The Complex Genetic Legacy of Hybridization and Introgression between the Rare Ocotea loxensis van der Werff and the Widespread O. infrafoveolata van der Werff (Lauraceae)
Abstract
1. Introduction
2. Results
2.1. Genetic Diversity of Loci
2.2. Genetic Diversity and Differentiation in O. loxensis and O. infrafoveolata
2.3. Genetic Structure of O. loxensis and O. infrafoveolata Populations
2.4. Genetic Composition of Populations
3. Discussion
4. Materials and Methods
4.1. Species and Population Sampling
4.2. DNA Extraction and nSSR Development
4.3. Genetic Diversity and Differentiation between O. loxensis and O. infrafoveolata
4.4. Genetic Structure of Populations
4.5. Genetic Composition of Hybrids
5. Conclusions and Prospects
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Ellstrand, N.C.; Schierenbeck, K.A. Hybridization as a stimulus for the evolution of invasiveness in plants? Proc. Natl. Acad. Sci. USA 2006, 148, 35–46. [Google Scholar] [CrossRef] [Scilit]
- Rhymer, J.M.; Simberloff, D. Extinction by hybridization and introgression. Annu. Rev. Ecol. Syst. 1996, 27, 83–109. [Google Scholar] [CrossRef] [Scilit]
- Muhlfeld, C.C.; Kalinowski, S.T.; McMahon, T.E.; Taper, M.L.; Painter, S.; Leary, R.F.; Allendorf, F.W. Hybridization rapidly reduces fitness of a native trout in the wild. Biol. Lett. 2009, 5, 328–331. [Google Scholar] [CrossRef] [Scilit]
- Arnold, M.L.; Ballerini, E.S.; Brothers, A.N. Hybrid fitness, adaptation and evolutionary diversification: Lessons learned from Louisiana Irises. Heredity 2012, 108, 159–166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carney, S.E.; Gardner, K.A.; Rieseberg, L.H. Evolutionary changes over the fifty-year history of a hybrid population of sunflowers (Helianthus). Evolution 2000, 54, 462–474. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adavoudi, R.; Pilot, M. Consequences of hybridization in mammals: A systematic review. Genes 2022, 13, 50. [Google Scholar] [CrossRef] [Scilit]
- Tomasello, S.; Oberprieler, C. Reticulate Evolution in the Western Mediterranean Mountain Ranges: The Case of the Leucanthemopsis Polyploid Complex. Front. Plant Sci. 2022, 13, 842842. [Google Scholar] [CrossRef] [Scilit]
- López de Heredia, U.; Mora-Márquez, F.; Goicoechea, P.G.; Guillardín-Calvo, L.; Simeone, M.C.; Soto, A. ddRAD Sequencing-Based Identification of Genomic Boundaries and Permeability in Quercus ilex and Q. suber Hybrids. Front. Plant Sci. 2020, 11, 1330. [Google Scholar] [CrossRef] [Scilit]
- Pinheiro, F.; de Melo e Gouveia, T.M.Z.; Cozzolino, S.; Cafasso, D.; Cardoso-Gustavson, P.; Suzuki, R.M.; Palma-Silva, C. Strong but permeable barriers to gene exchange between sister species of Epidendrum. Am. J. Bot. 2016, 103, 1472–1482. [Google Scholar] [CrossRef] [Scilit]
- Isabel, N.; Holliday, J.A.; Aitken, S.N. Forest genomics: Advancing climate adaptation, forest health, productivity, and conservation. Evol. Appl. 2020, 13, 3–10. [Google Scholar] [CrossRef] [Scilit]
- Draper, D.; Laguna, E.; Marques, I. Demystifying Negative Connotations of Hybridization for Less Biased Conservation Policies. Front. Ecol. Evol. 2021, 9, 268. [Google Scholar] [CrossRef] [Scilit]
- Chan, W.Y.; Hoffmann, A.A.; van Oppen, M.J.H. Hybridization as a conservation management tool. Conserv. Lett. 2019, 12, e12652. [Google Scholar] [CrossRef] [Scilit]
