Genetic Variation and Evolutionary Analysis of Eggplant Mottled Dwarf Virus Isolates from Spain
Abstract
1. Introduction
2. Results
2.1. Sequencing EMDV Isolates from Spain
2.2. Phylogenetic Relationships among Worldwide EMDV Isolates
2.3. Recombination between EMDV Variants
2.4. Genetic Variation, Selection and Coevolution in Different EMDV Genes
2.5. Genetic Differentiation of EMDV Populations
3. Discussion
4. Material and Methods
4.1. Virus Isolates
4.2. Primer Design
4.3. Nucleic Acid Purification, RT-PCR and Sequencing
4.4. In Silico Analyses of Nucleotide Sequences
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rubio, L.; Galipienso, L.; Ferriol, I. Detection of plant viruses and disease management: Relevance of genetic diversity and evolution. Front. Plant Sci. 2020, 11, 1092. [Google Scholar] [CrossRef]
- Roossinck, M.J. Mechanisms of plant virus evolution. Annu. Rev. Phytopathol. 1997, 35, 191–209. [Google Scholar] [CrossRef]
- Moya, A.; Holmes, E.C.; González-Candelas, F. The population genetics and evolutionary epidemiology of RNA viruses. Nat. Rev. Microbiol. 2004, 2, 279–288. [Google Scholar] [CrossRef]
- Chare, E.R.; Holmes, E.C. A phylogenetic survey of recombination frequency in plant RNA viruses. Arch. Virol. 2006, 151, 933–946. [Google Scholar] [CrossRef] [PubMed]
- International Committee on Taxonomy of Viruses (ICTV). Genus: Alphanucleorhabdovirus. Available online: https://ictv.global/report/chapter/rhabdoviridae/rhabdoviridae/alphanucleorhabdovirus (accessed on 16 September 2023).
- Pappi, P.G.; Dovas, C.I.; Efthimiou, K.E.; Maliogka, V.I.; Katis, N.I. A novel strategy for the determination of a rhabdovirus genome and its application to sequencing of Eggplant mottled dwarf virus. Virus Genes 2013, 47, 105–113. [Google Scholar] [CrossRef] [PubMed]
- CABI. Eggplant mottled dwarf virus. In Crop Protection Compendium; CAB International: Wallingford, UK, 2021; Available online: www.cabi.org/cpc (accessed on 16 September 2023).
- Della Giustina, W.; Javoy, M.; Bansept, P.; Morel, E.; Balasse, H.; Goussard, N.; Passard, C. Les cicadelles du genre Anaceratagallia vectrice du virus responsable de la maladie de la peau de crapaud du concombre. PHM Rev. Hortic. 2000, 420, 40–43. [Google Scholar]
- Babaie, G.; Izadpanah, K. Vector transmission of eggplant mottled dwarf virus in Iran. J. Phytopathol. 2003, 151, 679–682. [Google Scholar] [CrossRef]
- Desbiez, C.; Wipf-Scheibel, C.; Millot, P.; Berthier, K.; Girardot, G.; Gognalons, P.; Hirsch, J.; Moury, B.; Nozeran, K.; Piry, S.; et al. Distribution and evolution of the major viruses infecting cucurbitaceous and solanaceous crops in the French Mediterranean area. Virus Res. 2020, 286, 198042. [Google Scholar] [CrossRef]
- Pappi, P.G.; Maliogka, V.I.; Amoutzias, G.D.; Katis, N.I. Genetic variation of eggplant mottled dwarf virus from annual and perennial plant hosts. Arch. Virol. 2016, 161, 631–639. [Google Scholar] [CrossRef]
- Parrella, G.; Greco, B. Sequence variation of block III segment identifies three distinct lineages within Eggplant mottled dwarf virus isolates from Italy, Spain and Greece. Acta Virol. 2016, 60, 100–105. [Google Scholar] [CrossRef]
