Exogenous Sodium Nitroprusside Alleviates Drought Stress in Lagenaria siceraria
Abstract
1. Introduction
2. Results
2.1. Soil Moisture Content
2.2. Changes in Plant Height and Fresh and Dry Weight of Leaves
2.3. Change in Photosynthetic Parameters
2.4. Fluorescence Parameter Changes
2.5. Changes in Soluble Sugar and Soluble Protein Content
2.6. Changes in Antioxidant Enzyme Activity (SOD, CAT, POD)
2.7. Proline and Malondialdehyde Content Changes
2.8. Antioxidant Enzyme-Related Gene Expression
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Method of Experimentation
4.3. Determination of Plant Height and Leaf Dry and Fresh Weight
4.4. Determination of Photosynthetic Parameters
4.5. Measurement of Fluorescence Parameters
4.6. Determination of Soluble Protein, SOD, CAT, POD, and MDA
4.7. Determination of Soluble Sugar and Free Proline (Pro) in L. siceraria Seedlings
4.8. Related Enzyme Genes Screening
4.9. Gene Expression Analysis
4.10. Data Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Haghaninia, M.; Javanmard, A.; Mahdavinia, G.R.; Shah, A.A.; Farooq, M. Co-application of Biofertilizer and Stress-Modulating Nanoparticles Modulates the Physiological, Biochemical, and Yield Responses of Camelina (Camelina sativa L.) Under Limited Water Supply. J. Soil Sci. Plant Nutr. 2023, 23, 6681–6695. [Google Scholar] [CrossRef]
- Esmaielzehi, A.; Mehraban, A.; Mobasser, H.; Ganjali, H.; Miri, K. The yield and physiological properties of quinoa (Chenopodium quinoa) genotypes affected by chelated nano-silicon and micronutrients under drought stress conditions. Sci. Hortic. 2024, 334, 113296. [Google Scholar] [CrossRef]
- Gervais, T.; Creelman, A.; Li, X.; Bizimungu, B.; De Koeyer, D.; Dahal, K. Potato Response to Drought Stress: Physiological and Growth Basis. Front. Plant Sci. 2021, 12, 698060. [Google Scholar] [CrossRef] [PubMed]
- Hossain, M.S.; Li, J.; Sikdar, A.; Hasanuzzaman, M.; Uzizerimana, F.; Muhammad, I.; Yuan, Y.; Zhang, C.; Wang, C.; Feng, B. Exogenous Melatonin Modulates the Physiological and Biochemical Mechanisms of Drought Tolerance in Tartary Buckwheat (Fagopyrum tataricum (L.) Gaertn). Molecules 2020, 25, 2828. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Shi, F.; Li, X.; Wu, H.; Zhao, S.; Wu, X.; Huang, Y. Divergent roles of deep soil water uptake in seasonal tree growth under natural drought events in North China. Agric. For. Meteorol. 2022, 324, 109102. [Google Scholar] [CrossRef]
- Khator, K.; Parihar, S.; Jasik, J.; Shekhawat, G.S. Nitric oxide in plants: An insight on redox activity and responses toward abiotic stress signaling. Plant Signal. Behav. 2024, 19, 2298053. [Google Scholar] [CrossRef] [PubMed]
- Saini, S.; Sharma, P.; Singh, P.; Kumar, V.; Yadav, P.; Sharma, A. Nitric oxide: An emerging warrior of plant physiology under abiotic stress. Nitric Oxide 2023, 140–141, 58–76. [Google Scholar] [CrossRef] [PubMed]
- Kotapat, V.K.; Palaka, K.B.; Ampasala, R.D. Alleviation of nickel toxicity in finger millet (Eleusine coracana L.) germinating seedlings by exogenous application of salicylic acid and nitric oxide. Crop J. 2016, 5, 240–250. [Google Scholar] [CrossRef]