- Cozzolino, S.; Nardella, A.M.; Impagliazzo, S.; Widmer, A.; Lexer, C. Hybridization and conservation of Mediterranean orchids: Should we protect the orchid hybrids or the orchid hybrid zones? Biol. Conserv. 2006, 129, 14–23. [Google Scholar] [CrossRef] [Scilit]
- Mallet, J. Hybrid speciation. Nature 2007, 446, 279–283. [Google Scholar] [CrossRef] [Scilit]
- Marques, I.; Loureiro, J.; Draper, D.; Castro, M.; Castro, S. How much do we know about the frequency of hybridisation and polyploidy in the Mediterranean region? Plant Biol. 2018, 20, 21–37. [Google Scholar] [CrossRef] [Scilit]
- Abbott, R.J.; Barton, N.H.; Good, J.M. Genomics of hybridization and its evolutionary consequences. Mol. Ecol. 2016, 25, 2325–2332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marques, I.; Feliner, G.N.; Draper Munt, D.; Martins-Loução, M.A.; Aguilar, J.F. Unraveling cryptic reticulate relationships and the origin of orphan hybrid disjunct populations in Narcissus. Evolution 2010, 64, 2353–2368. [Google Scholar] [PubMed]
- Nieto Feliner, G.; Álvarez, I.; Fuertes-Aguilar, J.; Heuertz, M.; Marques, I.; Moharrek, F.; Piñeiro, R.; Riina, R.; Rosselló, J.A.; Soltis, P.S.; et al. Is homoploid hybrid speciation that rare? An empiricist’s view. Heredity 2017, 118, 513–516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beirinckx, L.; Vanschoenwinkel, B.; Triest, L. Hidden Hybridization and Habitat Differentiation in a Mediterranean Macrophyte, the Euryhaline Genus Ruppia. Front. Plant Sci. 2020, 11, 516856. [Google Scholar] [CrossRef] [Scilit]
- Payseur, B.A.; Rieseberg, L.H. A genomic perspective on hybridization and speciation. Mol. Ecol. 2016, 25, 2337–2360. [Google Scholar] [CrossRef] [Scilit]
- Ehrendorfer, F. Evolutionary patterns and strategies in seed plants. Taxon 1970, 19, 185–195. [Google Scholar] [CrossRef] [Scilit]
- Gentry, A.H. Neotropical floristic diversity: Phytogeographical connections between Central and South America, Pleistocene climatic fluctuations, or an accident of the Andean orogeny? Ann. Mo. Bot. Gard. 1982, 69, 557–593. [Google Scholar] [CrossRef] [Scilit]
- Pinheiro, F.; De Barros, F.; Palma-Silva, C.; Meyer, D.; Fay, M.F.; Suzuki, R.M.; Lexer, C.; Cozzolino, S. Hybridization and introgression across different ploidy levels in the Neotropical orchids Epidendrum fulgens and E. puniceoluteum (Orchidaceae). Mol. Ecol. 2010, 19, 3981–3994. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Antonelli, A. The rise and fall of Neotropical biodiversity. Bot. J. Linn. Soc. 2022, 199, 8–24. [Google Scholar] [CrossRef] [Scilit]
- Rull, V. Neotropical biodiversity: Timing and potential drivers. Trends Ecol. Evol. 2011, 26, 508–513. [Google Scholar] [CrossRef] [Scilit]
- Antonelli, A.; Sanmartín, I. Why are there so many plant species in the Neotropics? Taxon 2011, 60, 403–414. [Google Scholar] [CrossRef] [Scilit]
- Schley, R.J.; Twyford, A.D.; Pennington, R.T. Hybridization: A “double-edged sword” for Neotropical plant diversity. Bot. J. Linn. Soc. 2022, 199, 331–356. [Google Scholar] [CrossRef] [Scilit]
- Dick, C.W.; Kress, W.J. Dissecting tropical plant diversity with forest plots and a molecular toolkit. Bioscience 2009, 59, 745–755. [Google Scholar] [CrossRef] [Scilit]
