Metabolomic and Transcriptomic Analyses Reveal Changes in Active Components During the Growth and Development of Comfrey (Symphytum officinale L.)
Abstract
1. Introduction
2. Results
2.1. Effects of Different Growth Periods on the Contents of Active Components in Comfrey
2.2. Metabolome and Differentially Accumulated Metabolites (DAMs) Analyses
2.3. Transcriptome and DEG Analyses
2.4. Integrated Metabolomic and Transcriptomic Profiling
2.4.1. Phenolic Acid Biosynthetic Pathway
2.4.2. Flavonoid Biosynthetic Pathway
2.5. Identification of Potential TFs Involved in Core Metabolic Pathways and WGCNA
2.6. Quantitative Real-Time PCR (qRT-PCR) Validation
3. Discussion
4. Materials and Methods
4.1. Reagents and Materials
4.2. Preparation of Ethanol Extracts
4.3. Determination of Physicochemical Indices
4.3.1. Determination of Flavonoid Content
4.3.2. Determination of Total Phenol Content
4.4. Metabolome Analysis
4.5. RNA Sequencing and Analysis
4.6. Integrated Metabolomic and Transcriptomic Analysis
4.7. WGCNA and Gene Network Visualization
4.8. qRT-PCR Analysis
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Nasir, H.; Iqbal, Z.; Hiradate, S.; Fujii, Y. Isolation of allelochemicals from comfrey (Symphytum officinale L.): A candidate for allelopathic ground cover crop. J. Weed Sci. Technol. 2005, 50, 94–95. [Google Scholar] [CrossRef] [PubMed]
- Sowa, I.; Paduch, R.; Strzemski, M.; Zielińska, S.; Rydzik-Strzemska, E.; Sawicki, J.; Kocjan, R.; Polkowski, J.; Matkowski, A.; Latalski, M.; et al. Proliferative and antioxidant activity of Symphytum officinale root extract. Nat. Prod. Res. 2018, 32, 605–609. [Google Scholar] [CrossRef]
- Ali, A.; Li, Y.; Arockiam Jeyasundar, P.G.S.; Azeem, M.; Su, J.; Wahid, F.; Mahar, A.; Shah, M.Z.; Li, R.; Zhang, Z. Streptomyces pactum and Bacillus consortium influenced the bioavailability of toxic metals, soil health, and growth attributes of Symphytum officinale in smelter/mining polluted soil. Environ. Pollut. 2021, 291, 118237. [Google Scholar] [CrossRef] [PubMed]
- Barna, M.; Kucera, A.; Hladícova, M.; Kucera, M. Der wundheilende effekt einer Symphytum-herba-extrakt-creme (Symphytum × uplandicum Nyman): Ergebnisse einer randomisierten, kontrollierten doppelblindstudie. Wien. Med. Wochenschr. 2007, 157, 569–574. [Google Scholar] [CrossRef]
- Smith, D.B.; Jacobson, B.H. Effect of a blend of comfrey root extract (Symphytum officinale L.) and tannic acid creams in the treatment of osteoarthritis of the knee: Randomized, placebo-controlled, double-blind, multiclinical trials. J. Chiropr. Med. 2011, 10, 147–156. [Google Scholar] [CrossRef] [PubMed]
- Varvouni, E.; Zengin, G.; Graikou, K.; Ganos, C.; Mroczek, T.; Chinou, I. Phytochemical analysis and biological evaluation of the aerial parts from Symphytum anatolicum Boiss. and Cynoglottis barrelieri (All.) Vural & Kit Tan (Boraginaceae). Biochem. Syst. Ecol. 2020, 92, 104128. [Google Scholar] [CrossRef]