- Babaie, G.; Habibi, M.K.; Massah, A.; Dizadji, A.; Izadinejad, L.; Simon, A. Complete genome sequence and genome analysis of Eggplant mottled dwarf virus-Iranian isolate. J. Phytopathol. 2014, 163, 331–341. [Google Scholar] [CrossRef]
- Rivarez, M.P.S.; Pecman, A.; Bačnik, K.; Carvalho Frreira, O.M.; Vučurović, A.; Seljak, G.; Mehle, N.; Gutierrrez-Aguirre, I.; Ravnikar, M.; Kutnjak, D. In-depth study of tomato and weed viromes reveals undiscovered plant virus diversity in an agroecosystem. Microbiome 2023, 11, 60. [Google Scholar] [CrossRef]
- Menzel, W.; Winter, S.; Hamacher, J. First report of Eggplant mottled dwarf virus causing flower breaking and vein clearing in Hydrangea macrophylla in Germany. New Dis. Rep. 2016, 34, 11. [Google Scholar] [CrossRef]
- Frew, L.; Hogan, C.; Andrews, K.; Fowkes, A.; Skelton, A.; Webster, G.; Dixon, M.; Conyers, C.; Adams, I.; McGreig, S.; et al. First report of eggplant mottled dwarf virus in Pittosporum tobria in the United Kingdom. J. Plant Pathol. 2023, 105, 1733. [Google Scholar] [CrossRef]
- Elbeaino, T.; Kubaa, R.A.; Tuzlali, H.T.; Digiaro, M. Pittosporum cryptic virus 1: Genome sequence completion using next-generation sequencing. Arch. Virol. 2016, 161, 2039–2042. [Google Scholar] [CrossRef]
- Zhai, Y.; Miglino, R.; Sorrentino, R.; Masenga, V.; Alioto, D.; Pappu, H.R. Complete genomic characterization of eggplant mottled dwarf virus from Agapanthus sp. by deep sequencing and de novo assembly. J. Plant Pathol. 2014, 96, 593–595. [Google Scholar]
- Pappi, P.G.; Chaintoutis, S.C.; Dovas, C.I.; Efthimiou, K.E.; Katis, N.I. Development of one-tube real-time qRT-PCR and evaluation of RNA extraction methods for the detection of eggplant mottled dwarf virus in different species. J. Virol. Methods 2015, 212, 59–65. [Google Scholar] [CrossRef] [PubMed]
- Miglino, R.; Sorrentino, R.; De Stradis, A.; Zoina, A.; Alioto, D. Necrotic potato tubers infected by eggplant mottled dwarf virus in Italy. J. Plant Pathol. 2013, 95, 619–621. [Google Scholar]
- Tang, J.; Elliott, C.; Ward, L.I.; Iqram, A. Identification of Eggplant mottled dwarf virus in PEQ Hibiscus syriacus plants imported from Australia. Australas. Plant Dis. Notes 2014, 10, 6. [Google Scholar] [CrossRef]
- Desbiez, C.; Verdin, E.; Moury, B.; Lecoq, H.; Millot, P.; Wipf-Scheibel, C.; Mirzayeva, S.; Sultanova, N.; Balakishiyeva, G.; Mammadov, A.; et al. Prevalence and molecular diversity of the main viruses infecting cucurbit and solanaceous crops in Azerbaijan. Eur. J. Plant Pathol. 2019, 153, 359–369. [Google Scholar] [CrossRef]
- Martin, D.P.; Murrell, B.; Golden, M.; Khoosal, A.; Muhire, B. RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evol. 2015, 1, vev003. [Google Scholar] [CrossRef]
- Garcıa-Arenal, F.; Fraile, A.; Malpica, J.M. Variability and genetic structure of plant virus populations. Annu. Rev. Phytopathol. 2001, 39, 157–186. [Google Scholar] [CrossRef] [PubMed]
- Davino, S.; Panno, S.; Iacono, G.; Sabatino, L.; D’Anna, F.; Iapichino, G.; Olmos, A.; Scuderi, G.; Rubio, L.; Tomassoli, L.; et al. Genetic variation and evolutionary analysis of Pepino mosaic virus in Sicily: Insights into the dispersion and epidemiology. Plant Pathol. 2017, 66, 368–375. [Google Scholar] [CrossRef]
