis. Sci. Total Environ. 2024, 955, 176819. [Google Scholar] [CrossRef] [Scilit]
- Yuan, Y.; Zhao, W.; Zhang, Z.; Xiao, J.; Li, D.; Liu, Q.; Yin, H. Impacts of Oxalic Acid and Glucose Additions on N Transformation in Microcosms via Artificial Roots. Soil Biol. Biochem. 2018, 121, 16–23. [Google Scholar] [CrossRef] [Scilit]
- Thi Nong, H.; Tateishi, R.; Suriyasak, C.; Kobayashi, T.; Oyama, Y.; Chen, W.J.; Matsumoto, R.; Hamaoka, N.; Iwaya-Inoue, M.; Ishibashi, Y. Effect of Seedling Nitrogen Condition on Subsequent Vegetative Growth Stages and Its Relationship to the Expression of Nitrogen Transporter Genes in Rice. Plants 2020, 9, 861. [Google Scholar] [CrossRef] [Scilit]
- Gami, S.K.; Lauren, J.G.; Duxbury, J.M. Soil Organic Carbon and Nitrogen Stocks in Nepal Long-Term Soil Fertility Experiments. Soil Tillage Res. 2009, 106, 95–103. [Google Scholar] [CrossRef] [Scilit]
- Na, M.; Yuan, M.; Hicks, L.C.; Rousk, J. Testing the Environmental Controls of Microbial Nitrogen-Mining Induced by Semi-Continuous Labile Carbon Additions in the Subarctic. Soil Biol. Biochem. 2022, 166, 108562. [Google Scholar] [CrossRef] [Scilit]
- Sheng, F.; Cao, C.; Li, C. Integrated rice-duck farming decreases global warming potential and increases net ecosystem economic budget in central China. Environ. Sci. Pollut. Res. 2018, 25, 22744–22753. [Google Scholar] [CrossRef] [Scilit]
- Lin, K.; Wu, J. Effect of Introducing Frogs and Fish on Soil Phosphorus Availability Dynamics and Their Relationship with Rice Yield in Paddy Fields. Sci. Rep. 2020, 10, 21. [Google Scholar] [CrossRef] [Scilit]
- Xie, J.; Wu, X.; Tang, J.; Zhang, J.; Chen, X. Chemical Fertilizer Reduction and Soil Fertility Maintenance in Rice-Fish Coculture System. Front. Agric. China 2010, 4, 422–429. [Google Scholar] [CrossRef] [Scilit]
- Wang, P.; Dick, W.A. Microbial and Genetic Diversity in Soil Environments. J. Crop Improv. 2004, 12, 249–287. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Wang, P.; Long, Z.; Ding, L.; Zhang, W.; Tang, H.; Liu, J. Research Progress of Soil Microorganism Application Based on High-Throughput Sequencing Technology. IOP Conf. Ser. Earth Environ. Sci. 2021, 692, 042059. [Google Scholar] [CrossRef] [Scilit]
- Chourasiya, D.; Sharma, M.P.; Maheshwari, H.S.; Ramesh, A.; Sharma, S.K.; Adhya, T.K. Microbial Diversity and Soil Health in Tropical Agroecosystems; Springer: Singapore, 2017; pp. 19–35. [Google Scholar]
- Zhang, Y.; Hou, Y.; Jia, R.; Li, B.; Zhu, J.; Ge, X. Alterations in Soil Bacterial Community and Its Assembly Process within Paddy Field Induced by Integrated Rice–Giant River Prawn (Macrobrachium Rosenbergii) Farming. Agronomy 2024, 14, 1600. [Google Scholar] [CrossRef] [Scilit]
- Li, P.; Wu, G.; Li, Y.; Hu, C.; Ge, L.; Zheng, X.; Zhang, J.; Chen, J.; Zhang, H.; Bai, N.; et al. Long-Term Rice-Crayfish-Turtle Co-Culture Maintains High Crop Yields by Improving Soil Health and Increasing Soil Microbial Community Stability. Geoderma 2022, 413, 115745. [Google Scholar] [CrossRef] [Scilit]