- Nevzat, E.; Aykut, K.; Okkeş, A. Nitric oxide alleviates mercury toxicity by changing physiological and biochemical pathways in maize (Zea mays L.) seedlings. Acta Bot. Croat. 2024, 83, 60–68. [Google Scholar] [CrossRef]
- Ferreira, L.M.; Henschel, J.M.; de Almeida Mendes, J.J.V.; da Silva Gomes, D.; dos Santos, S.K.; Lopes, A.S.; Araujo, D.J.; Batista, D.S. Sodium Nitroprusside Alleviates Moderate Drought Stress in Beet (Beta vulgaris L. subsp. vulgaris) by Modulating Its Photosynthetic Capacity. J. Plant Growth Regul. 2023, 43, 755–769. [Google Scholar] [CrossRef]
- Farouk, S.; Al-Ghamdi, A.A.M. Sodium nitroprusside application enhances drought tolerance in marjoram herb by promoting chlorophyll biosynthesis and enhancing osmotic adjustment capacity. Arab. J. Geosci. 2021, 14, 430. [Google Scholar] [CrossRef]
- Farouk, S.; Al-Huqail, A.A. Sodium nitroprusside application regulates antioxidant capacity, improves phytopharmaceutical production and essential oil yield of marjoram herb under drought. Ind. Crops Prod. 2020, 158, 113034. [Google Scholar] [CrossRef]
- Li, Z.; Yong, B.; Cheng, B.; Wu, X.; Zhang, Y.; Zhang, X.; Peng, Y. Nitric oxide, γ-aminobutyric acid, and mannose pretreatment influence metabolic profiles in white clover under water stress. J. Integr. Plant Biol. 2019, 61, 1255–1273. [Google Scholar] [CrossRef] [PubMed]
- Boogar, R.A.; Salehi, H.; Jowkar, A. Exogenous nitric oxide alleviates oxidative damage in turfgrasses under drought stress. S. Afr. J. Bot. 2014, 92, 78–82. [Google Scholar] [CrossRef]
- Sundararajan, S.; Shanmugam, R.; Rajendran, V.; Sivakumar, H.P.; Ramalingam, S. Sodium Nitroprusside and Putrescine Mitigate PEG-Induced Drought Stress in Seedlings of Solanum lycopersicum. J. Soil Sci. Plant Nutr. 2021, 22, 1019–1032. [Google Scholar] [CrossRef]
- Majeed, S.; Nawaz, F.; Naeem, M.; Ashraf, M.Y.; Ejaz, S.; Ahmad, K.F.; Tauseef, S.; Farid, G.; Khalid, I.; Mehmood, K. Nitric oxide regulates water status and associated enzymatic pathways to inhibit nutrients imbalance in maize (Zea mays L.) under drought stress. Plant Physiol. Biochem. 2020, 155, 147–160. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Li, X.; Li, X.; Wei, Z.; Han, M.; Zhang, L.; Li, B. Exogenous nitric oxide protects against drought-induced oxidativestress in Malus rootstocks. Turk. J. Bot. 2016, 40, 17–27. [Google Scholar] [CrossRef]
- Kaya, D.M.; Okçu, G.; Atak, M.; Çıkılı, Y.; Kolsarıcı, Ö. Seed treatments to overcome salt and drought stress during germination in sunflower (Helianthus annuus L.). Eur. J. Agron. 2005, 24, 291–295. [Google Scholar] [CrossRef]
- Anmol, G.; Ambreen, B.; Smita, R.; Richa, M.; Mausam, S.; Swati, S.; Neelam, P. Mechanistic insights of plant-microbe interaction towards drought and salinity stress in plants for enhancing the agriculture productivity. Plant Stress 2022, 4, 100073. [Google Scholar] [CrossRef]
- He, Y.; Wu, J.; Lv, B.; Li, J.; Gao, Z.; Xu, W.; Baluška, F.; Shi, W.; Shaw, P.C.; Zhang, J. Involvement of 14-3-3 protein GRF9 in root growth and response under polyethylene glycol-induced water stress. J. Exp. Bot. 2015, 66, 2271–2281. [Google Scholar] [CrossRef]