- Cao, Z.; Guo, Y.; Liu, Z.; Zhang, H.; Zhou, H.; Shang, H. Ultrasonic enzyme-assisted extraction of comfrey (Symphytum officinale L.) polysaccharides and their digestion and fermentation behaviors in vitro. Process Biochem. 2021, 112, 98–111. [Google Scholar] [CrossRef]
- Avancini, C.A.; Wiest, J.M.; Haas, J.S.; Poser, G.; Dall’Agnol, R. Antimicrobial activity of plants used in the prevention and control of bovine mastitis in Southern Brazil. Lat. Am. J. Pharm. 2008, 27, 894–899. [Google Scholar]
- Liu, M.; Fu, J.; Liu, Y.; Gou, W.; Yuan, W.; Shang, H. Pectin from comfrey roots alleviate DSS-induced ulcerative colitis in mice through modulating the intestinal barrier. Int. J. Biol. Macromol. 2024, 282 Pt 3, 137016. [Google Scholar] [CrossRef]
- Alizadeh, P.; Alizadeh, P.; Rahimi, M.; Amjadi, S.; Bayati, M.; Ebrahimi, S. Enrichment of rosmarinic acid from comfrey (Symphytum officinale L.) root extract by macroporous adsorption resins and molecular docking studies. Ind. Crops Prod. 2024, 214, 118541. [Google Scholar] [CrossRef]
- Trifan, A.; Skalicka-Woźniak, K.; Granica, S.; Czerwińska, M.E.; Kruk, A.; Marcourt, L.; Wolfender, J.L.; Wolfram, E.; Esslinger, N.; Grubelnik, A.; et al. Symphytum officinale L.: Liquid-liquid chromatography isolation of caffeic acid oligomers and evaluation of their influence on pro-inflammatory cytokine release in LPS-stimulated neutrophils. J. Ethnopharmacol. 2020, 262, 113169. [Google Scholar] [CrossRef]
- Fernando, I.; Abeysinghe, D.C.; Dharmadasa, R.M. Determination of phenolic contents and antioxidant capacity of different parts of Withania somnifera (L.) Dunal. from three different growth stages. Ind. Crops Prod. 2013, 50, 537–539. [Google Scholar] [CrossRef]
- Poggioni, L.; Romi, M.; Guarnieri, M.; Cai, G.; Cantini, C. Nutraceutical profile of goji (Lycium barbarum L.) berries in relation to environmental conditions and harvesting period. Food Biosci. 2022, 49, 101954. [Google Scholar] [CrossRef]
- Kong, D.; Li, Y.; Bai, M.; Deng, Y.; Liang, G.; Wu, H. A comparative study of the dynamic accumulation of polyphenol components and the changes in their antioxidant activities in diploid and tetraploid Lonicera japonica. Plant Physiol. Biochem. 2017, 112, 87–96. [Google Scholar] [CrossRef] [PubMed]
- Palma, A.; Cossu, M.E.; Deligios, P.A.; Ledda, L.; Tiloca, M.T.; Sassu, M.; D’aquino, S. Organic versus conventional globe artichoke: Influence of cropping system and harvest date on physiological activity, physicochemical parameters, and bioactive compounds. Sci. Hortic. 2023, 321, 112304. [Google Scholar] [CrossRef]
- Wu, Y.; Zhang, C.; Huang, Z.; Lyu, L.; Li, W.; Wu, W. Integrative analysis of the metabolome and transcriptome provides insights into the mechanisms of flavonoid biosynthesis in blackberry. Food Res. Int. 2022, 153, 110948. [Google Scholar] [CrossRef]
