Next Article in Journal
Population Structure and Genetic Diversity of the 175 Soybean Breeding Lines and Varieties Cultivated in West Siberia and Other Regions of Russia
Next Article in Special Issue
Genetic Variation and Evolutionary Analysis of Eggplant Mottled Dwarf Virus Isolates from Spain
Previous Article in Journal
Dynamics of Organic Acids during the Droplet-Vitrification Cryopreservation Procedure Can Be a Signature of Oxidative Stress in Pogostemon yatabeanus
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Characteristics of Barley Yellow Dwarf Virus—PAS—The Main Causal Agent of Barley Yellow Dwarf Disease in Poland

by
Katarzyna Trzmiel
* and
Beata Hasiów-Jaroszewska
Department of Virology and Bacteriology, Institute of Plant Protection—National Research Institute, 60-318 Poznań, Poland
*
Author to whom correspondence should be addressed.
Plants 2023, 12(19), 3488; https://doi.org/10.3390/plants12193488
Submission received: 11 September 2023 / Revised: 29 September 2023 / Accepted: 2 October 2023 / Published: 6 October 2023

Abstract

Barley yellow dwarf is a threat to cereal crops worldwide. Barley yellow dwarf virus—PAS (BYDV-PAS) was detected for the first time in Poland in 2015, then in 2019. In the spring of 2021, in several locations in Poland, winter wheat and barley plants with dwarfism and leaf yellowing were collected. Reverse transcription—polymerase chain reaction results revealed BYDV presence in 47 samples and excluded wheat streak mosaic virus infections. Next, immuno-captured polymerase chain reactions confirmed only one case of co-infection caused by BYDV and wheat dwarf virus. Moreover, restriction fragment length polymorphism analysis showed that BYDV-PAS was predominant. The preliminary results were confirmed using sequencing. Infected cereal plants originated mainly from northwestern Poland. The complete coding sequence of coat protein (CP) and a fragment of RNA-dependent RNA polymerase (RdRp) genes of 14 Polish isolates were determined and deposited in the GenBank database. The nucleotide and deduced amino acid sequences of local isolates were compared with others reported to date, indicating their high similarity, from 75.4% to 99.5% and from 81.1% to 100% nucleotide sequence identity, in RdRp and CP, respectively. Phylogenetic analysis, based on the CP gene, revealed the presence of 3 main groups. The Polish isolates clustered together within the Ia group.

1. Introduction

Barley yellow dwarf (BYD) is one of the most important viral diseases of cereal crops in terms of both widespread occurrence and economic significance. In the past, several outbreaks of this disease were observed in various regions of the world: in 1907 and 1949 in the USA, in 1976 and 1986 in Canada, in 1977 in Italy, in 1998 in China, in 2003 in Spain, in 2002 and 2008 in the Czech Republic, and in 2001/2002 in Poland [1]. BYD is induced using a group of spherical barley yellow dwarf viruses (BYDVs) transmitted by about 25 aphid species [2,3]. The first classification of BYDVs distinguished different viruses by their primary aphid vector [4,5] or based on their serological properties [6] and next on nucleic acid sequences [7,8,9]. Currently, barley yellow dwarf virus species (BYDV)-kerII, -kerIII, -MAV, -PAS, and -PAV are grouped as the genus Luteovirus; cereal yellow dwarf virus species (CYDV)-RPV, -RPS and maize yellow dwarf virus-RMV (MYDV-RMV) are classified into the genus Polerovirus and BYDV-GAV, -SGV and -GPV are unassigned members in the family Luteoviridae [10]. The BYDV has a positive sense single-stranded (+ss) RNA genome of 5.6–5.8 kb in length with no 5′- cap and no poly(A) tail, and it is composed of 6 open reading frames (ORFs) [11]. In the first step of luteoviruses infection, their genomic RNA (gRNA), which encodes p1-helicase (ORF1) and p1-p2—RNA dependent RNA polymerase (RdRp), is translated. RdRp is created using a ribosomal frameshift of ORF1 and ORF2. Next, due to the polymerase activity of RdRp, replication of gRNA and transcription of sub-genomic RNAs (sgRNA1, sgRNA2, and sgRNA3) occur. The sgRNA1 serves as a template for the synthesis of p3a (ORF3a), p3—major component of coat protein (CP) (ORF3), p4—movement protein (MP) (ORF4) and p3-p5—minor component of CP (ORF3 and ORF5). The minor CP is expressed as an ORF 3/5 fusion by suppression of the ORF3 stop codon, expressing additional RTD protein (50 kDa) and producing larger (72–80 kDa) read-through protein (CP-RTD) [1]. In this study, two fragments, OFR2 and ORF3, will be analyzed. Viral infection causes leaf discoloration, yellowing, and dwarfism of infected plants. BYD severity depends on three main determinants: virus access time, virus species type, and cultivar genotype [1]. The disease is especially harmful for winter forms of cereals. Autumn infection caused by BYDVs can reduce grain yield by 63% and spring infection by 41% [12], with an average of 30% [13]. Although yield losses usually increase with the increase in disease incidence, BYD can reduce the yield even if the plant’s infection is asymptomatic [14]. On the other hand, in field conditions, plants are often infected by more than one virus species. As it has been previously shown, mixed infection of BYDV-PAV with wheat dwarf virus (WDV), wheat streak mosaic virus (WSMV), or barley mild mosaic virus (BaMMV) can affect the symptoms and disease severity [15]. Historical reports revealed local infections caused most often by single or mixed infections of BYDV-PAV and BYDV-MAV, and rarely of CYDV-RPV, in small-grain, in Poland [16]. However, further studies revealed the presence of new species (BYDV-PAS, BYDV-SGV, and BYDV-GAV) and numerous cases of co-infection [17,18,19,20].
The aim of this study was to determine the type of infection as well as evaluate the genetic variability of newly collected BYDV isolates and comparison with others described to date.

2. Results

2.1. Molecular Diagnostics

The results of this study confirmed virus presence in the majority of analyzed plant samples (47 positive/50 tested) collected from 20 various locations, mostly in northwestern Poland (Figure 1). The symptoms of 3 virus-free samples (2 wheat and 1 barley) from one location in the Greater Poland region have probably been caused by other pathogens, e.g., fungi or other factors affecting cereals. Molecular diagnostic results showed the prevalence of BYDV in tested samples. Partial results of RT-PCR tests are presented in Figure 2. The RFLP analyses revealed one characteristic banding pattern after digestion of the RT-PCR products by Hpa II, which indicates BYDV-PAS infections (Figure 3). In IC-Duplex-PCR tests, the presence of WDV-B specific amplicons (483 bp in size) was obtained only for three tested plant samples from one location in the Lubusz region. Moreover, additional RT-PCR tests with WSMV-specific primers did not confirm plant infection. The sequencing results of the obtained RT-PCR products were consistent with the results of the RT-PCR-RLFP reaction and confirmed BYDV-PAS presence in all analyzed samples.