- Ferrer, R.M.; Luis-Arteaga, M.; Guerri, J.; Moreno, P.; Rubio, L. Detection and identification of species of the genus Fabavirus by RT-PCR with a single pair of primers. J. Virol. Meth. 2007, 144, 156–160. [Google Scholar] [CrossRef] [PubMed]
- Davino, S.; Willemsen, A.; Panno, S.; Davino, M.; Catara, A.; Elena, S.F.; Rubio, L. Emergence and Phylodynamics of Citrus tristeza virus in Sicily, Italy. PLoS ONE 2013, 8, e66700. [Google Scholar] [CrossRef] [PubMed]
- Chare, E.R.; Gould, E.A.; Holmes, E.C. Phylogenetic analysis reveals a low rate of homologous recombination in negative-sense RNA viruses. J. Gen. Virol. 2003, 84, 2691–2703. [Google Scholar] [CrossRef] [PubMed]
- Han, G.Z.; Worobey, M. Homologous recombination in negative sense RNA viruses. Viruses 2011, 3, 1358–1373. [Google Scholar] [CrossRef]
- Velasco, L.; Salem, N.; Willemsen, A.; Lapidot, M.; Mansour, A.N.; Rubio, L.; Galipienso, L. Genetic variation and evolutionary forces shaping Cucumber vein yellowing virus populations: Risk of emergence of virulent isolates in Europe. Plant Pathol. 2016, 65, 847–856. [Google Scholar] [CrossRef]
- Bentley, K.; Evans, D.J. Mechanisms and consequences of positive-strand RNA virus recombination. J. Gen. Virol. 2018, 99, 1345–1356. [Google Scholar] [CrossRef]
- Vives, M.C.; Rubio, L.; Sambade, A.; Mirkov, T.E.; Moreno, P.; Guerri, J. Evidence of multiple recombination events between two RNA sequence variants within a Citrus tristeza virus isolate. Virology 2005, 331, 232–237. [Google Scholar] [CrossRef]
- Wright, S. The roles of mutation, inbreeding, crossbreeding and selection in evolution. Proc. Sixth Intl. Cong. Genet. 1932, 1, 356–366. [Google Scholar]
- Albiach-Martí, M.R.; Mawassi, M.; Gowda, S.; Satyanarayana, T.; Hilf, M.E.; Shanker, S.; Almira, E.C.; Vives, M.C.; Lopez, C.; Guerri, J.; et al. Sequences of Citrus tristeza virus separated in time and space are essentially identical. J. Virol. 2000, 74, 6856–6865. [Google Scholar] [CrossRef] [PubMed]
- Elvira-González, L.; Rubio, L.; Galipienso, L. Geographically distant isolates of the persistent southern tomato virus (STV) show very low genetic diversity in the putative coat protein gene. Virus Genes 2020, 56, 668–672. [Google Scholar] [CrossRef] [PubMed]
- Ferrer, R.M.; Ferriol, I.; Moreno, P.; Guerri, J.; Rubio, L. Genetic variation and evolutionary analysis of Broad bean wilt virus 2. Arch. Virol. 2011, 156, 1445–1450. [Google Scholar] [CrossRef]
- Rubio, L.; Guerri, J.; Moreno, P. Genetic variability and evolutionary dynamics of viruses of the family Closteroviridae. Front. Microbiol. 2013, 4, 151. [Google Scholar] [CrossRef]
- Callaway, A.; Giesman-Cookmeyer, D.; Gillock, E.T.; Sit, T.L.; Lommel, S.A. The multifunctional capsid proteins of plant RNA viruses. Annu. Rev. Phytopathol. 2001, 39, 419–460. [Google Scholar] [CrossRef]
- Plisson, C.; Drucker, M.; Blanc, S.; German-Retana, S.; Le Gall, O.; Thomas, D.; Bron, P. Structural characterization of HC-Pro, a plant virus multifunctional protein. J. Biol. Chem. 2003, 278, 23753–23761. [Google Scholar] [CrossRef] [PubMed]
- LaTourrette, K.; Garcia-Ruiz, H. Determinants of Virus Variation, Evolution, and Host Adaptation. Pathogens 2022, 11, 1039. [Google Scholar] [CrossRef] [PubMed]
