Assessing Olive Oil Quality Using Different DNA-Based Methods
Abstract
:1. Introduction
2. Results
2.1. Quality Parameters of the Oil Samples
2.2. Olive Oil DNA Isolation
2.3. PCR-Based Methods for Aspergillus Detection
2.4. Primer Design, Specificity, and Sensitivity of the LAMP Assay
3. Discussion
4. Materials and Methods
4.1. Sample Collection
4.2. Chemical Characterization of Oil Samples
4.3. Oil Sample Preparation and Conventional PCR Assay
4.4. Mold Isolation, Culture and Identification
4.5. Aspergillus Flavus DNA Extraction
4.6. LAMP Primers and Reaction
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- AL-Asmari, K.M.; Al-Attar, A.M.; Mohamed, I.; Zeid, A. Potential health benefits and components of olive oil: An overview. Biosci. Res. 2020, 17, 2673–2687. [Google Scholar]
- Marcelino, G.; Hiane, P.A.; Freitas, K.C.; Santana, L.F.; Pott, A.; Donadon, J.R.; Guimarães, R.C.A. Effects of olive oil and its minor components on cardiovascular diseases, inflammation, and gut microbiota. Nutrients 2019, 11, 1826. [Google Scholar] [CrossRef] [PubMed]
- Lozano-Castellón, J.; Olmo-Cunillera, A.; Casadei, E.; Valli, E.; Domínguez-López, I.; Miliarakis, E.; Pérez, M.; Ninot, A.; Romero-Aroca, A.; Bendini, A.; et al. A targeted foodomic approach to assess differences in extra virgin olive oils: Effects of storage, agronomic and technological factors. Food Chem. 2024, 435, 137539. [Google Scholar] [CrossRef]
- International Olive Council (IOC). Trade Standard Applying to Olive Oils and Olive-Pomace Oils; COI/T.15/Nc No 3/Rev. 14; International Olive Council: Madrid, Spain, 2019. [Google Scholar]
- Bruscatto, M.H.; Zambiazi, R.C.; Crizel-Cardoso, M.; Piatnicki, C.M.S.; Mendonca, C.R.B.; Dutra, F.L.G.; Coutinho, E.F. Chemical characterization and oxidative stability of olive oils extracted from olive trees of southern brazil. Pesqui. Agropecuária Bras. 2019, 52, 1231–1240. [Google Scholar] [CrossRef]
- Bavaro, S.; Susca, A.; Frisvard, J.; Tufariello, M.; Chytiti, A.; Perrone, G.; Miltra, G.; Logrieco, A.F.; Bleve, G. Isolation, characterization, and selection of molds associated to fermented black table olives. Front. Microbiol. 2017, 8, 1356. [Google Scholar] [CrossRef]
- Bhat, R.; Reddy, K.R.N. Challenges and issues concerning mycotoxins contamination in oil seeds and their edible oils: Updates from last decade. Food Chem. 2017, 215, 425–437. [Google Scholar] [CrossRef] [PubMed]
- Cotty, P.J.; Bayman, P.; Egel, D.S.; Elias, K.S. Agriculture, aflatoxins and Aspergillus. In The Genus Aspergillus; Peberdy, J.F., Ed.; Springer: Boston, MA, USA, 1994; p. 127. [Google Scholar]
- Frisvard, J.C.; Hubka, V.; Ezekiel, C.N.; Hong, S.B.; Nováková, A.; Chen, A.J.; Arzanlou, M.; Larsen, T.O.; Sklenßř, F.; Mahakarnchanakul, W.; et al. Taxonomy of Aspergillus section Flavi and their production of aflatoxins, ochratoxins and other mycotoxins. Stud. Mycol. 2019, 93, 1–63. [Google Scholar] [CrossRef]
- Bennett, J.W.; Klich, M. Mycotoxins. Clin. Microbiol. Rev. 2003, 16, 497–516. [Google Scholar] [CrossRef]
- Creppy, E.E. Update of survey, regulation and toxic effects of mycotoxins in Europe. Toxicol. Lett. 2002, 127, 19–28. [Google Scholar] [CrossRef]
- El Adlouni, C.; Pinelli, E.; Azemar, B.; Zaoui, D.; Beaune, P.; Pfohl-Leszkowicz, A. Phenobarbital increases DNA adduct and metabolites formed by ochratoxin A: Role of CYP 2C9 and microsomal glutathione-S-transferase. Environ. Mol. Mutagen. 2000, 35, 123–131. [Google Scholar] [CrossRef]
- Commission Regulation (EC) No. 1881/2006 of 19 December 2006. Setting maximum levels for certain contaminants in foodstuffs. Off. J. Eur. Uni. 2006, L364, 5–24.