2.2. Comparative Analysis

Obtained results allowed us to determine the complete coding sequence of CP (603 nucleotide, nt) as well as the partial coding sequence of RdRp (942 nt) genes of the Polish BYDV-PAS isolates. A set of nucleotide sequences (from BYDV-PAS-P1 to BYDV-PAS-P14) were deposited in the NCBI GenBank database. Their short characteristics with the accession numbers of individual samples are presented in Table 1. Comparative analysis of CP nt sequences revealed 100% identity for BYDV-PAS -P2, -P3, -P4, -P5, -P7, -P8, -P9, and -P12, as well as for BYDV-PAS-P11 and -P14 isolates. For the remaining Polish samples, some variability in nt and amino acid (aa) sequences was observed, and their identity ranged from 98.8% to 99.8% and from 97.2% to 100%, respectively. Analogically, the homological RdRp partial coding sequence was revealed only for four isolates (BYDV-PAS -P4, -P7, -P8, and -P9). The alignment results for the other Polish isolates showed that nt and aa sequence identity ranged from 97.5% to 99.8% and from 98% to 100%, respectively. The results indicated the dominance and prevalence of one genetic variant in various regions of the country, as well as a slight variation in obtained coding sequences of CP and RdRp. Four out of the 14 obtained sequences of RdRp and CP shared 100% identity. Interestingly, these isolates originated from various host plants (wheat and barley) growing in different parts of the country during different seasons (2014/2015 and 2020/2021). Comparison of CP nt sequences in the analyzed BYDV population revealed identity ranging from 81.1% to 100% and from 72.6% to 100% for aa sequences, respectively. The analysis of RdRp sequences showed identity ranging from 75.4% to 99.5% and from 78% to 100% for nt and aa, respectively. The dominant variant within the Polish population (BYDV-PAS-P2) shared 100% identity with the group of Estonian isolates (-Jogeva1, -Jogeva4, -Matapera, -Puide, -Rannu1, -Olustvere 2-W), German isolates (BYDV-PAS-26-1, -26-4, -114) as well as to Turkish one (BYDV-PAS-TR60-S51). Moreover, 100% identity of aa sequences of obtained RdRp fragment of BYDV-PAS-P2, -P3, -P6, -P14 to -Jogeva4 and -Olustvere2-W was also demonstrated. Nevertheless, the analyzed group of BYDV-PAS isolates shared the slightest identity with both South Korean isolates BYDV-PAS-JE and -KJ, originating from infected oat plants. For CP, the range of identity was 81.2–81.8% and 89.2–89.6% (nt sequences) and 72.2–73.3% and 85–86.1% (aa sequences), for BYDV-PAS-JE and -KJ, respectively. Analogically, for RdRp, nt sequence identity values ranged from 78.3% to 78.9% and from 75.4 to 76%, and for the aa sequence, from 83.4% to 84.1% and from 78% to 79%, respectively. The visualization of nt and aa sequence’s identity for CP and RdRp fragment, performed by SDTv1.2, was shown in Figure 4 and Figure 5, respectively.

2.3. Assessment of Variability and Recombination Analysis

Detailed analysis assessed the variability of aa sequences in two hypervariable regions of CP. The first region encompasses 45–60 aa residues (A/S/TGRRGPN/DSI/VPGSA/TGRT), the second one 155–168 aa residues (EAINGKD/EFQESTID). Both of them have been used for the differentiation of BYDV species [21]. The results of multi-sequence alignment analysis of the first region of CP showed a division into three main groups of isolates: (i) Polish, Estonian, German, Moroccan, Belgium, Turkish and some part of American (BYDV-PAS-0109, -OH3, -KS-SHKR, KS-PAS2); (ii) the most part of American isolates, (iii) Pakistani, New Zealand and South Korean (BYDV-PAS-CNU-GNW, from wheat). Moreover, a clear difference and the presence of up to 10 aa changes in this CP region was demonstrated for the remaining South Korean isolates BYDV-PAS-KJ and -JE, originating from oat plants. Analogically, for the second CP region, more conservative within BYDV-PAS population, the presence of two main groups was revealed: (i) Polish, Estonian, German, Moroccan, Belgium, and some part of American (BYDV-PAS-0109, -OH3, -KS-SHKR, KS-PAS2); (ii) the rest part of American isolates, Pakistani, New Zealand, Turkish and South Korean (BYDV-PAS- CNU-GNW, -KJ). BYDV-PAS-JE, like in the mentioned region, shared only four common aa residues and differed from the other BYDV-PAS isolates in 12 of 16 positions. The recombination analysis performed for the RdRp fragment revealed the existence of one potential recombinant—South Korean BYDV-PAS-JE, with potential major BYDV-PAS-OH3 and minor BYDV-PAS-KJ parents. Analogical analysis for CP pointed to German BYDV-PAS-143-2 isolate with major BYDV-PAS-Olustvere2-B and minor BYDV-PAS-KJ parents. The putative recombinants were detected using at least 6 RDP4 detection methods; therefore, they were not considered in the next phylogenetic analysis.