- López, C.; Aramburu, J.; Galipienso, L.; Soler, S.; Nuez, F.; Rubio, L. Evolutionary analysis of tomato Sw-5 resistance-breaking isolates of Tomato spotted wilt virus. J. Gen. Virol. 2011, 92, 210–215. [Google Scholar] [CrossRef] [PubMed]
- Rychlik, W. OLIGO 7 primer analysis software. Methods. Mol. Biol. 2007, 402, 35–60. [Google Scholar]
- Foissac, X.; Svanella-Dumas, L.; Gentit, P.; Dulucq, M.J.; Candresse, T. Polyvalent detection of fruit tree Tricho, Capillo and Foveavirus by nested RT-PCR using degenerate and inosine containing primers (PDO RT-PCR). Acta Hortic. 2001, 550, 37–43. [Google Scholar] [CrossRef]
- Higgins, D.; Thompson, J.; Gibson, T. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Nei, M.; Kumar, S. Molecular Evolution and Phylogenetics; Oxford University Press: Oxford, UK, 2000. [Google Scholar]
- Efron, B.; Halloran, E.; Holmes, S. Bootstrap confidence levels for phylogenetic trees. Proc. Natl. Acad. Sci. USA 1996, 93, 13429–13434. [Google Scholar] [CrossRef]
- Pamilo, P.; Bianchi, N.O. Evolution of the Zfx and Zfy genes: Rates and interdependence between the genes. Mol. Biol. Evol. 1993, 10, 271–281. [Google Scholar]
- Kosakovsky Pond, S.L.; Frost, S.D.W. Not so different after all: A comparison of methods for detecting amino acid sites under selection. Mol. Biol. Evol. 2005, 22, 1208–1222. [Google Scholar] [CrossRef] [PubMed]
- Weaver, S.; Shank, S.D.; Spielman, S.J.; Li, M.; Muse, S.V.; Kosakovsky Pond, S.L. Datamonkey 2.0: A modern web application for characterizing selective and other evolutionary processes. Mol. Biol. Evol. 2018, 35, 773–777. [Google Scholar] [CrossRef] [PubMed]
- Poon, A.F.Y.; Lewis, F.I.; Frost, S.D.W.; Kosakovsky Pond, S.L. Spidermonkey: Rapid detection of co-evolving sites using Bayesian graphical models. Bioinformatics 2008, 24, 1949–1950. [Google Scholar] [CrossRef] [PubMed]
- Weir, B.S.; Cockerham, C.C. Estimating F-statistics for the analysis of population structure. Evolution 1984, 38, 1358–1370. [Google Scholar] [PubMed]
- Rozas, J.; Ferrer-Mata, A.; Sanchez-DelBarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sanchez-Gracia, A. DnaSP 6: DNA sequence polymorphism analysis of large data sets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef]

| Isolate | Country | Region | Year | Host | Genes 1 | GenBank |
|---|---|---|---|---|---|---|
| 203/09 | Spain | Valencia | 2009 | Pittosporum tobira | N, L1 | OR631742, OR631755 |
| 80/10 | Spain | Almería | 2010 | Solanum melongena | N, L1 | OR631743, OR631756 |
| 990/11 | Spain | Almería | 2011 | Solanum lycopersicum | N, L1 | OR631744, OR631757 |
| 991/11 | Spain | Almería | 2011 | Cucumis sativus | N, L1 | OR631745, OR631758 |
| 539/12 | Spain | Granada | 2012 | Solanum lycopersicum | N, L1 | OR631746, OR631759 |
| 443/17 | Spain | Granada | 2017 | Solanum melongena | N, L1 | OR631747, OR631760 |
| 478/17 | Spain | Granada | 2017 | Solanum melongena | N, L1 | OR631748, OR631761 |
| 697/17 | Spain | Granada | 2017 | Solanum melongena | N, L1 | OR631749, OR631752 |
| 377/20 | Spain | Granada | 2020 | Solanum melongena | N, L1 | OR631750, OR631763 |