- Ma, Y.; Devi, M.J.; Song, L.; Gao, H.; Jin, L.; Cao, B. Multi-omics integration analysis reveals metabolic regulation of carbohydrate and secondary metabolites during goji berry (Lycium barbarum L.) maturation. Postharvest Biol. Technol. 2024, 218, 113184. [Google Scholar] [CrossRef]
- Wang, L.; Zhang, S.; Li, J.; Zhang, Y.; Zhou, D.; Li, C.; He, L.; Li, H.; Wang, F.; Gao, J. Identification of key genes controlling soluble sugar and glucosinolate biosynthesis in Chinese cabbage by integrating metabolome and genome-wide transcriptome analysis. Front. Plant Sci. 2022, 13, 1043489. [Google Scholar] [CrossRef]
- Tsao, R. Chemistry and biochemistry of dietary polyphenols. Nutrients 2010, 2, 1231–1246. [Google Scholar] [CrossRef]
- Pandey, K.B.; Rizvi, S.I. Plant polyphenols as dietary antioxidants in human health and disease. Oxid. Med. Cell. Longev. 2009, 2, 270–278. [Google Scholar] [CrossRef]
- Liu, W.; Feng, Y.; Yu, S.; Fan, Z.; Li, X.; Li, J.; Yin, H. The flavonoid biosynthesis network in plants. Int. J. Mol. Sci. 2021, 22, 12824. [Google Scholar] [CrossRef] [PubMed]
- Ruzicka, J.; Berger-Büter, K.; Esslinger, N.; Novak, J. Assessment of the diversity of comfrey (Symphytum officinale L. and S. × uplandicum Nyman). Genet. Resour. Crop Evol. 2021, 68, 2813–2825. [Google Scholar] [CrossRef]
- Maeda, H.; Dudareva, N. The shikimate pathway and aromatic amino acid biosynthesis in plants. Annu. Rev. Plant Biol. 2012, 63, 73–105. [Google Scholar] [CrossRef] [PubMed]
- Shang, H.; Zhao, J.; Guo, Y.; Zhang, H.; Duan, M.; Wu, H. Extraction, purification, emulsifying property, hypoglycemic activity, and antioxidant activity of polysaccharides from comfrey. Ind. Crops Prod. 2020, 146, 112183. [Google Scholar] [CrossRef]
- Trifan, A.; Opitz, S.E.W.; Josuran, R.; Grubelnik, A.; Esslinger, N.; Peter, S.; Bräm, S.; Meier, N.; Wolfram, E. Is comfrey root more than toxic pyrrolizidine alkaloids? Salvianolic acids among antioxidant polyphenols in comfrey (Symphytum officinale L.) roots. Food Chem. Toxicol. 2018, 112, 178–187. [Google Scholar] [CrossRef]
- Burdejova, L.; Tobolkova, B.; Polovka, M.; Neugebauerova, J. Differentiation of medicinal plants according to solvents, processing, origin, and season by means of multivariate analysis of spectroscopic and liquid chromatography data. Molecules 2023, 28, 4075. [Google Scholar] [CrossRef]
- Zhao, Z.; Moghadasian, M.H. Chemistry, natural sources, dietary intake and pharmacokinetic properties of ferulic acid: A review. Food Chem. 2008, 109, 691–702. [Google Scholar] [CrossRef]
- Mughal, A.; Jabeen, N.; Ashraf, K.; Sultan, K.; Farhan, M.; Hussain, M.; Deng, G.; Alsudays, I.M.; Saleh, M.A.; Tariq, S.; et al. Exploring the role of caffeic acid in mitigating abiotic stresses in plants: A review. Plant Stress 2024, 12, 100487. [Google Scholar] [CrossRef]