2.4. Phylogenetic Analysis

The phylogenetic analysis showed the presence of 3 main clusters. The first one, which was the most variable, was divided into three subgroups, named Ia, Ib, and Ic. The results performed for two various regions of the BYDV-PAS genome (CP and RdRp gene fragments) were convergent (Figure 6 and Figure 7).
In general, a similar arrangement of generated phylogenetic trees was observed, but slight differences were also noticeable. In the tree based on CP nt sequences, all the Polish isolates are grouped in the same cluster (Ia). However, closer phylogenetic relationships between BYDV-PAS-P10, -P11, and -P13 and some distance between BYDV-PAS-P1, -P2, and -P6 were also noticed. The group of Polish BYDV-PAS isolates clustered together with Estonian, German, Moroccan, and four isolates from the USA. The American isolates, BYDV-PAS-KS-SHKR, -KS-PAS-2, -0109, and -OH3, originated from Kansas, Iowa, and Ohio, respectively (Table 1). Moreover, single isolates from Belgium (BYDV-PAS-Pecq) and Turkey (BYDV-PAS-TR60-S51) were also included in this cluster. The second subgroup, Ib, was created mostly by different American isolates, with two isolates from New Zealand (BYDV-PAS-waw5-1 and -waw5-9) and one originating from Republic of Korea (BYDV-PAS-CNU-GNW). The last one, Ic, was represented by only a single, more distinct Pakistani BYDV-PAS-M40-2 isolate from Pennisetum glaucum (pearl millet). The second cluster was created using only two isolates, BYDV-PAS-OH2 from Ohio and BYDV-PAS-KJ from Republic of Korea. The third cluster, and one separate branch, was represented by the South Korean isolate BYDV-PAS-JE. For the RdRp tree, the available nt sequences came from Poland, Estonia, the USA, Republic of Korea, Belgium, and Turkey. Phylogenetic analysis based on the nt sequence of RdRp gene fragment confirmed the similar location of BYDV-PAS-P1, -P2, and -P6 isolates, but in this variant, stronger differentiation and location of BYDV-PAS-P13 on another branch of Ia was revealed. Moreover, the American isolate (BYDV-PAS-OH3) belonging to the Ia subgroup of the CP tree in the RdRp tree was classified as a separate Ib subgroup. On the other hand, the next American isolates (BYDV-PAS-129 and -KS-PAS1), clustered together in the Ib of the CP tree, were divided into two separate branches, Ic and II subgroups, respectively. Finally, BYDV-PAS-KJ, clustered together with BYDV-PAS-OH2 in the II group of the CP tree, in the RdRp tree, was merged with BYDV-GAV, used as an outgroup. Similar results were obtained based on aa sequence of both analyzed regions. For CP, the Polish BYDV-PAS isolates shared from 98.8% to 100% nt identity with a group of European and Morrocan isolates, while with American, New Zealand, and Pakistani from 95.5% to 96.2%, respectively. Analogically, for RdRp, the corresponding values were 97.5–99.8% and 92.8–99.5%.

3. Discussion

Knowledge about the presence and diversity of BYDV species in local fields is very important in the epidemiology context for two main reasons: firstly, the severity of the symptoms can depend on the particular BYDV/CYDV/MYDV species; secondly, the transmission efficiency of virus species varies with the aphid vector species [22]. In addition, as it has been previously reported [23], virus prevalence varies from year to year, so this kind of information may be useful for disease management in the future.
BYDV-PAS was separated from BYDV-PAV, considered a distinct species, and placed on the ICTV list in 2002 [9] due to genome sequence divergences. Current species demarcation criteria within the Luteoviridae family take into account >10% differences in aa sequences of any viral gene product [24]. BYDV-PAS has been confirmed in many countries around the world: the USA [25], New Zealand [26], Republic of Korea [27], Morocco [28], and in Europe—France [29], Czech Republic [30], Poland [18], Estonia [31]. However, the real BYDV-PAS occurrence might be underestimated. According to Chay et al. [32], BYDV-PAV antiserum does not discriminate between BYDV-PAV and BYDV-PAS. In addition, even based on sequencing results, some BYDV-PAS samples have been wrongly classified as BYDV-PAV [25]. Finally, the existence of recombination events complicates proper classification and the taxonomy of BYDV species [31].
The published results, based on serological methods, indicated the dominance of BYDV-PAV and -MAV with a lower proportion of CYDV-RPV infections in Poland [16]. However, further molecular analysis of cereal samples from the last epidemic BYD in the 2014/2015 season revealed the presence of other species: BYDV-PAS, -SGV, and -GAV in the country. Moreover, mixed infection of BYDV-MAV/WDV, BYDV-PAV/WDV, and BYDV-MAV/-PAV/-PAS occurred commonly and led to synergistic effects [18]. Further research from 2019 confirmed the co-infection of BYDV-MAV/BYDV-PAS and BYDV-MAV/BYDV-PAV and revealed the spread of newly detected species to other regions of the country. Furthermore, the obtained results showed a new tendency for the common occurrence of BYDV-PAS and BYDV-SGV in the group of BYDV species detected in cereal crops in Poland [19]. Current research results revealed increasing dominance of single BYDV-PAS infection with only one case of BYDV-PAS/WDV-B co-infection. Based on the above results, it can be assumed that BYDV-PAS is currently the main factor causing BYD symptoms in Poland. These observations are in contrast with those reported by Hodge et al. [33] from the USA (Ohio) and Kim et al. [27] from Republic of Korea, where BYDV-PAV was predominant among BYDV species. On the other hand, our findings are consistent with the results from Europe, the Czech Republic [34,35,36], and Estonia [31], where BYDV-PAS abundance was confirmed both using high-throughput sequencing (HTS) and conventional RT-PCR results. According to Authors from the Czech Republic, prevalent BYDV-PAS distribution might be partly explained by (i) high BYDV-PAS incidence on tested volunteer plants and wild grasses in which it can overwinter, (ii) a wider range of examined aphid vectors (four species), in comparison to BYDV-PAV (2 species) or BYDV-MAV (only one species); (iii) differences in pathogenicity of BYDVs. Results presented here confirmed BYDV-PAS infections, both in cultivated cereals and in perennial grasses. Moreover, based on the data of Strażyński and Roik [37], 3 of the main vectors of BYDV-PAS, Ropalosiphum padi, Sitobion avenae, and Metopolophium dirhodum, are still the most numerous species among the economically important group of aphids in Johnson’s suction trap in Poland. The obtained results may also be related to the fact that BYDV-PAS induces more severe symptoms than BYDV-PAV [28,32], and for this study, the samples with clear symptoms were collected.
Comparative sequence analysis showed that the Polish BYDV-PAS isolates are highly similar to each other and share overall >98% and >99% nt similarity for RdRp and CP, respectively. However, a detailed analysis of the available 52 CP sequences and 33 RdRp sequences revealed some variability. The group of Polish isolates was more similar to the group of isolates from Europe and Morocco than to those from the USA, New Zealand, or Pakistan. In conclusion, similarly to Hall [38], current sequence alignment studies confirmed that the CP of BYDV-PAS was less diverse than RdRp. However, as it was previously reported for BYDV-PAV [21,29], sequence variability within two short 5′ CP hyper-variable domains, covering 45–60 and 155–168 aa residues, also affects the grouping of BYDV-PAS isolates. This division was reflected in phylogenetic relationships related rather to the mentioned genetic diversity than with geographic origin or hosts of studied isolates. As proof of this statement, cluster Ia grouped the isolates originated from different countries and infecting different host plants: BYDV-PAS-Imavere (Estonia, Secale cereale), BYDV-PAS-OH3 (the USA, Triticum aestivum), BYDV-PAS-2 (Germany, Lolium multiflorum); BYDV-P10 (Poland, Bromus sp.), BYDV-PAS-TR60-S51 (Turkey, Geranium dissectum) and BYDV-PAS-Pecq (Belgium, Hordeum vulgare). The findings concerning BYDV-PAS isolates did not confirm such close relationships between phylogeny, geographical affiliation, or host as it was presented for the BYDV-PAV population by Wu et al. [39].
Next, the presented findings confirmed that both South Korean BYDV-PAS-JE and BYDV-PAS-KJ isolates, same as previously characterized by Hodge et al. [33], American BYDV-PAS-OH2, were distinct from the others. The RdRp fragment of BYDV-PAS-JE, -KJ, and BYDV-PAS-OH2 shared, respectively, from 78% to 84.2% and from 86.6% to 87.6% aa sequence similarity with the others. Analogically, for CP, these values ranged from 72.2% to 86.1% and from 91% to 93.2%, respectively. So, both of their analyzed genome regions were more than 10% divergent at the aa level from other BYDV-PAS isolates. According to current rules of classification within the Luteoviridae family [24], they should be classified as novel variants of BYDV-PAS, like it was presented for BYDV-PAS-OH2 by Hodge et al. [33], or even as separate BYDV species. The distinctness of these isolates was also strongly supported by maximum likelihood phylogenetic trees generated using CP and RdRp nt sequences. As it was shown in the CP tree, listed above virus isolates did not cluster with either of 2 large clades of BYDV-PAS and created two distinct branches (BYDV-PAS-OH2 with BYDV-PAS-KJ and BYDV-PAS-JE) (Figure 6) while in RdRp tree BYDV-PAS-OH2 grouped alone and BYDV-PAS-KJ clustered together with BYDV-GAV which was used as an outgroup (Figure 7). Due to a confirmed recombination event in the BYDV-PAS-JE for RdRp fragment, it was rejected from the analyzed group of isolates because, as it was previously reported, recombination disturbs the proper classification of BYDV species [31]. Taking into account the great importance of recombination presence, such comparative studies using whole genome sequences of BYDV-PAS should be continued in the future.
The present study is the first report providing molecular characteristics of the Polish isolates of BYDV-PAS and a current description of the phylogenetic relationships of its world’s population. Based on the obtained results, it can be assumed that this species is the most frequently occurring BYDV species in this region of Europe. Taking together this knowledge can contribute to understanding of BYDV epidemiology and will help to determine the changes in BYDV structure over time.