- Pouchon, C.; Fernández, A.; Nassar, J.M.; Boyer, F.; Aubert, S.; Lavergne, S.; Mavárez, J. Phylogenomic analysis of the explosive adaptive radiation of the Espeletia complex (Asteraceae) in the tropical Andes. Syst. Biol. 2018, 67, 1041–1060. [Google Scholar] [CrossRef] [Scilit]
- Vargas, O.M.; Ortiz, E.M.; Simpson, B.B. Conflicting phylogenomic signals reveal a pattern of reticulate evolution in a recent high-Andean diversification (Asteraceae: Astereae: Diplostephium). New Phytol. 2017, 214, 1736–1750. [Google Scholar] [CrossRef] [Scilit]
- Schmidt-Lebuhn, A.N.; Kessler, M.; Kumar, M. Promiscuity in the Andes: Species relationships in Polylepis (Rosaceae, Sanguisorbeae) based on AFLP and morphology. Syst. Bot. 2006, 31, 547–559. [Google Scholar] [CrossRef] [Scilit]
- Morales-Briones, D.F.; Liston, A.; Tank, D.C. Phylogenomic analyses reveal a deep history of hybridization and polyploidy in the Neotropical genus Lachemilla (Rosaceae). New Phytol. 2018, 218, 1668–1684. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Loiseau, O.; Mota Machado, T.; Paris, M.; Koubínová, D.; Dexter, K.G.; Versieux, L.M.; Lexer, C.; Salamin, N. Genome Skimming Reveals Widespread Hybridization in a Neotropical Flowering Plant Radiation. Front. Ecol. Evol. 2021, 9, 322. [Google Scholar] [CrossRef] [Scilit]
- Kay, K.M.; Schemske, D.W. Natural selection reinforces speciation in a radiation of neotropical rainforest plants. Evolution 2008, 62, 2628–2642. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mota, M.R.; Pinheiro, F.; Leal, B.S.S.; Wendt, T.; Palma-Silva, C. The role of hybridization and introgression in maintaining species integrity and cohesion in naturally isolated inselberg bromeliad populations. Plant Biol. 2019, 21, 122–132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marques, I.; Draper, D.; Riofrío, L.; Naranjo, C. Multiple hybridization events, polyploidy and low postmating isolation entangle the evolution of neotropical species of Epidendrum (Orchidaceae). BMC Evol. Biol. 2014, 14, 20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vega, Y.; Marques, I.; Castro, S.; Loureiro, J. Outcomes of extensive hybridization and introgression in Epidendrum (orchidaceae): Can we rely on species boundaries? PLoS ONE 2013, 8, 80662. [Google Scholar] [CrossRef] [Scilit]
- Mesgarana, M.B.; Lewisb, M.A.; Adesc, P.K.; Donohued, K.; Ohadia, S.; Lia, C.; Cousensa, R.D. Hybridization can facilitate species invasions, even without enhancing local adaptation. Proc. Natl. Acad. Sci. USA 2016, 113, 10210–10214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Der Werff, H. Studies in andean Ocotea (Lauraceae) II. Species with hermaphrodite flowers and densely pubescent lower leaf surfaces, occurring above 1000 meters in altitude. Novon 2013, 22, 336–370. [Google Scholar] [CrossRef] [Scilit]
- Marques, I.; Draper, D.; Riofrío, L.; Naranjo, C. Early Signs of the Effects of Forest Fragmentation on the Genetic Diversity and Structure of the Threatened Ecuadorian Tree Ocotea rotundata (Lauraceae). Forests 2022, 13, 1940. [Google Scholar] [CrossRef] [Scilit]