- Kaur, H.; Bhardwaj, R.D.; Grewal, S.K. Mitigation of salinity-induced oxidative damage in wheat (Triticum aestivum L.) seedlings by exogenous application of phenolic acids. Acta Physiol. Plant. 2017, 39, 221. [Google Scholar] [CrossRef]
- Yuan, S.; Ding, X.; Zhang, Y.; Cao, J.; Jiang, W. Characterization of defense responses in the ‘green ring’ and ‘red ring’ on jujube fruit upon postharvest infection by Alternaria alternata and the activation by the elicitor treatment. Postharvest Biol. Technol. 2019, 149, 166–176. [Google Scholar] [CrossRef]
- Rasul, A.; Millimouno, F.M.; Ali Eltayb, W.; Ali, M.; Li, J.; Li, X. Pinocembrin: A novel natural compound with versatile pharmacological and biological activities. BioMed Res. Int. 2013, 2013, 379850. [Google Scholar] [CrossRef]
- Yan, B.; Cao, G.; Sun, T.; Zhao, X.; Hu, X.; Yan, J.; Peng, Y.; Shi, A.; Li, Y.; Xue, W.; et al. Determination of pinocembrin in human plasma by solid-phase extraction and LC/MS/MS: Application to pharmacokinetic studies. Biomed. Chromatogr. 2014, 28, 1601–1606. [Google Scholar] [CrossRef]
- Rahigude, A.; Bhutada, P.; Kaulaskar, S.; Aswar, M.; Otari, K. Participation of antioxidant and cholinergic system in protective effect of naringenin against type-2 diabetes-induced memory dysfunction in rats. Neuroscience 2012, 226, 62–72. [Google Scholar] [CrossRef] [PubMed]
- Ortiz-Andrade, R.R.; Sánchez-Salgado, J.C.; Navarrete-Vázquez, G.; Webster, S.P.; Binnie, M.; García-Jiménez, S.; León-Rivera, I.; Cigarroa-Vázquez, P.; Villalobos-Molina, R.; Estrada-Soto, S. Antidiabetic and toxicological evaluations of naringenin in normoglycaemic and NIDDM rat models and its implications on extra-pancreatic glucose regulation. Diabetes Obes. Metab. 2008, 10, 1097–1104. [Google Scholar] [CrossRef]
- Zbarsky, V.; Datla, K.P.; Parkar, S.; Rai, D.K.; Aruoma, O.I.; Dexter, D.T. Neuroprotective properties of the natural phenolic antioxidants curcumin and naringenin but not quercetin and fisetin in a 6-OHDA model of Parkinson’s disease. Free Radic. Res. 2005, 39, 1119–1125. [Google Scholar] [CrossRef] [PubMed]
- Lisa, J.W.; Nica, M.B.; Murray, W.H. Antiatherogenic properties of naringenin, a citrus flavonoid. Cardiovasc. Drug Rev. 1999, 17, 160–178. [Google Scholar] [CrossRef]
- Mehmood, M.; Anwar, F.; Tabassam, Q. A Centum of Valuable Plant Bioactives; Academic Press Cambridge: Cambridge, MA, USA, 2021. [Google Scholar]
- Shen, Y.; Tian, P.; Li, D.; Wu, Y.; Wan, C.; Yang, T.; Chen, L.; Wang, T.; Wen, F. Chrysin suppresses cigarette smoke-induced airway inflammation in mice. Int. J. Clin. Exp. Med. 2015, 8, 2001–2008. [Google Scholar] [PubMed]
- Liu, Y.; Song, X.; He, J.; Zheng, X.; Wu, H. Synthetic derivatives of chrysin and their biological activities. Med. Chem. Res. 2014, 23, 555–563. [Google Scholar] [CrossRef]
- Norouzi, H.; Dastan, D.; Abdullah, F.O.; Al-Qaaneh, A.M. Recent advances in methods of extraction, pre-concentration, purification, identification, and quantification of kaempferol. J. Chromatogr. A 2024, 1735, 465297. [Google Scholar] [CrossRef]