4. Materials and Methods

4.1. Plant Sources

The plant samples of winter barley (30) and wheat (19) with stunting and leaf yellowing symptoms, as well as one symptomatic wild grass (Bromus sterillis), were collected from commercial fields in 20 various locations, in the spring of 2021 (from April to June). Samples originated from northern [Western-Pomerania (5), Pomerania (10), Kuyavia-Pomerania (2)], central [Lubusz (15), Greater Poland (17)] as well as southern [Subcarpathia (1)] regions of Poland. Additionally, the samples of wheat (1) and triticale (1) from Western Pomerania, wheat (1) from Warmia-Masuria, and barley (3) from Lower Silesia, collected in 2015 and 2018, were also used in this study.

4.2. RNA Isolation

Total RNA was extracted from all 56 symptomatic plant samples using the Total RNA Purification Kit (Novazym, Poznań, Poland) according to the manufacturer’s instructions. The concentration of total RNA was measured with a NanoDrop 2000 spectrophotometer (NanoDrop Technologies, Thermo Fisher Scientific, Waltham, MA, USA) and stored at −20 °C.

4.3. Reverse Transcription-Polymerase Chain (RT-PCR)

The one-step RT-PCR reactions were used to amplify the sequences of BYDV CP (641 bp) and a portion of RdRp (955 bp) genes. The reactions were performed with the primers BYcp-F/BYcp-R designed by Kundu [30] and with PASrdrp-F (AGGACTTCATCAGCCACTGC) and PASrdrp-R (AAAAACCCTGGGAATCAAGC), developed for the purpose of this study. The oligonucleotides were designed by Primer3software (http://frodo.wi.mit.edu/, accessed on 11 September 2023) [40] based on the full-length nt of BYDV-PAS-Jogeva1 (MK012659). The reactions, for all isolated samples, were carried out using 0.2 µL of RevertAid Reverse Transcriptase 200U/µL (Thermo Fisher Scientific), 5 µL of Dream Taq Green PCR Master Mix (2X) (Thermo Fisher Scientific), 0.2 µL Primer Mix (10 µMol/µL each) and sterile Milli-Q water for a final volume of 10 µL. Amplification was performed in thermal conditions as follows: reverse transcriptase at 42 °C for 20 min, then initial denaturation at 94 °C for 3 min, 40 cycles of 30 s at 94 °C, 30 s at 55 °C for CP, and 50 °C for RdRp, 60 s at 72 °C and a final elongation at 72 °C for 5 min. Additionally, to detect and amplify CP of the WSMV genome (1000 bp), RT-PCR one-step reactions with specific WSMV-CPeur-F/WSMV-CP-R primers were performed according to the procedure presented by Trzmiel et al. [41]. The presence of specific RT-PCR products was verified on 1% TBE gel electrophoresis stained with Midori Green DNA Stain (Nippon Genetics Europe GmbH, Düren, Germany) for UV light visualization.

4.4. Restriction Fragment Length Polymorphism Analysis (RFLP)

In order to discriminate BYDV species, additional RFLP reactions were carried out according to Kundu et al. [34]. Amplified DNA samples (CP region) were digested by Hpa II endonuclease (Thermo Fisher Scientific) at 37 °C for 3 h and then separated in 2% TBE agarose gel and stained as described above.

4.5. Immuno-Capture-Duplex Polymerase Chain Reaction (IC-Duplex PCR)

In order to identify barley- or wheat-specific forms (WDV-B and WDV-W, respectively), IC-Duplex PCR was carried out. The reactions were performed with WDV-H-F/WDV-H-R and WDV-T-F/WDV-T-R primer pairs, according to the procedure described by Trzmiel [19]. Reaction results were checked by electrophoresis of obtaining products in 1% TBE agarose gel as described above.

4.6. DNA Sequencing

Fourteen selected RT-PCR amplicons, obtained from barley, wheat, and B. sterillis plants originating from various regions of Poland were used for direct sequencing (Table 1). Reaction products of 955 and 641 pb in size, specific for RdRp and CP genes, respectively, were excised from agarose gels and purified using the Wizard® SV Gel and PCR Clean-Up System (Promega Corp., Madison, WI, USA). Eluted DNA samples were subsequently sequenced by Genomed S.A. (Warsaw, Poland) using specific primers (PASrdrp-F/PASrdrp-R and BYcp-F/BYcp-R). The nucleotide sequences were analyzed using Standard Nucleotide BLAST (BLAST, http://blast.cnbi.nlm.nih.gov/Blast.cgi, accessed on 11 September 2023), compiled and edited using the BioEdit software, version 7.2.5 [42]. The nucleotide sequences of the RdRP fragment and CP complete genes were deposited in the National Center for Biotechnology Information (NCBI) GenBank database with accession numbers listed in Table 1.

