Holy Basil (Ocimum sanctum L.) Flower and Fenofibrate Improve Lipid Profiles in Rats with Metabolic Dysfunction Associated Steatotic Liver Disease (MASLD): The Role of Choline Metabolism
Abstract
1. Introduction
2. Results
2.1. Holy Basil Flower and Fenofibrate Reduced Hepatic Lipid Accumulation and Markers of Liver Injury and Oxidative Stress
2.2. Holy Basil Flower and Fenofibrate Altered Hepatic Choline Metabolite and One-Carbon Metabolism Gene Expression Levels
2.2.1. Hepatic Choline Metabolites
2.2.2. One-Carbon Metabolism Gene Expression
2.3. Correlations Among Hepatic Choline Metabolites, One-Carbon Metabolism Gene Expression, and Metabolic Markers
2.4. Choline Metabolites Were Related to Metabolic Markers in a Treatment-Dependent and Independent Manner
3. Discussion
3.1. High-Fat Diet Altered Hepatic Choline Metabolism in the Pathogenesis of MASLD
3.2. Holy Basil Flower and Fenofibrate Independently Ameliorated Hepatic Insults by Altering Choline Metabolism
4. Materials and Methods
4.1. Holy Basil Flower Extract Preparation
4.2. Rat Experiments
4.3. Sample Collection and Processing
4.4. Analytic Measurements
4.4.1. Blood and Liver Biochemical Assays
4.4.2. Measurements of Hepatic Choline Metabolites
4.4.3. Hepatic One-Carbon Metabolism Gene Expression
4.5. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Younossi, Z.M.; Golabi, P.; Paik, J.M.; Henry, A.; Van Dongen, C.; Henry, L. The Global Epidemiology of Nonalcoholic Fatty Liver Disease (NAFLD) and Nonalcoholic Steatohepatitis (NASH): A Systematic Review. Hepatology 2023, 77, 1335–1347. [Google Scholar] [CrossRef] [PubMed]
- Santoleri, D.; Titchenell, P.M. Resolving the Paradox of Hepatic Insulin Resistance. CMGH 2019, 7, 447–456. [Google Scholar] [CrossRef] [PubMed]
- Shimomura, I.; Bashmakov, Y.; Horton, J.D. Increased Levels of Nuclear SREBP-1c Associated with Fatty Livers in Two Mouse Models of Diabetes Mellitus. J. Biol. Chem. 1999, 274, 30028–30032. [Google Scholar] [CrossRef]
- Yecies, J.L.; Zhang, H.H.; Menon, S.; Liu, S.; Yecies, D.; Lipovsky, A.I.; Gorgun, C.; Kwiatkowski, D.J.; Hotamisligil, G.S.; Lee, C.H.; et al. Akt Stimulates Hepatic SREBP1c and Lipogenesis through Parallel MTORC1-Dependent and Independent Pathways. Cell Metab. 2011, 14, 21–32. [Google Scholar] [CrossRef]
- Caudill, M.A.; Miller, J.W.; Gregory III, J.F.; Shane, B. Folate, Choline, Vitamin B 12, and Vitamin B 6. In Biochemical, Physiological, and Molecular Aspects of Human Nutrition; Elsevier: Amsterdam, The Netherlands, 2012; pp. 565–608. [Google Scholar]
- Zeisel, S.H.; Klatt, K.C.; Caudill, M.A. Choline. Adv. Nutr. 2018, 9, 58–60. [Google Scholar] [CrossRef]
- Walker, A.K.; Jacobs, R.L.; Watts, J.L.; Rottiers, V.; Jiang, K.; Finnegan, D.M.; Shioda, T.; Hansen, M.; Yang, F.; Niebergall, L.J.; et al. A Conserved SREBP-1/Phosphatidylcholine Feedback Circuit Regulates Lipogenesis in Metazoans. Cell 2011, 147, 840–852. [Google Scholar] [CrossRef]