- Sobierajska, K.; Wachowiak, W.; Zaborowska, J.; Łabiszak, B.; Wójkiewicz, B.; Sękiewicz, M.; Jasińska, A.K.; Sękiewicz, K.; Boratyńska, K.; Marcysiak, K.; et al. Genetic Consequences of Hybridization in Relict Isolated Trees Pinus sylvestris and the Pinus mugo Complex. Forests 2020, 11, 1086. [Google Scholar] [CrossRef] [Scilit]
- Boyd, J.N.; Anderson, J.T.; Brzyski, J.; Baskauf, C.; Cruse-Sanders, J. Eco-evolutionary causes and consequences of rarity in plants: A meta-analysis. New Phytol. 2022, 235, 1272–1286. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Broadhurst, L.; Coates, D. Genetic diversity within and divergence between rare and geographically widespread taxa of the Acacia acuminata Benth. (Mimosaceae) complex. Heredity 2002, 88, 250–257. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ellstrand, N.C.; Elam, D.R. Population genetic consequences of small population size: Implications for plant conservation. Annu. Rev. Ecol. Syst. 1993, 24, 217–242. [Google Scholar] [CrossRef]
- Swatdipong, A.; Primmer, C.R.; Vasemägi, A. Historical and recent genetic bottlenecks in European grayling, Thymallus thymallus. Conserv. Genet. 2010, 11, 279–292. [Google Scholar] [CrossRef] [Scilit]
- Martins, E.M.; Lamont, R.W.; Martinelli, G.; Lira-Medeiros, C.F.; Quinet, A.; Shapcott, A. Genetic diversity and population genetic structure in three threatened Ocotea species (Lauraceae) from Brazil’s Atlantic Rainforest and implications for their conservation. Conserv. Genet. 2015, 16, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Geng, Q.; Sun, L.; Zhang, P.; Wang, Z.; Qiu, Y.; Liu, H.; Lian, C. Understanding population structure and historical demography of Litsea auriculata (Lauraceae), an endangered species in east China. Sci. Rep. 2017, 7, 17343. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cui, B.; Vu, D.D.; Vu, D.G.; Bui, T.T.X.; Rahman, S.U.; Pham, M.P.; Nguyen, M.T.; Nguyen, V.S.; Shah, S.N.M.; Tran, V.H. Genetic diversity and population structure of Cinnamomum balansae Lecomte inferred by microsatellites. Open Life Sci. 2022, 17, 323–332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rieseberg, L.H.; Archer, M.A.; Wayne, R.K. Transgressive segregation, adaptation and speciation. Heredity 1999, 83, 363–372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abbott, R.J. Plant speciation across environmental gradients and the occurrence and nature of hybrid zones. J. Syst. Evol. 2017, 55, 238–258. [Google Scholar] [CrossRef] [Scilit]
- Baiakhmetov, E.; Ryzhakova, D.; Gudkova, P.D.; Nobis, M. Evidence for extensive hybridisation and past introgression events in feather grasses using genome-wide SNP genotyping. BMC Plant Biol. 2021, 21, 505. [Google Scholar] [CrossRef] [Scilit]
- Kenzo, T.; Kamiya, K.; Ngo, K.M.; Faizu, N.; Lum, S.K.Y.; Igarashi, S.; Norichika, Y.; Ichie, T. Overlapping flowering periods among Shorea species and high growth performance of hybrid seedlings promote hybridization and introgression in a tropical rainforest of Singapore. For. Ecol. Manag. 2019, 435, 38–44. [Google Scholar] [CrossRef] [Scilit]
- Dell’Olivo, A.; Hoballah, M.E.; Gübitz, T.; Kuhlemeier, C. Isolation barriers between petunia axillaris and petunia integrifolia (solanaceae). Evolution 2011, 65, 1979–1991. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marques, I.; Rosselló-Graell, A.; Draper, D.; Iriondo, J.M. Pollination patterns limit hybridization between two sympatric species of Narcissus (Amaryllidaceae). Am. J. Bot. 2007, 94, 1352–1359. [Google Scholar] [CrossRef] [Scilit]