- Papachristou, A.; Markaki, P. Determination of ochratoxin A in virgin olive oils of Greek origin by immunoaffinity column clean-up and high-performance liquid chromatography. Food Addit. Contam. 2004, 21, 85–92. [Google Scholar] [CrossRef] [PubMed]
- Samson, R.A.; Noonim, P.; Meijer, M.; Houbraken, J.; Frisvad, J.C.; Varga, J. Diagnostic tools to identify black Aspergilli. Stud. Mycol. 2007, 59, 129–145. [Google Scholar] [CrossRef] [PubMed]
- Klich, M.A.; Mullaney, E.J. Use of a bleomycin-containing medium to distinguish Aspergillus parasiticus from A. sojae. Mycologia 1989, 81, 159–160. [Google Scholar] [CrossRef]
- Luo, J.; Vogel, R.F.; Niessen, L. Development and application of a loop-mediated isothermal amplification assay for rapid identification of aflatoxigenic molds and their detection in food samples. Int. J. Food Microbiol. 2012, 159, 214–224. [Google Scholar] [CrossRef]
- Ortega, S.F.; Siciliano, I.; Prencipe, S.; Gullino, M.L.; Spadaro, D. Development of PCR, LAMP and qPCR assays for the detection of aflatoxigenic strains of Aspergillus flavus and A. parasiticus in hazelnut. Toxins 2020, 12, 757. [Google Scholar] [CrossRef]
- Schaad, N.W.; Frederick, R.D. Real-time PCR and its application for rapid plant disease diagnostics. Can. J. Plant Pathol. 2002, 24, 250–258. [Google Scholar] [CrossRef]
- Stakheev, A.A.; Ryazantsev, D.Y.; Gagkaeva, T.Y.; Zavriev, S.K. PCR detection of Fusarium fungi with similar profiles of the produced mycotoxins. Food Control 2011, 22, 462–468. [Google Scholar] [CrossRef]
- Rodriguez, A.; Rodriguez, M.; Luque, M.I.; Martin, A.; Cordoba, J.J. Real-time PCR assays for detection and quantification of aflatoxin producing molds in foods. Food Microbiol. 2012, 31, 89–99. [Google Scholar] [CrossRef]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, E63. [Google Scholar] [CrossRef]
- Mori, Y.; Kitao, M.; Tomita, N.; Notomi, T. Real-Time Turbidimetry of LAMP Reaction for Quantifying Template DNA. J. Biochem. Biophys. Methods 2004, 59, 145–157. [Google Scholar] [CrossRef] [PubMed]
- Soroka, M.; Wasowicz, B.; Rymaszewska, A. Loop-mediated isothermal amplification (Lamp): The better sibling of PCR? Cells 2021, 10, 1931. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.; Taniwaki, M.H.; Iamanaka, B.T.; Vogel, R.F.; Niessen, L. Application of loop-mediated isothermal amplification assays for direct identification of pure cultures of Aspergillus flavus, A. nomius, and A. caelatus and for their rapid detection in shelled Brazil nuts. Int. J. Food Microbiol. 2014, 172, 5–12. [Google Scholar] [CrossRef] [PubMed]
- Liu, P.; Li, B.; Yin, R.; Weng, Q.; Chen, Q. Development and evaluation of ITS and aflP based LAMP assays for rapid detection of Aspergillus flavus in food samples. Can. J. Microbiol. 2014, 60, 579–584. [Google Scholar] [CrossRef]
- Al-Sheikh, H.M. LAMP-PCR detection of ochratoxigenic Aspergillus species collected from peanut kernel. Genet. Mol. Res. 2015, 14, 634–644. [Google Scholar] [CrossRef]