- Chakravarthy, M.V.; Lodhi, I.J.; Yin, L.; Malapaka, R.R.V.; Xu, H.E.; Turk, J.; Semenkovich, C.F. Identification of a Physiologically Relevant Endogenous Ligand for PPARα in Liver. Cell 2009, 138, 476–488. [Google Scholar] [CrossRef]
- Reddy, J.K.; Hashimoto, T. Peroxisomal Beta-Oxidation and Peroxisome Proliferator-Activated Receptor Alpha: An Adaptive Metabolic System. Annu. Rev. Nutr. 2001, 21, 193–230. [Google Scholar] [CrossRef]
- Bernal-Mizrachi, C.; Weng, S.; Feng, C.; Finck, B.N.; Knutsen, R.H.; Leone, T.C.; Coleman, T.; Mecham, R.P.; Kelly, D.P.; Semenkovich, C.F. Dexamethasone Induction of Hypertension and Diabetes Is PPAR-Alpha Dependent in LDL Receptor-Null Mice. Nat. Med. 2003, 9, 1069–1075. [Google Scholar] [CrossRef]
- McKeage, K.; Keating, G.M. Fenofibrate: A Review of Its Use in Dyslipidaemia. Drugs 2011, 71, 1917–1946. [Google Scholar] [CrossRef]
- Singh, D.; Chaudhuri, P.K. A Review on Phytochemical and Pharmacological Properties of Holy Basil (Ocimum sanctum L.). Ind. Crops Prod. 2018, 118, 367–382. [Google Scholar] [CrossRef]
- Suanarunsawat, T.; Na Ayutthaya, W.D.; Songsak, T.; Thirawarapan, S.; Poungshompoo, S. Antioxidant Activity and Lipid-Lowering Effect of Essential Oils Extracted from Ocimum sanctum L. Leaves in Rats Fed with a High Cholesterol Diet. J. Clin. Biochem. Nutr. 2010, 46, 52–59. [Google Scholar] [CrossRef] [PubMed]
- Suanarunsawat, T.; Devakul Na Ayutthaya, W.; Songsak, T.; Thirawarapan, S.; Poungshompoo, S. Lipid-Lowering and Antioxidative Activities of Aqueous Extracts of Ocimum sanctum L. Leaves in Rats Fed with a High-Cholesterol Diet. Oxid. Med. Cell. Longev. 2011, 2011, 962025. [Google Scholar] [CrossRef]
- Subash-Babu, P.; Mohammed Alowaidh, H.; Al-Harbi, L.N.; Shamlan, G.; Aloud, A.A.; AlSedairy, S.A.; Alshatwi, A.A. Ocimum basilicum L. Methanol Extract Enhances Mitochondrial Efficiency and Decreases Adipokine Levels in Maturing Adipocytes Which Regulate Macrophage Systemic Inflammation. Molecules 2022, 27, 1388. [Google Scholar] [CrossRef]
- Sundler, R.; Arvidson, G.; Åkesson, B. Pathways for the Incorporation of Choline into Rat Liver Phosphatidylcholines In Vivo. Biochim. Biophys. Acta 1972, 280, 559–568. [Google Scholar] [CrossRef]
- Ontawong, A.; Boonphang, O.; Pasachan, T.; Duangjai, A.; Pongchaidecha, A.; Phatsara, M.; Jinakote, M.; Amornlerdpison, D.; Srimaroeng, C. Hepatoprotective Effect of Coffee Pulp Aqueous Extract Combined with Simvastatin against Hepatic Steatosis in High-Fat Diet-Induced Obese Rats. J. Funct. Foods 2019, 54, 568–577. [Google Scholar] [CrossRef]
- Lai, Z.; Chen, J.; Ding, C.; Wong, K.; Chen, X.; Pu, L.; Huang, Q.; Chen, X.; Cheng, Z.; Liu, Y.; et al. Association of Hepatic Global DNA Methylation and Serum One-Carbon Metabolites with Histological Severity in Patients with NAFLD. Obesity 2020, 28, 197–205. [Google Scholar] [CrossRef]
- Chen, Y.; Liu, Y.; Zhou, R.; Chen, X.; Wang, C.; Tan, X.; Wang, L.; Zheng, R.; Zhang, H.; Ling, W.; et al. Associations of Gut-Flora-Dependent Metabolite Trimethylamine-N-Oxide, Betaine and Choline with Non-Alcoholic Fatty Liver Disease in Adults. Sci. Rep. 2016, 6, 19076. [Google Scholar] [CrossRef]