- Dai, Z.; Su, W.; Chen, H.; Barberán, A.; Zhao, H.; Yu, M.; Yu, L.; Brookes, P.C.; Schadt, C.W.; Chang, S.X.; et al. Long-term Nitrogen Fertilization Decreases Bacterial Diversity and Favors the Growth of Actinobacteria and Proteobacteria in Agro-ecosystems across the Globe. Glob. Change Biol. 2018, 24, 3452–3461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Y.H.; Ren, W.Z.; Zhao, L.F.; Guo, L.; Liu, Y.X.; Hu, L.L.; Chen, X. Community Structure and Functional Features of Soil Microbes in the Rice-Fish Co-Culture System. J. South China Agric. Univ. 2024, 45, 865–877. [Google Scholar]
- Yang, Z.; Feng, Y.; Zhang, S.; Hu, Y.; Tang, Y.; Gu, H.; Gu, Z.; Xv, Y.; Cai, Y.; Zhang, H. Effects of Rice-Prawn (Macrobrachium Nipponense) Co-Culture on the Microbial Community of Soil. Appl. Microbiol. Biotechnol. 2022, 106, 7361–7372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lai, Z.L.S.H. Effects of a New Rice-Shrimp Farming Model on Soil Fertility and Microbial Community Structure in Paddy Field. Acta Pedol. Sin. 2023, 60, 1790–1800. [Google Scholar]
- Zhang, H.; Jiang, N.; Zhang, S.; Zhu, X.; Wang, H.; Xiu, W.; Zhao, J.; Liu, H.; Zhang, H.; Yang, D. Soil Bacterial Community Composition Is Altered More by Soil Nutrient Availability than PH Following Long-Term Nutrient Addition in a Temperate Steppe. Front. Microbiol. 2024, 15, 1455891. [Google Scholar] [CrossRef] [Scilit]
- Cheng, H.; Yuan, M.; Duan, Q.; Sun, R.; Shen, Y.; Yu, Q.; Li, S. Influence of Phosphorus Fertilization Patterns on the Bacterial Community in Upland Farmland. Ind. Crops Prod. 2020, 155, 112761. [Google Scholar] [CrossRef] [Scilit]
- Murphy, D.V.; Stockdale, E.A.; Brookes, P.C.; Goulding, K.W.T. Impact of Microorganisms on Chemical Transformations in Soil. In Soil Biological Fertility; Springer: Dordrecht, The Netherlands, 2003; pp. 37–59. [Google Scholar]
- Yu, C.; Li, Y.; Mo, R.; Deng, W.; Zhu, Z.; Liu, D.; Hu, X. Effects of Long-Term Straw Retention on Soil Microorganisms under a Rice–Wheat Cropping System. Arch. Microbiol. 2020, 202, 1915–1927. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, L.; Ma, H.; Zhao, Q.; Zhang, S.; Wei, W.; Ding, X. Changes in Soil Bacterial Community and Enzyme Activity under Five Years Straw Returning in Paddy Soil. Eur. J. Soil. Biol. 2020, 100, 103215. [Google Scholar] [CrossRef] [Scilit]
- Masuda, Y.; Shiratori, Y.; Ohba, H.; Ishida, T.; Takano, R.; Satoh, S.; Shen, W.; Gao, N.; Itoh, H.; Senoo, K. Enhancement of the Nitrogen-Fixing Activity of Paddy Soils Owing to Iron Application. Soil Sci. Plant Nutr. 2021, 67, 243–247. [Google Scholar] [CrossRef] [Scilit]
- Masuda, Y.; Yamanaka, H.; Xu, Z.-X.; Shiratori, Y.; Aono, T.; Amachi, S.; Senoo, K.; Itoh, H. Diazotrophic Anaeromyxobacter Isolates from Soils. Appl. Environ. Microbiol. 2020, 86, e00956-20. [Google Scholar] [CrossRef] [Scilit]
- Masuda, Y.; Itoh, H.; Shiratori, Y.; Isobe, K.; Otsuka, S.; Senoo, K. Predominant but Previously-Overlooked Prokaryotic Drivers of Reductive Nitrogen Transformation in Paddy Soils, Revealed by Metatranscriptomics. Microbes Environ. 2017, 32, 180–183. [Google Scholar] [CrossRef] [Scilit]
- Vilardi, K.J.; Johnston, J.; Dai, Z.; Cotto, I.; Tuttle, E.; Patterson, A.; Stubbins, A.; Pieper, K.J.; Pinto, A.J. Nitrogen Source Influences the Interactions of Comammox Bacteria with Aerobic Nitrifiers. Microbiol. Spectr. 2024, 12, e03181-23. [Google Scholar] [CrossRef] [Scilit]
- Onley, J.R.; Ahsan, S.; Sanford, R.A.; Löffler, F.E. Denitrification by Anaeromyxobacter Dehalogenans, a Common Soil Bacterium Lacking the Nitrite Reductase Genes NirS and NirK. Appl. Environ. Microbiol. 2018, 84, e01985-17. [Google Scholar] [CrossRef] [Scilit]