| 593/12 | Spain | Navarra | 2012 | Capsicum annuum | N, L1 | OR631751, OR631764 |
| 1009/11 | Spain | Pontevedra | 2011 | Capsicum annuum | N, L1 | OR631752, OR631765 |
| 464/15 | Spain | Valencia | 2015 | Podranea ricasoliana | N, L1 | OR631753, OR631766 |
| 540/15 | Spain | Zaragoza | 2015 | Pittosporum tobira | N, L1 | OR631754, OR631767 |
| S1 | Spain | Malaga | 2011 | Hibiscus rosa-sinensis | L1 | HG916821 [12] |
| S2 | Spain | Malaga | 2011 | Hibiscus rosa-sinensis | L1 | HG916822 [12] |
| S3 | Spain | Malaga | 2011 | Hibiscus rosa-sinensis | L1 | HG916823 [12] |
| S4 | Spain | Granada | 2011 | Hibiscus rosa-sinensis | L1 | HG916824 [12] |
| S5 | Spain | Almeria | 2013 | Cucumis sativus | L1 | HG916825 [12] |
| SH-eg | Iran | 2011 | Solanum melongena | N, X, P, Y, M, G, L | KC905081 [13] | |
| STR20ST2 | Slovenia | 2020 | Solanum lycopersicum | N, X, P, Y, M, G, L | OL472111 [14] | |
| PV-1127 | Germany | 2014 | Hydrangea macrophylla | N, X, P, Y, M, G, L | OQ847408 [15] | |
| 02923HTS | UK | 2022 | Pittosporum tobira | N, X, P, Y, M, G, L | OQ716555 [16] | |
| Pit-MAIB | Italy | 2008 | Pittosporum tobira | N, X, P, Y, M, G, L | LN680656 [17] | |
| Agapanthus | Italy | 2012 | Agapanthus sp. | N, X, P, Y, M, G, L | KJ082087 [18] | |
| PV-0031 | Italy | 1987 | Solanum melongena | N, X, P, Y, M, G, L | MW854257 | |
| EG1035 | Greece | Thessaloniki | 2009 | Solanum melongena | N, X, P, Y, M, G, L | FR751552 [6] |
| PV-1212 | Greece | Thessaloniki | 2017 | Cucumis sativus | N, X, P, Y, M, G, L | OL584369 |
| EMDVcs | Greece | Katerini | 2008 | Cucumis sativus | N, L1 | HG794532, HG794539 [11,19] |
| EMDVnt | Greece | Thessaloniki | 2006 | Nicotiana tabacum | N, L1 | HG794534, HG794540 [11,19] |
| EMDVsl | Greece | Thessaloniki | 2010 | Solanum lycopersicum | N, L1 | HG794535, HG794543 [11,19] |
| EMDVpit | Cyprus | Nicosia | 2011 | Pittosporum tobira | N, L1 | HG794531, HG794544 [11,19] |
| EMDV-Egg | Greece | 2007 | Hibiscus rosa-sinensis | L1 | AM922322 [19] | |
| EMDVhrs | Greece | Thessaloniki | 2009 | Lonicera japonica | N | HG794541 [11] |
| EMDVlj | Greece | Sifnos island | 2010 | Capparis spinosa | N | HG794542 [11] |
| EMDV-caps | Greece | Santorini | 2005 | Capparis spinosa | N | HG794545 [11] |
| EMDV-capsL | Greece | Rhodes | 2009 | Solanum melongena | L1 | HG794533 [19] |
| EMDVsm | Greece | Thessaloniki | 2010 | Hibiscus rosa-sinensis | L1 | HG794536 [19] |
| Vivaldi | Italy | Emilia-Romagna | 2012 | Solanum tuberosum | L1 | KC760150 [20] |
| C1 | Italy | Calabria | 2010 | Hibiscus rosa-sinensis | L1 | HG916814 [12] |
| C2 | Italy | Calabria | 2010 | Hibiscus rosa-sinensis | L1 | HG916815 [12] |
| SOM-1 | Italy | Campania | 2011 | Solanum melongena | L1 | HG916816 [12] |
| SOM-2 | Italy | Campania | 2011 | Solanum melongena | L1 | HG916817 [12] |
| SOM-3 | Italy | Campania | 2013 | Solanum melongena | L1 | HG916818 [12] |
| SOL-1 | Italy | Campania | 2010 | Solanum lycopersicum | L1 | HG916819 [12] |
| COV-1 | Italy | Emilia-Romagna | 1990 | Codiaeum variegatum | L1 | HG916820 [12] |
| EM170361 | France | 2017 | Solanum lycopersicum | L2 | MN990976 [10] | |
| EM170755 | France | 2017 | Cucumis sativus | L2 | MN990977 [10] | |
| T14_00910 | Australia | 2014 | Hibiscus syriacus | L2 | KJ742827 [21] | |