- Yao, Y.X.; Yu, Y.J.; Dai, S.; Zhang, C.Y.; Xue, X.Y.; Zhou, M.L.; Yao, C.H.; Li, Y.X. Kaempferol efficacy in metabolic diseases: Molecular mechanisms of action in diabetes mellitus, obesity, non-alcoholic fatty liver disease, steatohepatitis, and atherosclerosis. Biomed. Pharmacother. 2024, 175, 116694. [Google Scholar] [CrossRef]
- Imran, M.; Rauf, A.; Shah, Z.A.; Saeed, F.; Imran, A.; Arshad, M.U.; Ahmad, B.; Bawazeer, S.; Atif, M.; Peters, D.G.; et al. Chemo-preventive and therapeutic effect of the dietary flavonoid kaempferol: A comprehensive review. Phytother. Res. 2019, 33, 263–275. [Google Scholar] [CrossRef]
- Gao, X.; Feng, X.; Hou, T.; Huang, W.; Ma, Z.; Zhang, D. The roles of flavonoids in the treatment of inflammatory bowel disease and extraintestinal manifestations: A review. Food Biosci. 2024, 62, 105431. [Google Scholar] [CrossRef]
- Vlaisavljević, S.; Kaurinović, B.; Popović, M.; Vasiljević, S. Profile of phenolic compounds in Trifolium pratense L. extracts at different growth stages and their biological activities. Int. J. Food Prop. 2017, 20, 3090–3101. [Google Scholar] [CrossRef]
- Pretti, I.R.; da Luz, A.C.; Jamal, C.M.; do Carmo Pimentel Batitucci, M. Variation of biochemical and antioxidant activity with respect to the phenological stage of Tithonia diversifolia Hemsl. (Asteraceae) populations. Ind. Crops Prod. 2018, 121, 241–249. [Google Scholar] [CrossRef]
- Hopper, D.W.; Ghan, R.; Schlauch, K.A.; Cramer, G.R. Transcriptomic network analyses of leaf dehydration responses identify highly connected ABA and ethylene signaling hubs in three grapevine species differing in drought tolerance. BMC Plant Biol. 2016, 16, 118. [Google Scholar] [CrossRef]
- Lu, C.; Pu, Y.; Liu, Y.; Li, Y.; Qu, J.; Huang, H.; Dai, S. Comparative transcriptomics and weighted gene co-expression correlation network analysis (WGCNA) reveal potential regulation mechanism of carotenoid accumulation in Chrysanthemum × morifolium. Plant Physiol. Biochem. 2019, 142, 415–428. [Google Scholar] [CrossRef]
- Sun, M.; Shi, M.; Wang, Y.; Huang, Q.; Yuan, T.; Wang, Q.; Wang, C.; Zhou, W.; Kai, G. The biosynthesis of phenolic acids is positively regulated by the JA-responsive transcription factor ERF115 in Salvia miltiorrhiza. J. Exp. Bot. 2019, 70, 243–254. [Google Scholar] [CrossRef] [PubMed]
- Huang, Q.; Sun, M.; Yuan, T.; Wang, Y.; Shi, M.; Lu, S.; Tang, B.; Pan, J.; Wang, Y.; Kai, G. The AP2/ERF transcription factor SmERF1L1 regulates the biosynthesis of tanshinones and phenolic acids in Salvia miltiorrhiza. Food Chem. 2019, 274, 368–375. [Google Scholar] [CrossRef]
- Hartmann, U.; Sagasser, M.; Mehrtens, F.; Stracke, R.; Weisshaar, B. Differential combinatorial interactions of cis-acting elements recognized by R2R3-MYB, BZIP, and BHLH factors control light-responsive and tissue-specific activation of phenylpropanoid biosynthesis genes. Plant Mol. Biol. 2005, 57, 155–171. [Google Scholar] [CrossRef]