- Douksouna, Y.; Kwallah, A.O.; Nyerere, A.; Runo, S.; Ambang, Z. Application and evaluation of the loop-mediated isothermal amplification assay for the detection of aflatoxigenic fungi contaminants of rice grains in Kenya. Plant Pathol. Microbiol. 2020, 11, 491. [Google Scholar] [CrossRef]
- Ferrara, M.; Logrieco, A.F.; Moretti, A.; Susca, A. A loop-mediated isothermal amplification (LAMP) assay for rapid detection of fumonisin producing Aspergillus species. Food Microbiol. 2020, 90, 103469. [Google Scholar] [CrossRef]
- Niessen, L.; Bechtner, J.; Fodil, S.; Taniwaki, M.H.; Vogel, R.F. LAMP-based group specific detection of aflatoxin producers within Aspergillus section Flavi in food raw materials, spices, and dried fruit using neutral red for visible-light signal detection. Int. J. Food Microbiol. 2018, 266, 241–250. [Google Scholar] [CrossRef] [PubMed]
- Consolandi, C.; Palmieri, L.; Severgnini, M.; Maestri, E.; Marmiroli, N.; Agrimonti, C.; Baldoni, L.; Donini, P.; De Bellis, G.; Castiglioni, B. A procedure for olive oil traceability and authenticity: DNA extraction, multiplex PCR and LDR-universal array analysis. Eur. Food Res. Technol. 2008, 227, 1429–1438. [Google Scholar] [CrossRef]
- Taberlet, P.; Coissac, E.; Pompanon, F.; Gielly, L.; Miquel, C.; Valentini, A.; Vermat, T.; Corthier, G.; Brochmann, C.; Willerslev, E. Power and limitations of the chloroplast trn L (UAA) intron for plant DNA barcoding. Nucleic Acids Res. 2007, 35, e14. [Google Scholar] [CrossRef]
- Krichène, D.; Allalout, A.; Salvador, M.D.; Fregapane, G.; Zarrouk, M. Fatty acids, volatiles, sterols and triterpenic alcohols of sixmonovarietal Tunisian virgin olive oils. Eur. J. Lipid Sci. Technol. 2010, 112, 400–409. [Google Scholar] [CrossRef]
- Rodríguez, A.; Rodríguez, M.; Andrade, M.J.; Córdoba, J.J. Detection of filamentous fungi in foods. Curr. Opin. Food Sci. 2015, 5, 36–42. [Google Scholar] [CrossRef]
- Aladhadh, M. A review of modern methods for the detection of foodborne pathogens. Microorganisms 2023, 11, 1111. [Google Scholar] [CrossRef] [PubMed]
- Mellikeche, W.; Casini, G.; Ricelli, A.; Colelli, G.; Gallo, M.; D’Onghia, A.M. Detection of post-harvest pathogens by loop-mediated isothermal amplification: A review. Phytopathol. Mediterr. 2022, 61, 531–547. [Google Scholar] [CrossRef]
- Raieta, K.; Muccillo, L.; Colantuoni, V. A novel reliable method of DNA extraction from olive oil suitable for molecular traceability. Food Chem. 2015, 172, 596–602. [Google Scholar] [CrossRef]
- Schrader, C.; Schielke, A.; Ellerbroek, L.; Johne, R. PCR inhibitors—Occurrence, properties and removal. J. Appl. Microbiol. 2012, 113, 1014–1026. [Google Scholar] [CrossRef]
- Kumar, R.; Kumar, L.M.; Prasad, P.; Tiwari, R.K. Editorial: Current advancements in real-time plant pathogen diagnostics: From lab assays to in-field detection. Front. Plant Sci. 2023, 14, 1255654. [Google Scholar] [CrossRef]
- Markakis, E.A.; Roditakis, E.N.; Kalantzakis, G.S.; Chatzaki, A.; Soultatos, S.K.; Stavrakaki, M.; Tavlaki, G.I.; Koubouris, G.C.; Bagkis, N.; Goumas, D.E. Characterization of fungi associated with olive fruit rot and olive oil degradation in Crete, Southern Greece. Plant Dis. 2021, 105, 3623–3635. [Google Scholar] [CrossRef]