- Yang, X.; Wu, Y.; Shu, L.; Gu, H.; Liu, F.; Ding, J.; Zeng, J.; Wang, C.; He, Z.; Xu, M.; et al. Unraveling the Important Role of Comammox Nitrospira to Nitrification in the Coastal Aquaculture System. Front. Microbiol. 2024, 15, 1355859. [Google Scholar] [CrossRef] [Scilit]
- Gonçalves, O.S.; Fernandes, A.S.; Tupy, S.M.; Ferreira, T.G.; Almeida, L.N.; Creevey, C.J.; Santana, M.F. Insights into Plant Interactions and the Biogeochemical Role of the Globally Widespread Acidobacteriota Phylum. Soil Biol. Biochem. 2024, 192, 109369. [Google Scholar] [CrossRef] [Scilit]
- Ivanova, A.A.; Zhelezova, A.D.; Chernov, T.I.; Dedysh, S.N. Linking Ecology and Systematics of Acidobacteria: Distinct Habitat Preferences of the Acidobacteriia and Blastocatellia in Tundra Soils. PLoS ONE 2020, 15, e0230157. [Google Scholar] [CrossRef] [Scilit]
- Eichorst, S.A.; Kuske, C.R.; Schmidt, T.M. Influence of Plant Polymers on the Distribution and Cultivation of Bacteria in the Phylum Acidobacteria. Appl. Environ. Microbiol. 2011, 77, 586–596. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hernandez, M.E.; Beck, D.A.C.; Lidstrom, M.E.; Chistoserdova, L. Oxygen Availability Is a Major Factor in Determining the Composition of Microbial Communities Involved in Methane Oxidation. PeerJ 2015, 3, e801. [Google Scholar] [CrossRef] [Scilit]
- Seo, J.; Jang, I.; Gebauer, G.; Kang, H. Abundance of Methanogens, Methanotrophic Bacteria, and Denitrifiers in Rice Paddy Soils. Wetlands 2014, 34, 213–223. [Google Scholar] [CrossRef] [Scilit]
- Zeng, W.; Zhang, Y.; Luo, W.; Zhu, Y.; Yin, H.; Lan, X.; Ye, S. Soil-Microbial Interactions in Rice-Loach-Shrimp Integrated Farming: Multivariate Analysis of Ecological Intensification. Water 2024, 16, 2083. [Google Scholar] [CrossRef] [Scilit]
- Udom, B.; Eguma, G.; Dickson, A.; Agbai, W.; Nengi-Benwari, A. Organic Carbon Stock, Carbohydrates and Aggregate Stability of an Ultisols in Managed Secondary Forests. Appl. Environ. Biotechnol. 2024, 9, 94–100. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Cheng, Y.; Zhang, Y.; Li, Y.; Wang, F.; Shen, C. Soil Microbiome Response to Reduced Nitrogen Supply in an Over-Fertilized Wheat-Maize System. Agronomy 2024, 14, 2631. [Google Scholar] [CrossRef] [Scilit]
- Tang, J.; Su, L.; Fang, Y.; Wang, C.; Meng, L.; Wang, J.; Zhang, J.; Xu, W. Moderate Nitrogen Reduction Increases Nitrogen Use Efficiency and Positively Affects Microbial Communities in Agricultural Soils. Agriculture 2023, 13, 796. [Google Scholar] [CrossRef] [Scilit]









| R0.25 | MWD | GMD | |||||||
|---|---|---|---|---|---|---|---|---|---|
| Treatments | Mass Percentage of Water-Stable Aggregates of Different Sizes (%) | (%) | (mm) | (mm) | |||||
| >2 mm | 1.0~2.0 mm | 0.5~1.0 mm | 0.25~0.5 mm | 0.053~0.25 mm | <0.053 mm | ||||
| RT | 8.47 ± 0.01 b | 7.64 ± 0.01 c | 10.85 ± 0.04 b | 27.38 ± 0.05 ab | 16.45 ± 0.03 ab | 29.21 ± 0.06 a | 54.34 ± 0.09 b | 0.51 ± 0.06 c | 0.25 ± 0.05 b |
| IT | 12.57 ± 0.02 a | 11.01 ± 0.02 b | 11.03 ± 0.02 b | 28.24 ± 0.01 a | 18.31 ± 0.02 a | 18.85 ± 0.03 c | 62.85 ± 0.02 a | 0.64 ± 0.05 ab | 0.34 ± 0.03 a |
| IT90 | 12.09 ± 0.01 a | 13.55 ± 0.01 a | 18.50 ± 0.03 a | 21.46 ± 0.02 bc | 12.55 ± 0.01 b | 21.86 ± 0.02 bc | 65.59 ± 0.02 a | 0.69 ± 0.03 a | 0.37 ± 0.07 a |