- Danieli-Silva, A.; Varassin, I. Breeding system and thrips (Thysanoptera) pollination in the endangered tree Ocotea porosa (Lauraceae): Implications for conservation. Plant Species Biol. 2013, 28, 31–40. [Google Scholar] [CrossRef] [Scilit]
- Christe, C.; Stölting, K.N.; Bresadola, L.; Fussi, B.; Heinze, B.; Wegmann, D.; Lexer, C. Selection against recombinant hybrids maintains reproductive isolation in hybridizing Populus species despite F1 fertility and recurrent gene flow. Mol. Ecol. 2016, 25, 2482–2498. [Google Scholar] [CrossRef] [Scilit]
- Zalapa, J.E.; Brunet, J.; Guries, R.P. The extent of hybridization and its impact on the genetic diversity and population structure of an invasive tree, Ulmus pumila (Ulmaceae). Evol. Appl. 2010, 3, 157. [Google Scholar] [CrossRef] [Scilit]
- Jiang, D.; Feng, J.; Dong, M.; Wu, G.; Mao, K.; Liu, J. Genetic origin and composition of a natural hybrid poplar Populus × jrtyschensis from two distantly related species. BMC Plant Biol. 2016, 16, 89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, Y.; Harris, A.J.; Li, H.; Gao, X. Hybrid Speciation and Introgression Both Underlie the Genetic Structures and Evolutionary Relationships of Three Morphologically Distinct Species of Lilium (Liliaceae) Forming a Hybrid Zone Along an Elevational Gradient. Front. Plant Sci. 2020, 11, 576407. [Google Scholar] [CrossRef] [Scilit]
- Hauser, T.P.; Jørgensen, R.B.; østergård, H. Fitness of backcross and F2 hybrids between weedy Brassica rapa and oilseed rape (B. napus). Heredity 1998, 81, 436–443. [Google Scholar] [CrossRef]
- Wang, H.; Mcarthur, E.D.; Sanderson, S.C.; Graham, J.H.; Freeman, D.C. Narrow hybrid zone between two subspecies of big sagebrush (Artemisia tridentata: Asteraceae). IV. Reciprocal transplant experiments. Evolution 1997, 51, 95–102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kulmuni, J.; Wiley, B.; Otto, S.P. On the fast track: Hybrids adapt more rapidly than parental populations in a novel environment. Evol. Lett. 2024, 8, 128–136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, W.; Declerck, S.A.J. Intrinsic postzygotic barriers constrain cross-fertilisation between two hybridising sibling rotifer species of the Brachionus calyciflorus species complex. Freshw. Biol. 2022, 67, 240–249. [Google Scholar] [CrossRef] [Scilit]
- Marques, I.; Nieto Feliner, G.; Martins-Loução, M.A.; Fuertes Aguilar, J. Fitness in Narcissus hybrids: Low fertility is overcome by early hybrid vigour, absence of exogenous selection and high bulb propagation. J. Ecol. 2011, 99, 1508–1519. [Google Scholar] [CrossRef] [Scilit]
- Silva-Pereira, V.; De Camargo Smidt, E.; Leite Borba, E. Isolation mechanisms between two sympatric Sophronitis (Orchidaceae) species endemic to Northeastern Brazil. Plant Syst. Evol. 2007, 269, 171–182. [Google Scholar] [CrossRef] [Scilit]