- Bhat, A.I.; Aman, R.; Mahfouz, M. Onsite detection of plant viruses using isothermal amplification assays. Plant Biotechnol. J. 2022, 20, 1859–1873. [Google Scholar] [CrossRef]
- Sadallah, A.; Minutillo, S.A.; Valentini, F.; Raimondo, M.L.; Lops, F.; Carlucci, A.; Ippolito, A.; D’Onghia, A.M. A real time loop-mediated amplification (RealAmp) assay for rapid detection of Pleurotus richardsiae in declining olive plants. Phytopathol. Mediterr. 2022, 61, 259–267. [Google Scholar] [CrossRef]
- Tran, V.T.; Do, T.B.X.L.; Nguyen, T.K.; Vu, X.T.; Dao, B.N.; Nguyen, H.H. A simple, efficient and universal method for the extraction of genomic DNA from bacteria, yeasts, molds and microalgae suitable for PCR-based applications. Life Sci. Biotechnol. 2017, 59, 66–74. [Google Scholar]
Calabrian Province Manufacturing | Monovarietal Oil (Variety) | Multivarietal Oil |
---|---|---|
Vibo Valentia | Tonda Di Filogaso (FILO) | MV1 |
Vibo Valentia | Tonda Di Filadelfia (FILA) | MV2 |
Reggio Calabria | Ottobratica (OTT) | MV3 |
Reggio Calabria | Ciciarello (CIC) | MV4 |
Cosenza | Grossa Di Cassano (CAS) | MV5 |
Cosenza | Nocellara (NOC) | MV6 |
Crotone | Pennulara (PEN) | MV7 |
Crotone | Fidusa (FID) | MV8 |
Catanzaro | Carolea (CAR) | MV9 |
Catanzaro | Romanella (ROM) | MV10 |
Free Acidity (% Oleic Acid) | Peroxide Value (meqO2/kg) | p-Anisidine Value (anV) | |
---|---|---|---|
Monovarietal oil | |||
CAR | 0.6 | 15.1 | 2.2 |
ROM | 0.07 | 17.9 | 3.2 |
CAS | 0.08 | 11.6 | 3.1 |
PEN | 0.75 | 36.7 | 0.5 |
FID | 0.63 | 32.4 | 3.2 |
CIC | 0.12 | 18.3 | 1.6 |
OTT | 0.23 | 13.9 | 2.0 |
NOC | 0.73 | 27.7 | 1.2 |
FILO | 0.24 | 18.5 | 2.1 |
FILA | 0.51 | 20.4 | 1.4 |
Multivarietal oil | |||
MV1 | 0.2 | 16.4 | 4.6 |
MV2 | 0.25 | 19.5 | 0.5 |
MV3 | 0.22 | 13.7 | 4.9 |
MV4 | 0.59 | 16. 8 | 2.5 |
MV5 | 0.12 | 12.3 | 3.7 |
MV6 | 0.72 | 24.8 | 1.8 |
MV7 | 0.29 | 10.7 | 5.0 |
MV8 | 0.11 | 19.4 | 2.4 |
MV9 | 0.14 | 10.1 | 2.9 |
MV10 | 0.68 | 33.7 | 3.1 |
Assay | Primer | Sequence (5′–3′) |
---|---|---|
trnLFw | CGAAATCGGTAGACGCTACG | |
Endpoint PCR | trnLRev | GGGGATAGAGGGACTTGAAC |
IT1fw- | GCGGAAGGATCATTACCGAG | |
IT1rv | CAAGAGATCCATTGTTGAAAG | |
F3 | TCCGATCCTCGAGCGTATG | |
B3 | CCGAAGGAGCCAGCTTTC | |
LAMP | FIP (F2 + F1c) | CCTGATCCGAGGTCAACCTGGA- CTTTGTCACCCGCTCTGTAG |
BIP (B2 + B1c) | GCGGAGGAAAAGAAACCAACCG- TGAGCTCTTGCCGCTT | |
Loop primer (Lp) | ATTGCCTCAGTAACGGCGAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Moscato, G.; Bonavita, S.; Regina, T.M.R. Assessing Olive Oil Quality Using Different DNA-Based Methods. Plants 2024, 13, 3220. https://doi.org/10.3390/plants13223220
Moscato G, Bonavita S, Regina TMR. Assessing Olive Oil Quality Using Different DNA-Based Methods. Plants. 2024; 13(22):3220. https://doi.org/10.3390/plants13223220
Chicago/Turabian StyleMoscato, Giovanna, Savino Bonavita, and Teresa Maria Rosaria Regina. 2024. "Assessing Olive Oil Quality Using Different DNA-Based Methods" Plants 13, no. 22: 3220. https://doi.org/10.3390/plants13223220
APA StyleMoscato, G., Bonavita, S., & Regina, T. M. R. (2024). Assessing Olive Oil Quality Using Different DNA-Based Methods. Plants, 13(22), 3220. https://doi.org/10.3390/plants13223220