4.7. Estimating Sequence Similarity and Recombination Events

Partial genome sequences of 14 BYDV-PAS isolates obtained in this study and 47 BYDV-PAS isolates retrieved from the GenBank database (Table 1) were used in phylogenetic analyses. The alignments were performed for fragments of coding sequences of RdRp (ORF2) and CP (ORF3). The multiple sequence alignments were conducted using the ClustalW implemented in BioEdit program [42,43]. Sequence identity matrices were displayed using BioEdit and Sequence Demarcation Tool Version 1.2 (SDTv1.2) [44]. Phylogenetic analyses were preceded by an estimation of the occurrence of potential recombination events within the above-mentioned BYDV-PAS isolates. For this purpose, RDP, GENECONV, Chimaera, MaxChi, BootScan, SiScan, 3Seq, and LARD methods implemented in the Recombination Detection Program version 4 (RDP4) with default settings [45] were used. Recombination events were considered significant if four or more of these methods had a p < 0.05 in addition to phylogenetic evidence of recombination.

4.8. Phylogenetic Analysis

Phylogenetic studies were conducted for two amplified 942 and 535 nt trimmed fragments, respectively, for RdRp and CP genes within the 5′ and 3′ ends of the viral genome. Due to nt sequence identity a set of 6 different representative sequences for the CP gene of the Polish BYDV-PAS-P1, -P2, -P6, -P10, -P11, -P13 and 11 different sequences for RdRp gene of BYDV-PAS-P1, -P2, -P3, -P4, -P5, -P6, -P10, -P11, -P12, -P13, -P14 isolates, as well as 46 (for CP) and 22 (for RdRp) other BYDV-PAS sequences from the GenBank database, with deleted recombinant variants, were used for the analysis (Table 1). Chinese BYDV-GAV (AY220739) served as an outgroup. The phylogenetic relationships were analyzed by maximum likelihood algorithm (ML), choosing the best DNA/Protein model Kimura 2-parameter (K2+G) for nt and Jones-Taylor-Thornton (JTT+G) and Le Gascuel (LG+G) for deduced amino acids (aa) sequences, implemented in MEGA11 [46]. Bootstrap values were calculated using 1000 random replications. Phylogenetic trees were edited and visualized in the Evolview online platform [47].

Author Contributions

Conceptualization, K.T. and B.H.-J.; methodology, K.T.; software, K.T.; validation, K.T. and B.H.-J.; formal analysis, K.T. and B.H.-J.; investigation, K.T.; resources, K.T., data curation, K.T.; writing—original draft preparation, K.T.; writing—review and editing, B.H.-J.; visualization, K.T.; supervision, B.H.-J.; project administration, B.H.-J.; funding acquisition, B.H.-J. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the Ministry of Education and Science, research subvention—WIB03 for years 2020–2023.

Data Availability Statement

The datasets generated during the current study are available from the corresponding author upon reasonable request.

Acknowledgments

The authors would like to thank Agnieszka Taberska and Julia Minicka for their help with graphic editing.

Conflicts of Interest

The authors have no relevant financial or non-financial interests to disclose.