- Johnson, M.A.; Price, D.K.; Price, J.P.; Stacy, E.A. Postzygotic barriers isolate sympatric species of Cyrtandra (Gesneriaceae) in Hawaiian montane forest understories. Am. J. Bot. 2015, 102, 1870–1882. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Broyles, S.B. Hybrid bridges to gene flow: A case study in milkweeds (Asclepias). Evolution 2002, 56, 1943–1953. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jacquemyn, H.; Brys, R.; Honnay, O.; Roldán-Ruiz, I. Asymmetric gene introgression in two closely related Orchis species: Evidence from morphometric and genetic analyses. BMC Evol. Biol. 2012, 12, 178. [Google Scholar] [CrossRef] [Scilit]
- Milne, R.I.; Terzioglu, S.; Abbott, R.J. A hybrid zone dominated by fertile F1s: Maintenance of species barriers in Rhododendron. Mol. Ecol. 2003, 12, 2719–2729. [Google Scholar] [CrossRef] [Scilit]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3-new capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [Scilit]
- Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar] [CrossRef] [Scilit]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinform. Appl. 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rice, W.R. Analyzing Tables of Statistical Tests. Evolution 1989, 43, 223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Excoffier, L.; Lischer, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of Population Structure Using Multilocus Genotype Data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Earl, D.A.; vonHoldt, B.M. STRUCTURE HARVESTER: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour. 2012, 4, 359–361. [Google Scholar] [CrossRef] [Scilit]
- Anderson, E.C.; Thompson, E.A. A model-based method for identifying species hybrids using multilocus genetic data. Genetics 2002, 160, 1217–1229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burgarella, C.; Lorenzo, Z.; Jabbour-Zahab, R.; Lumaret, R.; Guichoux, E.; Petit, R.J.; Soto, Á.; Gil, L. Detection of hybrids in nature: Application to oaks (Quercus suber and Q. ilex). Heredity 2009, 102, 442–452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jakobsson, M.; Rosenberg, N.A. CLUMPP: A cluster matching and permutation program for dealing with label switching and multimodality in analysis of population structure. Bioinformatics 2007, 23, 1801–1806. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rosenberg, N.A. DISTRUCT: A program for the graphical display of population structure. Mol. Ecol. Notes 2004, 4, 137–138. [Google Scholar] [CrossRef] [Scilit]
- Nielsen, R.; Wakeley, J. Distinguishing migration from isolation: A Markov chain Monte Carlo approach. Genetics 2001, 158, 885. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Petit, R.J.; Hampe, A. Some evolutionary consequences of being a tree. Annu. Rev. Ecol. Evol. Syst. 2006, 37, 187–214. [Google Scholar] [CrossRef] [Scilit]




| Locus | Primers (5′-3′) | Ta (°C) | Repeat Motif | Size Range (bp) | Accession Number | Na | Ne | Ho | He | PIC |
|---|---|---|---|---|---|---|---|---|---|---|
| Orot8 | F: GTCGGAAACTCTACCAAAGTGA | 58 | (TC)8 | 131–140 | OP428739 * | 3.154 | 2.635 | 0.391 | 0.425 | 0.782 |
| R: CCATCCCCGTAGAGTCTCG | ||||||||||
| Orot21 | F: CGGGACTATCAGAAGGTACGT | 59 | (GT)22 | 180–185 | OP428742 * | 1.769 | 1.508 | 0.385 | 0.218 | 0.873 |
| R: TGGGTAAAAGTCTGCTGATCCT | ||||||||||
| Orot22 | F: TCCTCCTACTCCTATCTACGGA | 50 | (CT)13 | 148–155 | OP428743 * | 2.923 | 2.162 | 0.490 | 0.436 | 0.784 |
| R: ATCGTCTCTGCTATCCCTGC | ||||||||||