| AZ15-31 | Azerbaijan | 2015 | Cucumis sativus | Y1 | MG964325 [22] |
| Isolates | N | Y | L |
|---|---|---|---|
| SH-eg/STR20ST2 | 87.6 | 86.7 | 85.2 |
| SH-eg/EMDVpit | 85.9 | 84.4 | 98.2 |
| STR20ST2/EMDVpit | 89.2 | 90.1 | 85.0 |
| Gene | S | π | dN | dS | dN/dS | N | NSe | Pos | Neg |
|---|---|---|---|---|---|---|---|---|---|
| N | 0.209 | 0.167 | 0.012 | 0.443 | 0.027 | 1431 | 299 | 1 (449) | 140 |
| X | 0.320 | 0.225 | 0.072 | 0.587 | 0.123 | 294 | 94 | 1 (10) | 24 |
| P | 0.226 | 0.170 | 0.021 | 0.437 | 0.048 | 885 | 200 | 0 | 86 |
| Y | 0.189 | 0.241 | 0.005 | 0.485 | 0.010 | 864 | 163 | 0 | 112 |
| M | 0.228 | 0.178 | 0.017 | 0.474 | 0.036 | 756 | 172 | 0 | 96 |
| G | 0.223 | 0.163 | 0.012 | 0.501 | 0.023 | 1848 | 412 | 0 | 231 |
| L | 0.224 | 0.179 | 0.013 | 0.495 | 0.028 | 5841 | 1309 | 0 | 761 |
| Gene | N | Italy | Greece | Spain | |
|---|---|---|---|---|---|
| N | 3 | Italy | 0.166±0.015 | ||
| 8 | Greece | 0.148 ± 0.012 (−0.068) | 0.177± 0.014 | ||
| 13 | Spain | 0.187 ± 0.015 (0.524) | 0.203 ± 0.017 (0.487) | 0.019± 0.002 | |
| L1 | 10 | Italy | 0.110± 0.013 | ||
| 6 | Greece | 0.239 ± 0.036 (0.277) | 0.206± 0.031 | ||
| 18 | Spain | 0.285 ± 0.046 (0.688) | 0.206 ± 0.026 (0.475) | 0.025± 0.003 |
| N | Malaga | Granada | Almeria | Rest | |
|---|---|---|---|---|---|
| 3 | Malaga | 0.018±0.003 | |||
| 6 | Granada | 0.039 ± 0.005 (0.520) | 0.016± 0.004 | ||
| 4 | Almeria | 0.040 ± 0.005 (0.492) | 0.016 ± 0.002 (−0.094) | 0.019± 0.003 | |
| 5 | Rest | 0.038 ± 0.005 (0.472) | 0.019 ± 0.003 (0.046) | 0.019 ± 0.003 (0.011) | 0.018± 0.004 |
| Primer | Sequence | Position 1 | PCR Size 2 |
|---|---|---|---|
| EMDV-N1F2 | ATGACTATTTAAATAAAACCCAACAAC | 181–207 | 914 |
| EMDV-N2bR | AGTGGTGAGGAGCATCTTGTA′ | 1074–1094 | |
| EMDV-N2F2 | TTATTCAAGGCCTAGATACTTACACTG | 922–948 | 846 |
| EMDV-N1R2 | CACACACCACAAACATAGACTAGATAC | 1741–1767 | |
| EMDV-PL1a | ATGGGGGCATCCTATCATAGA- | 8165–8185 | 1053 |
| EMDV-PL2b | GCGACGTACTTTATATCACACACTGTCAT | 9189–9216 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alfaro-Fernández, A.; Taengua, R.; Font-San-Ambrosio, I.; Sanahuja-Edo, E.; Peiró, R.; Galipienso, L.; Rubio, L. Genetic Variation and Evolutionary Analysis of Eggplant Mottled Dwarf Virus Isolates from Spain. Plants 2024, 13, 250. https://doi.org/10.3390/plants13020250
Alfaro-Fernández A, Taengua R, Font-San-Ambrosio I, Sanahuja-Edo E, Peiró R, Galipienso L, Rubio L. Genetic Variation and Evolutionary Analysis of Eggplant Mottled Dwarf Virus Isolates from Spain. Plants. 2024; 13(2):250. https://doi.org/10.3390/plants13020250
Chicago/Turabian StyleAlfaro-Fernández, Ana, Rafael Taengua, Isabel Font-San-Ambrosio, Esmeralda Sanahuja-Edo, Rosa Peiró, Luis Galipienso, and Luis Rubio. 2024. "Genetic Variation and Evolutionary Analysis of Eggplant Mottled Dwarf Virus Isolates from Spain" Plants 13, no. 2: 250. https://doi.org/10.3390/plants13020250
APA StyleAlfaro-Fernández, A., Taengua, R., Font-San-Ambrosio, I., Sanahuja-Edo, E., Peiró, R., Galipienso, L., & Rubio, L. (2024). Genetic Variation and Evolutionary Analysis of Eggplant Mottled Dwarf Virus Isolates from Spain. Plants, 13(2), 250. https://doi.org/10.3390/plants13020250