References

  1. Ali, M.; Anwar, S.; Shuja, M.N.; Triparthi, R.K.; Singh, J. The genus Luteovirus from infection to disease. Eur. J. Plant Pathol. 2018, 151, 841–860. [Google Scholar] [CrossRef] [Scilit]
  2. Domier, L.L. Genome structure and function of barley yellow dwarf viruses. In Barley Yellow Dwarf 40 years of Progress, 1st ed.; D’Arcy, C.J., Burnett, P.A., Eds.; APS Press: St. Paul, MN, USA, 1995; pp. 181–201. [Google Scholar]
  3. Halbert, S.; Voegtlin, D. Biology and taxonomy of vectors of barley yellow dwarf viruses. In Barley Yellow Dwarf 40 Years of Progress, 1st ed.; D’Arcy, C.J., Burnett, P.A., Eds.; APS Press: St. Paul, MN, USA, 1995; pp. 217–258. [Google Scholar]
  4. Rochow, W.F. Biological properties of four isolates of Barley yellow dwarf virus. Phytopathology 1969, 59, 1580–1588. [Google Scholar] [PubMed]
  5. Rochow, W.F.; Muller, I. Fifth variant of Barley yellow dwarf virus in New-York. Plant Dis. Rep. 1971, 55, 874–879. [Google Scholar]
  6. Rochow, W.F.; Carmichael, L.E. Specificity among barley yellow dwarf viruses in enzyme immunosorbent assays. Virology 1979, 95, 415–420. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Cheng, Z.M.; He, X.Y.; Wu, M.S.; Zhou, G.H. Nucleotide sequence of coat protein gene for GPV isolate of Barley yellow dwarf virus and construction of expression plasmid for plant. Sci. China Ser. C 1996, 39, 534–543. [Google Scholar]
  8. Wang, X.; Chang, S.; Jin, Z.; Li, L.; Zhou, G. Nucleotide sequences of the coat protein and readthrough protein genes of the Chinese GAV isolate of Barley yellow dwarf virus. Acta Virol. 2001, 45, 249–252. [Google Scholar]
  9. Mayo, M.A. ICTV at the Paris ICV: Results of the plenary session and the binomial ballot. Arch. Virol. 2002, 147, 2254–2260. [Google Scholar] [CrossRef] [Scilit]
  10. Domier, L.L. Family Luteoviridae. In Virus taxonomy classification and nomenclature of Viruses: Ninth Report of the International Committee on Taxonomy of Viruses, 1st ed.; King, A.M.Q., Adams, M.L., Carstens, E.B., Lefkowitz, E.J., Eds.; Elsevier Academic Press: San Diego, CA, USA, 2012; pp. 1045–1053. [Google Scholar]
  11. Miller, W.A.; Liu, S.; Beckett, R. Barley yellow dwarf virus: Luteoviridae or Tombusviridae? Mol Plant Pathol 2002, 3, 177–183. [Google Scholar] [CrossRef] [Scilit]
  12. Brakke, M.K. Virus disease in wheat. In Wheat and Wheat Improvement, 2nd ed.; Heyne, E.G., Ed.; American Social of Agronomy: Madison, WI, USA, 1987; pp. 585–603. [Google Scholar]
  13. Perry, K.L.; Kolb, F.L.; Samsons, B.; Lawson, C.; Cisar, G.; Ohm, H. Yield effects of barley yellow dwarf virus in soft red winter wheat. Phytopathology 2000, 90, 1043–1048. [Google Scholar] [CrossRef] [Scilit]
  14. Jones, R.; McKirdy, S.; Shivas, R. Occurrence of barley yellow dwarf viruses in over-summering grasses and cereal crops in Western Australia. Australas. Plant Pathol. 1990, 19, 90–96. [Google Scholar] [CrossRef] [Scilit]
  15. Achon, M.A.; Serrano, L.; Ratti, C.; Rubies-Autonell, C. First detection of Wheat dwarf virus in barley in Spain associated with an outbreak of barley yellow dwarf. Plant Dis 2006, 90, 970. [Google Scholar] [CrossRef] [Scilit]
  16. Jeżewska, M.; Cajza, M.; Buchowska-Ruszkowska, M. Monitoring and molecular diagnostics of cereal viruses. In Reducing Losses in Crop Yields with Food Safety, 1st ed.; Sosnowska, D., Ed.; Instytut Ochrony Roślin–PIB: Poznań, Poland, 2010; pp. 157–180. [Google Scholar]
  17. Jeżewska, M.; Trzmiel, K. Outbreak of barley yellow dwarf in winter cereals in Poland in the season 2014/2015. Prog. Plant Prot. 2016, 56, 296–301. [Google Scholar]
  18. Trzmiel, K. Identification of barley yellow dwarf viruses in Poland. J Plant Pathol 2017, 99, 493–497. [Google Scholar]
  19. Trzmiel, K. Occurrence of Wheat dwarf virus and Barley yellow dwarf virus species in Poland in the spring of 2019. J. Plant Prot. Res. 2020, 60, 345–350. [Google Scholar]
  20. Trzmiel, K.; Klejdysz, T. Detection of barley- and wheat-specific forms of Wheat dwarf virus in their vector Psammotettix alienus by duplex PCR assay. J. Plant Prot. Res. 2018, 58, 54–57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Liu, F.; Wang, X.; Liu, Y.; Xie, J.; Gray, S.M.; Zhou, G.; Gao, B. A Chinese isolate of barley yellow dwarf virus-PAV represents a third distinct species within the PAV serotype. Arch. Virol. 2007, 152, 1365–1373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Van den Eynde, R.; Van Leeuwen, T.; Haesaert, G. Identifying drivers of spatio-temporal dynamics in barley yellow dwarf virus epidemiology as a critical factor in disease control. Pest. Manag. Sci. 2020, 76, 2548–2556. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Paliwal, Y.C. Identyfication and annual variation of variants of barley yellow dwarf virus in Ontario and Quebec. J. Plant Pathol. 1982, 4, 59–64. [Google Scholar]
  24. D’Arcy, C.J.; Domier, L.L. Family Luteoviridae. In Virus Taxonomy: VIIIth Report of International Committee on Taxonomy of Viruses, 1st ed.; Faequet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U., Ball, L.A., Eds.; Elsevier Academic Press: San Diego, CA, USA, 2005; pp. 891–900. [Google Scholar]
  25. Robertson, N.L.; French, R. Genetic structure in natural populations of barley/cereal yellow dwarf virus isolates from Alaska. Arch. Virol. 2007, 152, 891–902. [Google Scholar] [CrossRef] [Scilit]
  26. Delmiglio, C. The Incidence and Phylogenetic Analysis of Viruses Infecting New Zealand’s Native Grasses. Ph.D. Thesis, University of Aukland, Auckland, New Zealand, 2008. [Google Scholar]
  27. Kim, N.K.; Lee, H.J.; Kim, S.M.; Jeong, R.D. Identification of viruses infecting oats in Korea by metatranscriptomics. Plants 2022, 11, 256. [Google Scholar] [CrossRef] [Scilit]
  28. Bencharki, B.; Muttere, J.; El Yamani, M.; Ziegler-Graff, V.; Zaoui, D.; Jonard, G. Severity of infection of Moroccan barley yellow dwarf virus PAV isolates correlates with variability in their coat protein sequences. Ann. Appl. Biol. 1999, 13, 843–853. [Google Scholar] [CrossRef] [Scilit]
  29. Mastari, J.; Lapierre, H.; Dessens, J.T. Asymetrical distribution of barley yellow dwarf virus PAV variants between host plant species. Phytopathology 1998, 88, 818–821. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Kundu, J.K. First report of barley yellow dwarf virus-PAS in wheat and barley grown in the Czech Republic. Plant Dis. 2008, 92, 1587. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Sõmera, M.; Massart, S.; Tamisier, L.; Sooväli, P.; Sathees, K.; Kvarnheden, A. A survey using high-throughput sequencing suggests that the diversity of cereal and barley yellow dwarf viruses is underestimated. Front. Microbiol. 2021, 12, 673218. [Google Scholar]