- Imajo, K.; Fujita, K.; Yoneda, M.; Shinohara, Y.; Suzuki, K.; Mawatari, H.; Takahashi, J.; Nozaki, Y.; Sumida, Y.; Kirikoshi, H.; et al. Plasma Free Choline Is a Novel Non-Invasive Biomarker for Early-Stage Non-Alcoholic Steatohepatitis: A Multi-Center Validation Study. Hepatol. Res. 2012, 42, 757–766. [Google Scholar] [CrossRef]
- Lu, S.C.; Alvarez, L.; Huang, Z.Z.; Chen, L.; An, W.; Corrales, F.J.; Avila, M.A.; Kanel, G.; Mato, J.M. Methionine Adenosyltransferase 1A Knockout Mice Are Predisposed to Liver Injury and Exhibit Increased Expression of Genes Involved in Proliferation. Proc. Natl. Acad. Sci. USA 2001, 98, 5560–5565. [Google Scholar] [CrossRef]
- Cano, A.; Buqué, X.; Martínez-Uña, M.; Aurrekoetxea, I.; Menor, A.; García-Rodríguez, J.L.; Lu, S.C.; Martínez-Chantar, M.L.; Mato, J.M.; Ochoa, B.; et al. Methionine Adenosyltransferase 1A Gene Deletion Disrupts Hepatic Very Low-Density Lipoprotein Assembly in Mice. Hepatology 2011, 54, 1975–1986. [Google Scholar] [CrossRef] [PubMed]
- Duce, A.M.; Ortíz, P.; Cabrero, C.; Mato, J.M. S-Adenosyl-L-Methionine Synthetase and Phospholipid Methyltransferase Are Inhibited in Human Cirrhosis. Hepatology 1988, 8, 65–68. [Google Scholar] [CrossRef] [PubMed]
- Piras, I.S.; Raju, A.; Don, J.; Schork, N.J.; Gerhard, G.S.; DiStefano, J.K. Hepatic PEMT Expression Decreases with Increasing NAFLD Severity. Int. J. Mol. Sci. 2022, 23, 9296. [Google Scholar] [CrossRef]
- Wu, N.; Feng, M.; Yue, S.; Shi, X.; Tang, N.; Xiong, Y.; Wang, J.; Zhang, L.; Song, H.; Shi, Y.; et al. DNA Methylation of SMPD3-Based Diagnostic Biomarkers of NASH and Mild Fibrosis. Genes Dis. 2024, 11, 99. [Google Scholar] [CrossRef]
- Liu, Y.; Shi, D.; Tian, Y.; Liu, Y.; Zhan, Q.; Xu, J.; Wang, J.; Xue, C. Eicosapentaenoic Acid-Enriched Phosphatidylcholine Attenuated Hepatic Steatosis Through Regulation of Cholesterol Metabolism in Rats with Nonalcoholic Fatty Liver Disease. Lipids 2017, 52, 119–127. [Google Scholar] [CrossRef]
- Kaewmalee, J.; Ontawong, A.; Duangjai, A.; Tansakul, C.; Rukachaisirikul, V.; Muanprasat, C.; Srimaroeng, C. High-Efficacy α,β-Dehydromonacolin s Improves Hepatic Steatosis and Suppresses Gluconeogenesis Pathway in High-Fat Diet-Induced Obese Rats. Pharmaceuticals 2021, 14, 375. [Google Scholar] [CrossRef]
- Nair, A.B.; Jacob, S. A Simple Practice Guide for Dose Conversion Between Animals and Human. J. Basic. Clin. Pharm. 2016, 7, 27–31. [Google Scholar] [CrossRef]
- Besseling, P.J.; Pieters, T.T.; Nguyen, I.T.N.; de Bree, P.M.; Willekes, N.; Dijk, A.H.; Bovee, D.M.; Hoorn, E.J.; Rookmaaker, M.B.; Gerritsen, K.G.; et al. A Plasma Creatinine- And Urea-Based Equation to Estimate Glomerular Filtration Rate in Rats. Am. J. Physiol. Ren. Physiol. 2021, 320, F518–F524. [Google Scholar] [CrossRef]