| Olox1 | F: TGAGGAGTAGGGAATGTCGG | 58 | (CTC)4 | 192–198 | PP791920 | 2.538 | 2.022 | 0.884 | 0.492 | 0.905 |
| R: GGTACCTCCCGTAAAGTCGA | ||||||||||
| Olox3 | F: GTGGAGGTCTGCTACGCG | 60 | (TA)10 | 183–186 | PP791921 | 2.462 | 1.201 | 0.065 | 0.155 | 0.899 |
| R: AAGTCCCCATAGCGATCCAG | ||||||||||
| Olox4 | F: GCTGCGAGGAGGGATGATC | 60 | (TTC)8 | 179–183 | PP791922 | 3.000 | 2.085 | 0.326 | 0.405 | 0.803 |
| R: CCCGTAGTAGTAGAGTCCCG | ||||||||||
| Olox8 | F: GGTATGAGCGCCCCATCTAG | 59 | (TATC)6 | 173–177 | PP791923 | 1.923 | 1.580 | 0.186 | 0.254 | 0.789 |
| R: TAAACCCGTACATCCGTCCC | ||||||||||
| Olox9 | F: CGGAGTAGAGCAATCCCCTA | 59 | (GC)15 | 179–185 | PP791924 | 5.077 | 3.732 | 0.873 | 0.679 | 0.903 |
| R: CTGTATCCCCATTCCCCGAA | ||||||||||
| Oinf2 | F: GACTAGGGATCGCTGGGAC | 59 | (TATA)10 | 173–183 | PP791925 | 2.462 | 2.107 | 0.477 | 0.357 | 0.865 |
| R: GTCCCCTAAATCCCGAGTCC | ||||||||||
| Oinf4 | F: GGATGTCCTGACTCGGGG | 59 | (AT)14 | 178–192 | PP791926 | 1.385 | 1.385 | 0.385 | 0.192 | 0.788 |
| R: CCTCCCCAGCTCGCATATC | ||||||||||
| Oinf5 | F: TCGACGCTCCTATGGATAGC | 59 | (CTT)8 | 191–200 | PP791927 | 4.615 | 3.170 | 0.736 | 0.682 | 0.901 |
| R: TCCTCACCTGTCGCACTG | ||||||||||
| Oinf6 | F: CGAGGGACCCGAGAGAGA | 59 | (TC)10 | 163–174 | PP791928 | 2.769 | 1.936 | 0.229 | 0.407 | 0.782 |
| R: AGCTCTCTCTCCCTAAATCGG | ||||||||||
| Oinf10 | F: GTGACGACGCCCATATAATAGG | 58 | (GTTT)6 | 178–185 | PP791929 | 2.769 | 2.117 | 0.492 | 0.463 | 0.885 |
| R: CGAAAAGGCGCGAGGTATC | ||||||||||
| Oinf14 | F: CGGAGCACTATTTTATTTAGCGT | 58 | (TA)16 | 163–174 | PP791930 | 4.692 | 3.061 | 0.522 | 0.538 | 0.823 |
| R: GGGTCTACGTGTGTGTGCAT | ||||||||||
| Oinf20 | F: GGGGATTATAGGCGAGGGAG | 59 | (CTA)10 | 153–163 | PP791931 | 3.538 | 1.908 | 0.160 | 0.384 | 0.886 |
| R: TCCCTCCCCGTCAATCCTAT |
| Species | Populations | N | Na | Ne | I | Ho | He | Fis | PPL |
|---|---|---|---|---|---|---|---|---|---|
| O. loxensis | |||||||||
| LOX-SJB * | 20 | 3.733 ± 0.384 a,b | 2.518 ± 0.265 | 0.968 ± 0.125 b | 0.487 ± 0.089 a | 0.518 ± 0.062 b | 0.014 ± 0.133 d | 93.33 c | |
| LOX-TIR | 21 | 4.231 ± 0.271b | 2.696 ± 0.224 | 1.115 ± 0.076 c | 0.719 ± 0.077 b | 0.656 ± 0.031 c | −0.042 ± 0.124 c | 100.00 a | |
| LOX-CAJ | 20 | 4.210 ± 0.279 b | 2.658 ± 0.206 | 1.112 ± 0.074 c | 0.700 ± 0.076 b | 0.692 ± 0.031 c | −0.035 ± 0.123 c | 100.00 d | |
| LOX-VIL | 21 | 4.222 ± 0.271 b | 2.844 ± 0.224 | 1.149 ± 0.074 c | 0.741 ± 0.081 b | 0.619 ± 0.030 c | −0.033 ± 0.134 c | 100.00 d | |
| LOX-CHA | 22 | 4.260 ± 0.279 b | 3.045 ± 0.231 | 1.196 ± 0.071 c | 0.730 ± 0.082 b | 0.643 ± 0.029 c | −0.002 ± 0.132 c | 100.00 d | |
| O. infrafoveolata | |||||||||
| INF-TIR | 23 | 4.467 ± 0.376 b | 3.143 ± 0.268 | 1.232 ± 0.084 c | 0.749 ± 0.081 b | 0.647 ± 0.031 c | −0.030 ± 0.135 c | 100.00 d | |
| INF-CAJ | 21 | 4.467 ± 0.376 b | 3.004 ± 0.280 | 1.177 ± 0.093 c | 0.733 ± 0.080 b | 0.623 ± 0.037 c | −0.202 ± 0.129 b | 100.00 d | |
| INF-VIL | 23 | 4.333 ± 0.361 b | 2.994 ± 0.226 | 1.193 ± 0.075 c | 0.781 ± 0.089 b | 0.641 ± 0.025 c | −0.197 ± 0.153 b | 100.00 d | |
| INF-CHA | 21 | 4.333 ± 0.374 b | 2.977 ± 0.228 | 1.188 ± 0.076 c | 0.749 ± 0.081 b | 0.639 ± 0.025 c | −0.199 ± 0.143 b | 100.00 d | |