  32. Chay, C.A.; Smith, D.M.; Vaughan, R.; Gray, S.M. Diversity among isolates within the PAV serotype of barley yellow dwarf virus. Phytopathology 1996, 86, 370–377. [Google Scholar] [CrossRef] [Scilit]
  33. Hodge, B.A.; Paul, P.A.; Stewart, L.R. Occurrence and High-Throughput Sequencing of Viruses in Ohio wheat. Plant Dis. 2020, 104, 1789–1800. [Google Scholar] [CrossRef] [Scilit]
  34. Kundu, J.K.; Jarošova, J.; Gadiou, S.; Červena, G. Discrimination of three BYDV species by one-step RT-PCR-RFLP and sequence based methods in cereal plants from the Czech Republic. Cereal Res. Commun. 2009, 37, 541–550. [Google Scholar] [CrossRef] [Scilit]
  35. Jarošova, J.; Chrpova, J.; Šip, V.; Kundu, J.K. A comparative study of the Barley yellow dwarf virus species PAV and PAS: Distribution, accumulation and host resistance. Plant Pathol. 2013, 62, 436–443. [Google Scholar] [CrossRef] [Scilit]
  36. Singh, K.; Jarošova, J.; Fousek, J.; Chen, H.; Kundu, J.K. Virome identification in wheat in the Czech Republic using small RNA deep sequencing. J. Integr. Agric. 2020, 19, 1825–1833. [Google Scholar] [CrossRef] [Scilit]
  37. Strażyński, P.; Roik, K. Registration of the flight dynamics of economically important aphid species using the Jonson’s suction trap and its importance in the integrated protection of agricultural crops. Prog. Plant Prot. 2021, 61, 246–252. [Google Scholar]
  38. Hall, G. Selective constraint and genetic differentiation in geographically distant barley yellow dwarf virus populations. J. Gen. Virol. 2006, 87, 3067–3075. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Wu, B.; Blanchard-Letort, A.; Liu, Y.; Zhou, G.; Wang, X.; Elena, S.F. Dynamics of Molecular Evolution and Phylogeography of Barley yellow dwarf virus-PAV. PLoS ONE 2011, 6, e16896. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Rozen, S.; Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 2000, 132, 365–386. [Google Scholar] [PubMed]
  41. Trzmiel, K.; Szydło, W.; Hasiów-Jaroszewska, B. Biological and molecular characterisation of the two Polish Wheat streak mosaic virus isolates and their transmission by wheat curl mites. Plant Prot. Sci. 2021, 57, 171–178. [Google Scholar] [CrossRef] [Scilit]
  42. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  43. Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTALW: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choise. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Muhire, B.M.; Varsani, A.; Martin, D.P. SDT: A Virus Classification Tool Based on Pairwise Sequence Alignment and Identity Calculation. PLoS ONE 2014, 9, e108277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Martin, D.P.; Murrell, B.; Golden, M.; Khoosal, A.; Muhire, B. RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evol. 2015, 1, vev003. [Google Scholar] [CrossRef] [Scilit]
  46. Tamura, K.; Stecher, G.; Kumar, S. MEGA 11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [Scilit]
  47. Subramanian, B.; Gao, S.; Lercher, M.J.; Hu, S.; Chen, W.H. Evolview v3: A webserver for visualization, annotation, and management of phylogenetic trees. Nucleic Acids Res 2019, 47, W270–W275. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Locations of BYDV-PAS infections in Poland in Spring 2021. Black dots represent the locations of BYDV-PAS infection, orange dots show the locations where the samples were collected for sequencing. Names of the regions: I—West-Pomerania, II—Pomerania, III—Warmia-Masuria, IV—podlaskie, V—Lubusz, VI—Greater Poland, VII—Kujavia-Pomerania, VIII—Masovia, IX—łódzkie, X—lubelskie, XI—Lower Silesia, XII—opolskie, XIII—Silesia, XIV—świętokrzyskie, XV—Lesser Poland, XVI—Subcarpathia.
Figure 1. Locations of BYDV-PAS infections in Poland in Spring 2021. Black dots represent the locations of BYDV-PAS infection, orange dots show the locations where the samples were collected for sequencing. Names of the regions: I—West-Pomerania, II—Pomerania, III—Warmia-Masuria, IV—podlaskie, V—Lubusz, VI—Greater Poland, VII—Kujavia-Pomerania, VIII—Masovia, IX—łódzkie, X—lubelskie, XI—Lower Silesia, XII—opolskie, XIII—Silesia, XIV—świętokrzyskie, XV—Lesser Poland, XVI—Subcarpathia.
Plants 12 03488 g001
Figure 2. Detection of BYDV coat protein (CP) region (641 bp) in plant samples by RT-PCR. Amplified products were analyzed in 1% TBE agarose gel. Lanes: (M)—100 bp DNA ladder (Novazym); (1−5)—tested wheat sample; (6−8)—tested barley samples; (K−—no template control.
Figure 2. Detection of BYDV coat protein (CP) region (641 bp) in plant samples by RT-PCR. Amplified products were analyzed in 1% TBE agarose gel. Lanes: (M)—100 bp DNA ladder (Novazym); (1−5)—tested wheat sample; (6−8)—tested barley samples; (K−—no template control.
Plants 12 03488 g002
Figure 3. Restriction profiles of BYDV species. RT-PCR products were digested by Hpa II endonuclease and separated on 2% TBE agarose gel. Lanes: (M)—100 bp DNA ladder (Novazym); (1–4)—tested BYDV samples.
Figure 3. Restriction profiles of BYDV species. RT-PCR products were digested by Hpa II endonuclease and separated on 2% TBE agarose gel. Lanes: (M)—100 bp DNA ladder (Novazym); (1–4)—tested BYDV samples.
Plants 12 03488 g003
Figure 4. Two-dimensional visualization of nucleotide sequence identity (a) or amino acid sequence identity (b) of 46 barley yellow dwarf virus—PAS (BYDV-PAS) isolates of CP gene. The matrices were performed using SDTv1.2.
Figure 4. Two-dimensional visualization of nucleotide sequence identity (a) or amino acid sequence identity (b) of 46 barley yellow dwarf virus—PAS (BYDV-PAS) isolates of CP gene. The matrices were performed using SDTv1.2.
Plants 12 03488 g004
Figure 5. Two-dimensional visualization of nucleotide sequence identity (a) or amino acid sequence identity (b) of 30 isolates of barley yellow dwarf virus—PAS (BYDV-PAS) of RdRp gene. The matrices were performed using SDTv1.2.
Figure 5. Two-dimensional visualization of nucleotide sequence identity (a) or amino acid sequence identity (b) of 30 isolates of barley yellow dwarf virus—PAS (BYDV-PAS) of RdRp gene. The matrices were performed using SDTv1.2.
Plants 12 03488 g005