- Ding, K.; Pei, T.; Bai, Z.; Jia, Y.; Ma, P.; Liang, Z. SmMYB36, a novel R2R3-MYB transcription factor, enhances tanshinone accumulation and decreases phenolic acid content in Salvia miltiorrhiza hairy roots. Sci. Rep. 2017, 7, 5104. [Google Scholar] [CrossRef]
- Chen, J.; Li, G.; Zhang, H.; Yuan, Z.; Li, W.; Peng, Z.; Shi, M.; Ding, W.; Zhang, H.; Cheng, Y.; et al. Primary bitter taste of Citrus is linked to a functional allele of the 1,2-rhamnosyltransferase gene originating from Citrus grandis. J. Agric. Food Chem. 2021, 69, 9869–9882. [Google Scholar] [CrossRef]
- Zhou, Z.; Gao, H.; Ming, J.; Ding, Z.; Lin, X.; Zhan, R. Combined transcriptome and metabolome analysis of Pitaya fruit unveiled the mechanisms underlying peel and pulp color formation. BMC Genom. 2020, 21, 734. [Google Scholar] [CrossRef]
- Zhang, Z.; Huang, W.; Zhao, L.; Xiao, L.; Huang, H. Integrated metabolome and transcriptome reveals the mechanism of the flower coloration in cashew Anacardium occidentale. Sci. Hortic. 2024, 324, 112617. [Google Scholar] [CrossRef]
- Welch, D.; Hassan, H.; Blilou, I.; Immink, R.; Heidstra, R.; Scheres, B. Arabidopsis JACKDAW and MAGPIE zinc finger proteins delimit asymmetric cell division and stabilize tissue boundaries by restricting SHORT-ROOT action. Genes Dev. 2007, 21, 2196–2204. [Google Scholar] [CrossRef]
- Colasanti, J.; Yuan, Z.; Sundaresan, V. The indeterminate gene encodes a zinc finger protein and regulates a leaf-generated signal required for the transition to flowering in maize. Cell 1998, 93, 593–603. [Google Scholar] [CrossRef] [PubMed]
- Cui, D.; Zhao, J.; Jing, Y.; Fan, M.; Liu, J.; Wang, Z.; Xin, W.; Hu, Y. The arabidopsis IDD14, IDD15, and IDD16 cooperatively regulate lateral organ morphogenesis and gravitropism by promoting auxin biosynthesis and transport. PLoS Genet. 2013, 9, e1003759. [Google Scholar] [CrossRef] [PubMed]
- Kumar, M.; Le, D.T.; Hwang, S.; Seo, P.J.; Kim, H.U. Role of the INDETERMINATE DOMAIN genes in plants. Int. J. Mol. Sci. 2019, 20, 2286. [Google Scholar] [CrossRef] [PubMed]
- Seo, P.J.; Ryu, J.; Kang, S.K.; Park, C.M. Modulation of sugar metabolism by an INDETERMINATE DOMAIN transcription factor contributes to photoperiodic flowering in Arabidopsis. Plant J. 2011, 65, 418–429. [Google Scholar] [CrossRef]
- Jain, M.; Tyagi, A.K.; Khurana, J.P. Genome-wide identification, classification, evolutionary expansion and expression analyses of homeobox genes in rice. FEBS J. 2008, 275, 2845–2861. [Google Scholar] [CrossRef]
- Hu, W.; dePamphilis, C.W.; Ma, H. Phylogenetic analysis of the plant-specific zinc finger-homeobox and mini zinc finger gene families. J. Integr. Plant Biol. 2008, 50, 1031–1045. [Google Scholar] [CrossRef]