| IT70 | 7.31 ± 0.01 b | 11.19 ± 0.02 ab | 13.34 ± 0.03 b | 19.55 ± 0.02 c | 20.67 ± 0.01 a | 27.95 ± 0.06 ab | 51.38 ± 0.03 b | 0.53 ± 0.06 bc | 0.26 ± 0.04 b |
| IT50 | 6.25 ± 0.03 b | 7.42 ± 0.02 c | 18.15 ± 0.03 a | 19.08 ± 0.06 c | 20.35 ± 0.02 a | 28.75 ± 0.03 a | 50.89 ± 0.01 b | 0.49 ± 0.07 c | 0.25 ± 0.03 b |
| Treatment | TN | TP | TK | AN | AP | AK | SOC | pH | EC |
|---|---|---|---|---|---|---|---|---|---|
| (g kg−1) | (g kg−1) | (g kg−1) | (mg kg−1) | (mg kg−1) | (mg kg−1) | (g kg−1) | (ms cm−1) | ||
| RT | 1.18 ± 0.09 b | 0.56 ± 0.05 b | 18.58 ± 2.62 a | 31.16 ± 5.74 b | 11.13 ± 2.84 b | 120.67 ± 10.33 a | 11.66 ± 2.06 b | 7.81 ± 0.14 a | 0.22 ± 0.03 ab |
| IT | 1.26 ± 0.03 ab | 0.58 ± 0.02 b | 19.60 ± 0.65 a | 36.90 ± 9.84 b | 19.18 ± 3.63 a | 125.00 ± 16.00 a | 13.86 ± 1.73 ab | 7.60 ± 0.31 a | 0.18 ± 0.05 b |
| IT90 | 1.31 ± 0.04 a | 0.61 ± 0.01 ab | 19.40 ± 0.75 a | 47.56 ± 4.10 a | 23.33 ± 2.42 a | 102.33 ± 20.67 ab | 16.11 ± 3.98 a | 7.79 ± 0.27 a | 0.26 ± 0.04 a |
| IT70 | 1.17 ± 0.06 b | 0.56 ± 0.04 b | 15.91 ± 4.46 a | 40.18 ± 6.56 ab | 21.75 ± 4.84 a | 126.00 ± 6.00 a | 11.74 ± 0.65 b | 7.66 ± 0.27 a | 0.21 ± 0.01 ab |
| IT50 | 1.19 ± 0.08 b | 0.66 ± 0.06 a | 19.21 ± 1.19 a | 32.80 ± 1.64 b | 24.38 ± 5.05 a | 87.00 ± 14.00 b | 11.20 ± 1.48 b | 7.79 ± 0.18 a | 0.18 ± 0.04 b |
| Treatments | Whether to Breed Eel | Type and Dosage of Fertilizers |
|---|---|---|
| RT | No | Regular fertilization |
| IT | Yes | Regular fertilization |
| IT90 | Yes | 10% nitrogen reduction fertilization |
| IT70 | Yes | 30% nitrogen reduction fertilization |
| IT50 | Yes | 50% nitrogen reduction fertilization |
| Measurement Target | Target Gene | Gene Name | Primer Sequence |
|---|---|---|---|
| bacteria | 341F-806R | 341F | CCTAYGGGRBGCASCAG |
| 806R | GGACTACNNGGGTATCTAAT | ||
| fungi | ITS1F-ITS2R | ITS1F | CTTGGTCATTTAGAGGAAGTAA |
| ITS2R | GCTGCGTTCTTCATCGATGC | ||
| actinomycetes | Act920F-Act1200R | Act920F | TACGGCCGCAAGGCTA |
| Act1200R | TCRTCCCCACCTTCCTCCG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ma, M.; Lv, W.; Huang, Y.; Zhang, J.; Li, S.; Bai, N.; Zhang, H.; Zhu, X.; Xu, C.; Zhang, H. Nitrogen Fertilizer Reduction in Rice–Eel Co-Culture System Improves the Soil Microbial Diversity and Its Functional Stability. Plants 2025, 14, 2425. https://doi.org/10.3390/plants14152425
Ma M, Lv W, Huang Y, Zhang J, Li S, Bai N, Zhang H, Zhu X, Xu C, Zhang H. Nitrogen Fertilizer Reduction in Rice–Eel Co-Culture System Improves the Soil Microbial Diversity and Its Functional Stability. Plants. 2025; 14(15):2425. https://doi.org/10.3390/plants14152425
Chicago/Turabian StyleMa, Mengqian, Weiguang Lv, Yu Huang, Juanqin Zhang, Shuangxi Li, Naling Bai, Haiyun Zhang, Xianpu Zhu, Chenglong Xu, and Hanlin Zhang. 2025. "Nitrogen Fertilizer Reduction in Rice–Eel Co-Culture System Improves the Soil Microbial Diversity and Its Functional Stability" Plants 14, no. 15: 2425. https://doi.org/10.3390/plants14152425
APA StyleMa, M., Lv, W., Huang, Y., Zhang, J., Li, S., Bai, N., Zhang, H., Zhu, X., Xu, C., & Zhang, H. (2025). Nitrogen Fertilizer Reduction in Rice–Eel Co-Culture System Improves the Soil Microbial Diversity and Its Functional Stability. Plants, 14(15), 2425. https://doi.org/10.3390/plants14152425