- Koc, H.; Mar, M.-H.; Ranasinghe, A.; Swenberg, J.A.; Zeisel, S.H. Quantitation of Choline and Its Metabolites in Tissues and Foods by Liquid Chromatography/Electrospray Ionization-Isotope Dilution Mass Spectrometry. Anal. Chem. 2002, 74, 4734–4740. [Google Scholar] [CrossRef]








| Gene Symbols | Gene Name | Forward Primers 5′ to 3′ | Reverse Primers 3′ to 5′ | RT-PCR Product Size (bp) |
|---|---|---|---|---|
| Pemt | Phosphatidylethanolamine N-methyltransferase | CCAGGTTGCACAAAAGGAGC | GTCAGGGATTGGTGGGGATG | 198 |
| Mat1a | Methionine adenosyltransferase 1A | AGCCTGGGTGTGTCTGTCTA | TCGATATGAGCCAGGTCCGT | 165 |
| Mthfd1 | Methylenetetrahydrofolate dehydrogenase 1 | GCGGCTATTCCCAGGTCATT | ATAGCAGCAGCCACAAGGTT | 100 |
| Mtfhfd1l | Mitochondrial monofunctional 10-formyl-tetrahydrofolate synthetase | TGCCGAGGGACTTCATTCTG | ACCTGGCATTGTGCTCATCA | 90 |
| Cept1 | Choline-ethanolamine phosphotransferase-1 | TGGGCTGGACATAACTGGGTA | GGCTATTTACCACGCAGGC | 170 |
| Pcyt1a | Phosphate cytidylyltransferase 1, choline, α isoform | CGTCTCCCCGCAACCTATTT | TGTTGCTCCATTAGGGCCAG | 172 |
| Bhmt | Betaine-homocysteine methyltransferase | AAGCCTTTGCTGGAGACCG | ATCTCCGATCACGACTTCGC | 147 |
| Chka | Choline kinase alpha | GTCTCTCGTCACTGCTGCTC | GAATGGCTCACCGGCTTCA | 118 |
| Smpd3 | Sphingomyelin phosphodiesterase 3 | TATGGCAGCTTGGCACTAGG | AGATTCCTGGGAGGTCAGGC | 161 |
| β-Actin | β-Actin | CCTAAGGCCAACCGTGAAAA | GGAGCGCGTAACCCTCAATAC | 189 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Taesuwan, S.; Inchai, J.; Boonyingsathit, K.; Chimkerd, C.; Judprasong, K.; Rachtanapun, P.; Muanprasat, C.; Vaddhanaphuti, C.S. Holy Basil (Ocimum sanctum L.) Flower and Fenofibrate Improve Lipid Profiles in Rats with Metabolic Dysfunction Associated Steatotic Liver Disease (MASLD): The Role of Choline Metabolism. Plants 2025, 14, 13. https://doi.org/10.3390/plants14010013
Taesuwan S, Inchai J, Boonyingsathit K, Chimkerd C, Judprasong K, Rachtanapun P, Muanprasat C, Vaddhanaphuti CS. Holy Basil (Ocimum sanctum L.) Flower and Fenofibrate Improve Lipid Profiles in Rats with Metabolic Dysfunction Associated Steatotic Liver Disease (MASLD): The Role of Choline Metabolism. Plants. 2025; 14(1):13. https://doi.org/10.3390/plants14010013
Chicago/Turabian StyleTaesuwan, Siraphat, Jakkapong Inchai, Konpong Boonyingsathit, Chanika Chimkerd, Kunchit Judprasong, Pornchai Rachtanapun, Chatchai Muanprasat, and Chutima S. Vaddhanaphuti. 2025. "Holy Basil (Ocimum sanctum L.) Flower and Fenofibrate Improve Lipid Profiles in Rats with Metabolic Dysfunction Associated Steatotic Liver Disease (MASLD): The Role of Choline Metabolism" Plants 14, no. 1: 13. https://doi.org/10.3390/plants14010013
APA StyleTaesuwan, S., Inchai, J., Boonyingsathit, K., Chimkerd, C., Judprasong, K., Rachtanapun, P., Muanprasat, C., & Vaddhanaphuti, C. S. (2025). Holy Basil (Ocimum sanctum L.) Flower and Fenofibrate Improve Lipid Profiles in Rats with Metabolic Dysfunction Associated Steatotic Liver Disease (MASLD): The Role of Choline Metabolism. Plants, 14(1), 13. https://doi.org/10.3390/plants14010013