- Mashilo, J.; Odindo, A.; Shimelis, H.; Musenge, P.A.; Tesfay, S.Z.; Magwaza, L.S. Photosynthetic efficiency of bottle gourd [Lagenaria siceraria (Molina) Standl.] under drought stress. Ind. J. Plant Physiol. 2018, 23, 293–304. [Google Scholar] [CrossRef]
- Gelaw, A.T.; Mishra, S.N. Molecular priming with H2O2 and proline triggers antioxidant enzyme signals in maize seedlings during drought stress. Biochim. Biophys. Acta—Gen. Subj. 2024, 1868, 130633. [Google Scholar] [CrossRef] [PubMed]
- Bagheenayat, N.; Barzin, G.; Jafarinia, M.; Pishkar, L.; Entezari, M. The Use of the Jip-Test to Investigate the Role of Nitric Oxide in Alleviation Drought Damage to Photosystem II in Salviaofficinalis L. Biol. Bull. Russ. Acad. Sci. 2023, 49, S83–S91. [Google Scholar] [CrossRef]
- Seleiman, M.F.; Al-Suhaibani, N.; Ali, N.; Akmal, M.; Alotaibi, M.; Refay, Y.; Dindaroglu, T.; Abdul-Wajid, H.H.; Battaglia, M.L. Drought Stress Impacts on Plants and Different Approaches to Alleviate Its Adverse Effects. Plants 2021, 10, 259. [Google Scholar] [CrossRef] [PubMed]
- Monti, A.; Barbanti, L.; Venturi, G. Photosynthesis on individual leaves of sugar beet (Beta vulgaris) during the ontogeny at variable water regimes. Ann. Appl. Biol. 2007, 151, 155–165. [Google Scholar] [CrossRef]
- Liu, H.; Chen, K.; Yang, L.; Han, X.; Wu, M.; Shen, Z. Physiological and Transcriptomic Analyses Reveal the Response of Medicinal Plant Bletilla striata (Thunb. ex A. Murray) Rchb. f. via Regulating Genes Involved in the ABA Signaling Pathway, Photosynthesis, and ROS Scavenging under Drought Stress. Horticulturae 2023, 9, 307. [Google Scholar] [CrossRef]
- Zhao, P.; Chen, X.; Xue, X.; Wang, Y.; Wang, Y.; Li, H.; Xue, R.; Li, Y. Improvement of polyamine synthesis maintains photosynthetic function in wheat during drought stress and rewatering at the grain filling stage. Plant Growth Regul. 2023, 102, 497–513. [Google Scholar] [CrossRef]
- Kaya, C.; Uğurlar, F.; Seth, C.S. Sodium nitroprusside modulates oxidative and nitrosative processes in Lycopersicum esculentum L. under drought stress. Plant Cell Rep. 2024, 43, 152. [Google Scholar] [CrossRef]
- Maryam, R.; Hassan, E.; Vahid, N. Metabolic and Physiological Changes Induced by Nitric Oxide and Its Impact on Drought Tolerance in Soybean. J. Plant Growth Regul. 2022, 42, 1905–1918. [Google Scholar] [CrossRef]
- Felicitas, G.; Jörg, D.; Frank, G. Nitric oxide, antioxidants and prooxidants in plant defence responses. Front. Plant Sci. 2013, 4, 419. [Google Scholar] [CrossRef]
- Kaur, G.; Asthir, B. Proline: A key player in plant abiotic stress tolerance. Biol. Plant. 2015, 59, 609–619. [Google Scholar] [CrossRef]
- Aghaleh, M.; Niknam, V.; Ebrahimzadeh, H.; Razavi, K. Effect of salt stress on physiological and antioxidative responses in two species of Salicornia (S. persica and S. europaea). Acta Physiol. Plant 2011, 33, 1261–1270. [Google Scholar] [CrossRef]