- Zhou, C.; Zhu, C.; Xie, S.; Weng, J.; Lin, Y.; Lai, Z.; Guo, Y. Genome-wide analysis of zinc finger motif-associated homeodomain (ZF-HD) family genes and their expression profiles under abiotic stresses and phytohormones stimuli in tea plants (Camellia sinensis). Sci. Hortic. 2021, 281, 109976. [Google Scholar] [CrossRef]
- Tran, L.S.; Nakashima, K.; Sakuma, Y.; Osakabe, Y.; Qin, F.; Simpson, S.D.; Maruyama, K.; Fujita, Y.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Co-expression of the stress-inducible zinc finger homeodomain ZFHD1 and NAC transcription factors enhances expression of the ERD1 gene in Arabidopsis. Plant J. 2007, 49, 46–63. [Google Scholar] [CrossRef] [PubMed]
- Khatun, K.; Nath, U.K.; Robin, A.H.K.; Park, J.I.; Lee, D.J.; Kim, M.B.; Kim, C.K.; Lim, K.B.; Nou, I.S.; Chung, M.Y. Genome-wide analysis and expression profiling of zinc finger homeodomain (ZHD) family genes reveal likely roles in organ development and stress responses in tomato. BMC Genom. 2017, 18, 695. [Google Scholar] [CrossRef]
- Li, R.; Shang, H.; Wu, H.; Wang, M.; Duan, M.; Yang, J. Thermal inactivation kinetics and effects of drying methods on the phenolic profile and antioxidant activities of chicory (Cichorium intybus L.) leaves. Sci. Rep. 2018, 8, 9529. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.; He, W.; Lu, M.; Yuan, B.; Zeng, M.; Tao, G.; Qin, F.; Chen, J.; Guan, Y.; He, Z. Enzyme-assisted ultrasonic-microwave synergistic extraction and UPLC-QTOF-MS analysis of flavonoids from Chinese water chestnut peels. Ind. Crops Prod. 2018, 117, 179–186. [Google Scholar] [CrossRef]
- Espada-Bellido, E.; Ferreiro-González, M.; Carrera, C.; Palma, M.; Barroso, C.G.; Barbero, G.F. Optimization of the ultrasound-assisted extraction of anthocyanins and total phenolic compounds in mulberry (Morus nigra) pulp. Food Chem. 2017, 219, 23–32. [Google Scholar] [CrossRef]
- Want, E.J.; Masson, P.; Michopoulos, F.; Wilson, I.D.; Theodoridis, G.; Plumb, R.S.; Shockcor, J.; Loftus, N.; Holmes, E.; Nicholson, J.K. Global metabolic profiling of animal and human tissues via UPLC-MS. Nat. Protoc. 2013, 8, 17–32. [Google Scholar] [CrossRef]
- Wen, B.; Mei, Z.; Zeng, C.; Liu, S. MetaX: A flexible and comprehensive software for processing metabolomics data. BMC Bioinf. 2017, 18, 183. [Google Scholar] [CrossRef]
- Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinf. 2011, 12, 323. [Google Scholar] [CrossRef]








| Genes | Forward Primer Sequence (5′ to 3′) | Reverse Primer Sequence (5′ to 3′) |
|---|---|---|
| β-actin | TGAGTGGTGGTACGACTATGTTCCC | TCATGCTACTTGGTGCCAATGCTG |
| AP2/ERF-ERF1 | AAGAGGCGGCTCGGGCATAC | CGGGCTCGGGATCTCCAGAAG |
| AP2/ERF-ERF2 | TGCCTCACGCCTCTGTAGTGTC | GGAACGAAAACCCGCCCTGAAC |
| AP2/ERF-ERF3 | TGACGGAGGTTTGGGAAGTTTAGC | AACATTTGACACGGCGGAGGAG |
| bHLH1 | TCTGCTTCTGCTTCCACCGTTTC | AATGAGCGTTTGAAGGCGTTGTTG |
| C2H2-1 | GTGGTGTTACGGCTTCGGAAGG | GGTTTCTTGGACGGATGAGGACTC |
| C2H2-2 | CCTTAGCAGCCGTGGTGGAAATAG | CACCTCATCATCACCGCCAGAAC |