| INF-NUM * | 22 | 4.267 ± 0.396 b | 3.097 ± 0.250 | 1.206 ± 0.084 c | 0.730 ± 0.081 b | 0.650 ± 0.025 c | −0.170 ± 0.153 b | 100.00 d | |
| INF-TAM * | 24 | 4.200 ± 0.355 b | 3.068 ± 0.242 | 1.188 ± 0.076 c | 0.794 ± 0.070 b | 0.650 ± 0.023 c | −0.268 ± 0.136 b | 100.00 d | |
| INF-CJS * | 25 | 2.467 ± 0.413 a | 1.894 ± 0.164 | 0.626 ± 0.115 b | 0.501 ± 0.114 a | 0.296 ± 0.065 a | −0.798 ± 0.069 a | 73.33 b | |
| INF-QUH * | 25 | 2.067 ± 0.396 a | 1.653 ± 0.177 | 0.454 ± 0.123 a | 0.525 ± 0.131 a | 0.288 ± 0.073 a | −0.848 ± 0.063 a | 53.33 a |
| LOX-SJB * | LOX-TIR | LOX-CAJ | LOX-VIL | LOX-CHA | INF-TIR | INF-CAJ | INF-VIL | INF-CHA | INF-NUM * | INF-TAM * | INF-CJS * | INF-QUH * | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0 | LOX-SJB * | ||||||||||||
| 0.110 | 0 | LOX-TIR | |||||||||||
| 0.108 | 0.038 | 0 | LOX-CAJ | ||||||||||
| 0.104 | 0.028 | 0.043 | 0 | LOX-VIL | |||||||||
| 0.113 | 0.046 | 0.047 | 0.030 | 0 | LOX-CHA | ||||||||
| 0.320 | 0.321 | 0.334 | 0.315 | 0.290 | 0 | INF-TIR | |||||||
| 0.342 | 0.341 | 0.355 | 0.334 | 0.311 | 0.012 | 0 | INF-CAJ | ||||||
| 0.333 | 0.337 | 0.351 | 0.331 | 0.306 | 0.009 | 0.009 | 0 | INF-VIL | |||||
| 0.363 | 0.36 | 0.375 | 0.353 | 0.329 | 0.017 | 0.013 | 0.010 | 0 | INF-CHA | ||||
| 0.344 | 0.337 | 0.352 | 0.331 | 0.310 | 0.013 | 0.015 | 0.011 | 0.008 | 0 | INF-NUM * | |||
| 0.357 | 0.354 | 0.367 | 0.349 | 0.327 | 0.025 | 0.024 | 0.021 | 0.011 | 0.017 | 0 | INF-TAM * | ||
| 0.502 | 0.514 | 0.531 | 0.502 | 0.482 | 0.204 | 0.200 | 0.204 | 0.199 | 0.196 | 0.211 | 0 | INF-CJS * | |
| 0.520 | 0.534 | 0.550 | 0.521 | 0.501 | 0.273 | 0.270 | 0.277 | 0.276 | 0.269 | 0.289 | 0.302 | 0 | INF-QUH * |
| Populations | df | SS | % Variance |
|---|---|---|---|
| All samples | |||
| Among populations | 12 | 1147.090 | 39% |
| Within populations | 275 | 956.500 | 61% |
| O. loxensis | |||
| Among populations | 4 | 3.660 | 6% |
| Within populations | 104 | 46.500 | 94% |
| O. infrafoveolata | |||
| Among populations | 7 | 804.600 | 41% |
| Within populations | 176 | 1180.796 | 59% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Draper, D.; Riofrío, L.; Naranjo, C.; Marques, I. The Complex Genetic Legacy of Hybridization and Introgression between the Rare Ocotea loxensis van der Werff and the Widespread O. infrafoveolata van der Werff (Lauraceae). Plants 2024, 13, 1956. https://doi.org/10.3390/plants13141956
Draper D, Riofrío L, Naranjo C, Marques I. The Complex Genetic Legacy of Hybridization and Introgression between the Rare Ocotea loxensis van der Werff and the Widespread O. infrafoveolata van der Werff (Lauraceae). Plants. 2024; 13(14):1956. https://doi.org/10.3390/plants13141956
Chicago/Turabian StyleDraper, David, Lorena Riofrío, Carlos Naranjo, and Isabel Marques. 2024. "The Complex Genetic Legacy of Hybridization and Introgression between the Rare Ocotea loxensis van der Werff and the Widespread O. infrafoveolata van der Werff (Lauraceae)" Plants 13, no. 14: 1956. https://doi.org/10.3390/plants13141956
APA StyleDraper, D., Riofrío, L., Naranjo, C., & Marques, I. (2024). The Complex Genetic Legacy of Hybridization and Introgression between the Rare Ocotea loxensis van der Werff and the Widespread O. infrafoveolata van der Werff (Lauraceae). Plants, 13(14), 1956. https://doi.org/10.3390/plants13141956