- Dong, Y.; Jinc, S.S.; Liu, S.; Xu, L.; Kong, J. Effects of exogenous nitric oxide on growth of cotton seedlings under NaCl stress. J. Soil Sci. Plant Nutr. 2014, 14, 1–13. [Google Scholar] [CrossRef]
- Ahmad, B.; Mukarram, M.; Choudhary, S.; Petrík, P.; Ahmad, D.T.; Masroor, A.K.M. Adaptive responses of nitric oxide (NO) and its intricate dialogue with phytohormones during salinity stress. Plant Physiol. Biochem. 2024, 208, 108504. [Google Scholar] [CrossRef]
- Liu, F.; Yang, J.; Mu, H.; Li, X.; Zhang, X.; Wen, Y.; Zhang, X. Effects of Brassinolide on Growth, Photosynthetic Rate and Antioxidant Enzyme Activity of Ornamental Gourd under Salt Stress. Russ. J. Plant Physiol. 2023, 70, 137. [Google Scholar] [CrossRef]
Light Intensity lx | Net Photosynthetic Rate μmol/m2/s | Stomatal Conductance mol/m2/s | Transpiration Rate mmol/m2/s | Intercellular CO2 Concentration μmol/mol |
---|---|---|---|---|
0 | −2.08 ± 0.12 e | 0.04 ± 0.01 c | 0.93 ± 0.17 e | 547.67 ± 20.78 a |
50 | 0.37 ± 0.50 de | 0.05 ± 0.01 c | 1.19 ± 0.22 e | 411.50 ± 17.29 b |
100 | 2.59 ± 0.27 d | 0.07 ± 0.01 bc | 1.56 ± 0.25 de | 362.50 ± 18.54 c |
200 | 7.33 ± 0.19 c | 0.09 ± 0.01 ab | 2.01 ± 0.27 bcd | 282.17 ± 19.98 d |
400 | 12.77 ± 1.08 ab | 0.11 ± 0.02 a | 2.40 ± 0.28 abc | 218.50 ± 12.84 ef |
600 | 13.37 ± 1.88 ab | 0.12 ± 0.01 a | 2.64 ± 0.28 abc | 238.50 ± 9.56 de |
800 | 16.16 ± 1.06 a | 0.12 ± 0.02 a | 2.77 ± 0.27 ab | 188.50 ± 17.73 fg |
1000 | 16.56 ± 1.39 a | 0.12 ± 0.01 a | 2.80 ± 0.26 a | 179.17 ± 8.16 fg |
1200 | 15.43 ± 1.55 a | 0.12 ± 0.01 a | 2.79 ± 0.24 a | 190.67 ± 9.49 fg |
1400 | 14.83 ± 1.58 a | 0.11 ± 0.01 ab | 2.68 ± 0.21 abc | 188.33 ± 8.74 fg |
1600 | 12.99 ± 1.20 ab | 0.09 ± 0.01 ab | 2.43 ± 0.20 abc | 180.33 ± 5.75 fg |
1800 | 10.44 ± 1.41 bc | 0.07 ± 0.01 bc | 1.94 ± 0.20 cd | 181.50 ± 12.59 fg |
2000 | 7.08 ± 1.90 c | 0.04 ± 0.01 c | 1.23 ± 0.21 e | 164.67 ± 26.16 g |
Gene Name | Primer Sequences | |
---|---|---|
LsSOD | Left | AGAGGAATTGGTGGCAGTCG |
Right | TCCGTCGACCGTTGACATTT | |
LsCAT | Left | ATGGTCCGCACACATTGGAT |
Right | ACATCCCTCCCTACTGGCAT | |
LsPOD | Left | TCATGTGCCGACATCCTAGC |
Right | AAGAAAGTGCCTTCTCGCGA | |
LsMDA | Left | GCTATTTGGTTTTTCATTGACGGC |
Right | AAATCTTAACTTAAGAGGAAGGTGCG | |
LsH3 | Left | CAAACTGCCCGTAAGTCCAC |
Right | GGCTTCTTCACTCCTCCTGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, X.; Qi, S.; Liu, S.; Mu, H.; Jiang, Y. Exogenous Sodium Nitroprusside Alleviates Drought Stress in Lagenaria siceraria. Plants 2024, 13, 1972. https://doi.org/10.3390/plants13141972
Zhang X, Qi S, Liu S, Mu H, Jiang Y. Exogenous Sodium Nitroprusside Alleviates Drought Stress in Lagenaria siceraria. Plants. 2024; 13(14):1972. https://doi.org/10.3390/plants13141972
Chicago/Turabian StyleZhang, Xiaodi, Saike Qi, Shan Liu, Hongmei Mu, and Yiyue Jiang. 2024. "Exogenous Sodium Nitroprusside Alleviates Drought Stress in Lagenaria siceraria" Plants 13, no. 14: 1972. https://doi.org/10.3390/plants13141972
APA StyleZhang, X., Qi, S., Liu, S., Mu, H., & Jiang, Y. (2024). Exogenous Sodium Nitroprusside Alleviates Drought Stress in Lagenaria siceraria. Plants, 13(14), 1972. https://doi.org/10.3390/plants13141972