| MYB | CCGCTTGAGAGTAGAGTTCCAGTG | CGGGCTCATGCGAGGTTTGG |
| NAC | TCAGCCAGCCATCCTCTTACTCG | TTGCCATTGAAGGAAGCCCACATC |
| bZIP1 | GCTGAAAGGGTGGTCGCTTCTG | GACAGTCTGCTGCTCGATCAAAGG |
| zf-HD1 | GGTTCACGGCGGTGGAAGTTG | GACGGCTGCGGTGAGTTCATG |
| zf-HD2 | TAGCCTCCGCCATTACCACTACC | AGTTGCAGCCACCGCATTGAG |
| AP2/ERF-ERF4 | TGCTGCCCAATCAATCTCCACTG | TGGATTTCTCCGAGGGTGTGTTTG |
| bHLH2 | GCCTCATCCACAAGCGACATCTC | TCTACATTCGTTCGGGCATCACAG |
| bZIP2 | TGCCATCAGAAACAACTGCCAGAG | GCCTGAGGTGATCGTCTACATTGC |
| WRKY | ATTTGGGGTTACAAGGGCACTCTC | GAGGCATTTGGGCATGTTGTGAAG |
| 4CL | ATTTTGCTGGGTAGGGCTGCTTG | AACAGGGTTATGGCATGACGGAAG |
| CAD | CCTTGAAGCCAGCGGAATGTACC | CGAGTCACACTGAGCACCAACAC |
| POD | TTGCAGAAAATGAGGAGGCAGACC | AAAGCAGTGTTCTTGTGGCGTTTG |
| CALDH | GGTCCCCAGGTCTCAAAACTTCAG | ACCCTTGTCACCCTTGCGTTTG |
| COMT | AGAATTTTCCAGCAGGAGCCAACC | AAGAACCCAGAAGCAGCCTCAATG |
| CCoAOMT | GCTCTTTCAATGGCTCTGGCTCTC | ACCCAAGTTTGCTGGTCACAAGG |
| PAL | CTCCCCTGCCTCCCCTTTAGC | AGGGATTGAAGGGAAGCCATTTGG |
| C4H | TCTTCCATTGGGCAGGGTTGTTTG | GCCACACATGAACCTCCACGAC |
| CHS | GTCTCCGCCCTTCTGTCAAACG | CAGCCAAGTCCTTCGCCATACG |
| CHI | CCGTTGTACCTGCCATAGGAGTTG | CCGTCTTTGCCAGGAAGGATTCG |
| HCT | AGACGGGCGGGCTAGGTTTC | AGTTCACCGGCTAATGCGATTGG |
| C3’H | CGGCTTCACTCATTACACGGTCAG | GGACAATGGCAGAACTCCTAAGGC |
| F3H | AGGCAATGGGCTTGGAGAAAGAAG | CTGGCTGAGGGCATTTTGGGTAG |
| F3’H | TCCAGACCGCCTTCCAACCG | TTCGCAGTCGTCTGAGGCAATTC |
| F3’5’H | GGTGCTAAGGCTCTTGGTGACTG | GTGCTCGACTCATACATGGCTTGG |
| DFR | CCCCTTCATCACACCAACATTCCC | AAGGCGGAGTTCTGCAATCTGATG |
| ANS | ACCCAAAATGCCCTCAACCAGAAC | CCAGGAACCATGTTGTGGAGGATG |
| FLS | TGCACACTCACATACCTCTTCC | CGACACCGAGTTAGAATCAAATCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fu, J.; Liu, Y.; Gou, W.; Liu, M.; Zhang, N.; Si, Q.; Shang, H. Metabolomic and Transcriptomic Analyses Reveal Changes in Active Components During the Growth and Development of Comfrey (Symphytum officinale L.). Plants 2025, 14, 2088. https://doi.org/10.3390/plants14142088
Fu J, Liu Y, Gou W, Liu M, Zhang N, Si Q, Shang H. Metabolomic and Transcriptomic Analyses Reveal Changes in Active Components During the Growth and Development of Comfrey (Symphytum officinale L.). Plants. 2025; 14(14):2088. https://doi.org/10.3390/plants14142088
Chicago/Turabian StyleFu, Jia, Yuqian Liu, Wenting Gou, Mengxue Liu, Nanyi Zhang, Qiang Si, and Hongmei Shang. 2025. "Metabolomic and Transcriptomic Analyses Reveal Changes in Active Components During the Growth and Development of Comfrey (Symphytum officinale L.)" Plants 14, no. 14: 2088. https://doi.org/10.3390/plants14142088
APA StyleFu, J., Liu, Y., Gou, W., Liu, M., Zhang, N., Si, Q., & Shang, H. (2025). Metabolomic and Transcriptomic Analyses Reveal Changes in Active Components During the Growth and Development of Comfrey (Symphytum officinale L.). Plants, 14(14), 2088. https://doi.org/10.3390/plants14142088