Figure 6. Maximum likelihood tree based on 540 nt fragment of CP region of BYDV-PAS isolates. The nucleotide sequence of BYDV-GAV was used as an outgroup. The numbers of each major node indicate bootstrap values out of 1000 replicates (provided only when >50%). The phylogenetic tree was edited and visualized in the Evolview online platform. Information about the host and region of origin was placed on the tree and explained in the legend. Polish BYDV-PAS isolates are indicated (black triangles).
Figure 6. Maximum likelihood tree based on 540 nt fragment of CP region of BYDV-PAS isolates. The nucleotide sequence of BYDV-GAV was used as an outgroup. The numbers of each major node indicate bootstrap values out of 1000 replicates (provided only when >50%). The phylogenetic tree was edited and visualized in the Evolview online platform. Information about the host and region of origin was placed on the tree and explained in the legend. Polish BYDV-PAS isolates are indicated (black triangles).
Plants 12 03488 g006
Figure 7. Maximum likelihood tree based on 942 nt fragment of RdRp region of BYDV-PAS isolates. The nucleotide sequence of BYDV-GAV was used as an outgroup. The numbers of each major node indicate bootstrap values out of 1000 replicates (provided only when >50%). The phylogenetic tree was edited and visualized in the Evolview online platform. Information about the host and region of origin was placed on the tree and explained in the legend. Polish BYDV-PAS isolates are indicated (black triangles).
Figure 7. Maximum likelihood tree based on 942 nt fragment of RdRp region of BYDV-PAS isolates. The nucleotide sequence of BYDV-GAV was used as an outgroup. The numbers of each major node indicate bootstrap values out of 1000 replicates (provided only when >50%). The phylogenetic tree was edited and visualized in the Evolview online platform. Information about the host and region of origin was placed on the tree and explained in the legend. Polish BYDV-PAS isolates are indicated (black triangles).
Plants 12 03488 g007
Table 1. Description of virus isolates used in this study.
Table 1. Description of virus isolates used in this study.
Virus IsolateHostOriginAcc. No. of RNA [CP * and RdRP #]
BYDV-PAS-P1 1TriticalePoland, 2015KU893144 *; ON950062 #
BYDV-PAS-P2Triticum aestivumPoland, 2015KU893145 *; ON950063 #
BYDV-PAS-P3Hordeum vulgarePoland, 2015ON950056 *; ON950064 #
BYDV-PAS-P4Triticum aestivumPoland, 2015OM685192 *; ON950065 #
BYDV-PAS-P5Hordeum vulgarePoland, 2018ON950057 *; ON950066 #
BYDV-PAS-P6Hordeum vulgarePoland, 2018ON950058 *; ON950067 #
BYDV-PAS -IDA-P7Hordeum vulgarePoland, 2021OM685192 *; ON950065 #
BYDV-PAS-P8Hordeum vulgarePoland, 2021OM685192 *; ON950065 #
BYDV-PAS-P9Hordeum vulgarePoland, 2021OM685192 *; ON950065 #
BYDV-PAS-Br-P10Bromus sp.Poland, 2021ON109387 *; ON950068 #
BYDV-PAS-P11Hordeum vulgarePoland, 2021ON950059 *; ON950069 #
BYDV-PAS-P12Hordeum vulgarePoland, 2021OM685192 *; ON950070 #
BYDV-PAS-P13Hordeum vulgarePoland, 2021ON950060 *; ON950071 #
BYDV-PAS-P14Triticum aestivumPoland, 2021ON950061 *; ON950072 #
BYDV-PAS-Jogeva1 2Triticum aestivumEstonia, 2015MK012659
BYDV-PAS-Jogeva2Triticum aestivumEstonia, 2015MK012658
BYDV-PAS-Jogeva4Triticum aestivumEstonia, 2015MK012654
BYDV-PAS-MataperaTriticum aestivumEstonia, 2015MK012657
BYDV-PAS-VaimelaTriticum aestivumEstonia, 2014MK012655
BYDV-PAS-PuideTriticum aestivumEstonia, 2015MK012656
BYDV-PAS-Olustvere2-WTriticum aestivumEstonia, 2014MK012652
BYDV-PAS-Olustvere2-BHordeum vulgareEstonia, 2014MK012653
BYDV-PAS-Rannu1Triticum aestivumEstonia, 2014MK012651
BYDV-PAS-ImavereSecale cerealeEstonia, 2015MK012660
BYDV-PAS-PolvaTriticum aestivumEstonia, 2013MK012650
BYDV-PAS-26-1Hordeum vulgareGermany, 2015KY634888 *
BYDV-PAS-26-3Hordeum vulgareGermany, 2015KY634890 *
BYDV-PAS-26-4Hordeum vulgareGermany, 2015KY634891 *
BYDV-PAS-2Lolium multiflorumGermany, 2008KY634879 *
BYDV-PAS-131Triticum aestivumGermany, 2015KY634913 *
BYDV-PAS-138Festuca ovinaGermany, 2008KY634917 *
BYDV-PAS-114Hordeum vulgareGermany, 2015KY634907 *
BYDV-PAS-143-1Hordeum vulgareGermany, 2016KY634922 *
BYDV-PAS-142-3Hordeum vulgareGermany, 2016KY634921 *
BYDV-PAS-PecqHordeum vulgareBelgium, 2013OM046619 *
BYDV-PAS-TR60-S51Geranium dissectumTurkey, 2018MZ612011
BYDV-MA9505-Morocco, 1998AJ007920 *
BYDV-MA9511-Morocco, 1998AJ007922 *
BYDV-MA9516-Morocco, 1998AJ007926 *
BYDV-PAS-0109Hordeum vulgareUSA: Iowa, 2007EF521828
BYDV-PAS-OH1Triticum aestivumUSA: Ohio, 2016MN128938 *
BYDV-PAS-OH1ATriticum aestivumUSA: Ohio, 2016MK913614 *
BYDV-PAS-OH1BTriticum aestivumUSA: Ohio, 2016MK913615 *
BYDV-PAS-OH1DTriticum aestivumUSA: Ohio, 2016MK913617 *
BYDV-PAS-OH2Triticum aestivumUSA: Ohio, 2016MN128939
BYDV-PAS-OH3Triticum aestivumUSA: Ohio, 2016MN128940
BYDV-PAS-KS PAS-1Triticum aestivumUSA: Kansas, 2012KY593456
BYDV-PAS-KS PAS-2Triticum aestivumUSA: Kansas, 2012KY593457
BYDV-PAS-KS-SHKRTriticum aestivumUSA: Kansas, 2011KU170668
BYDV-PAS-WG13-USA, 2005DQ285676 *
BYDV-PAS-64-USA, 2005DQ285679 *
BYDV-PAS-WF12-USA, 2005DQ285678 *
BYDV-PAS-WS6603-USA, 2005DQ285680 *
BYDV-PAS-129-USA, 2005AF218798
BYDV-PAS37P5o03-2Avena sativaUSA, 2003DQ792506 *
BYDV-PAS-M40-2Pearl milletPakistan, 2011KR259156 *
BYDV-PAS-waw5-1Microlaena stipoidesNew ZealandEF408152 *
BYDV-PAS-waw5-9Microlaena stipoidesNew ZealandEF408153 *
BYDV-PAS-KJAvena sativaRepublic of Korea, 2020LC592173
BYDV-PAS-JEAvena sativaRepublic of Korea, 2020LC592174
BYDV-PAS-CNU-GNWTriticum aestivumRepublic of Korea, 2021LC746087 *
BYDV-GAV-ChinaAY220739
1 local BYDV isolates. 2 BYDV isolates retrieved from the GenBank database. * CP gene sequence accession number. # RdRp gene sequence accession number.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Trzmiel, K.; Hasiów-Jaroszewska, B. Molecular Characteristics of Barley Yellow Dwarf Virus—PAS—The Main Causal Agent of Barley Yellow Dwarf Disease in Poland. Plants 2023, 12, 3488. https://doi.org/10.3390/plants12193488

AMA Style

Trzmiel K, Hasiów-Jaroszewska B. Molecular Characteristics of Barley Yellow Dwarf Virus—PAS—The Main Causal Agent of Barley Yellow Dwarf Disease in Poland. Plants. 2023; 12(19):3488. https://doi.org/10.3390/plants12193488

Chicago/Turabian Style

Trzmiel, Katarzyna, and Beata Hasiów-Jaroszewska. 2023. "Molecular Characteristics of Barley Yellow Dwarf Virus—PAS—The Main Causal Agent of Barley Yellow Dwarf Disease in Poland" Plants 12, no. 19: 3488. https://doi.org/10.3390/plants12193488

APA Style

Trzmiel, K., & Hasiów-Jaroszewska, B. (2023). Molecular Characteristics of Barley Yellow Dwarf Virus—PAS—The Main Causal Agent of Barley Yellow Dwarf Disease in Poland. Plants, 12(19), 3488. https://doi.org/10.3390/plants12193488

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop