Cheungsam Seed Husk Extract Reduces Skin Inflammation through Regulation of Inflammatory Mediator in TNF-α/IFN-γ-Induced HaCaT Cells
Abstract
:1. Introduction
2. Results
2.1. Gas Chromatography-Mass Spectrometry Analysis of Cheungsam Seed Husk Ethanol Extract
2.2. CSSH Decreases Pro-Inflammatory Cytokines and Chemokines in TNF-α/IFN-γ-Induced HaCaT Cells
2.3. CSSH Reduces Atopic Dermatitis-Related Cytokines and Chemokines in TNF-α/IFN-γ-Induced HaCaT Cells
2.4. CSSH Downregulates the MAPK (ERK, JNK and p38) and NF-κB Pathways in TNF-α/IFN-γ-Induced HaCaT Cells
2.5. CSSH Inhibits NLRP3 Inflammasome Activation in TNF-α/IFN-γ-Induced HaCaT Cells
2.6. CSSH Suppresses Phosphorylation of JAK1 and STAT6 in TNF-α/IFN-γ-Induced HaCaT Cells
2.7. CSSH Upregulates Filaggrin and Involucrin in TNF-α/IFN-γ-Induced HaCaT Cells
3. Discussion
4. Materials and Methods
4.1. Chemicals and Reagents
4.2. Preparation of Cheungsam Seed Husk Extract
4.3. Gas Chromatography-Mass Spectrometry Analysis of Cheungsam Seed Husk Extract
4.4. Cell Culture
4.5. Cell Viability Assay
4.6. RNA Extraction and Real-Time Quantitative PCR
4.7. Western Blotting
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Bautista, J.L.; Yu, S.; Tian, L. Flavonoids in Cannabis sativa: Biosynthesis, bioactivities, and biotechnology. ACS Omega 2021, 6, 5119–5123. [Google Scholar] [CrossRef]
- Anil, S.M.; Peeri, H.; Koltai, H. Medical Cannabis Activity Against Inflammation: Active Compounds and Modes of Action. Front. Pharmacol. 2022, 13, 908198. [Google Scholar] [CrossRef]
- De Gregorio, D.; McLaughlin, R.J.; Posa, L.; Ochoa-Sanchez, R.; Enns, J.; Lopez-Canul, M.; Aboud, M.; Maione, S.; Comai, S.; Gobbi, G. Cannabidiol modulates serotonergic transmission and reverses both allodynia and anxiety-like behavior in a model of neuropathic pain. Pain 2019, 160, 136. [Google Scholar] [CrossRef]
- Rodriguez, C.E.B.; Ouyang, L.; Kandasamy, R. Antinociceptive effects of minor cannabinoids, terpenes and flavonoids in Cannabis. Behav. Pharmacol. 2022, 33, 130–157. [Google Scholar] [CrossRef]
- Gulck, T.; Moller, B.L. Phytocannabinoids: Origins and Biosynthesis. Trends Plant Sci. 2020, 25, 985–1004. [Google Scholar] [CrossRef]
- Castillo-Arellano, J.; Canseco-Alba, A.; Cutler, S.J.; Leon, F. The Polypharmacological Effects of Cannabidiol. Molecules 2023, 28, 3271. [Google Scholar] [CrossRef]
- Filer, C.N. Acidic cannabinoid decarboxylation. Cannabis Cannabinoid Res. 2022, 7, 262–273. [Google Scholar] [CrossRef]
- Britch, S.C.; Babalonis, S.; Walsh, S.L. Cannabidiol: Pharmacology and therapeutic targets. Psychopharmacology 2021, 238, 9–28. [Google Scholar] [CrossRef]
- Kumar, P.; Mahato, D.K.; Kamle, M.; Borah, R.; Sharma, B.; Pandhi, S.; Tripathi, V.; Yadav, H.S.; Devi, S.; Patil, U.; et al. Pharmacological properties, therapeutic potential, and legal status of Cannabis sativa L.: An overview. Phytother. Res. 2021, 35, 6010–6029. [Google Scholar] [CrossRef]
- Farinon, B.; Molinari, R.; Costantini, L.; Merendino, N. The seed of industrial hemp (Cannabis sativa L.): Nutritional quality and potential functionality for human health and nutrition. Nutrients 2020, 12, 1935. [Google Scholar] [CrossRef]
- Moon, Y.-H.; Lee, B.-H.; Jeong, B.-C.; Kim, Y.-u.; Kim, G.-Y. Breeding History of Non-drug Type Hemp Variety “Cheungsam” and It’s Characteristics. Korean J. Int. Agric. 2002, 14, 119–126. [Google Scholar]
- Kleinhenz, M.D.; Magnin, G.; Ensley, S.M.; Griffin, J.J.; Goeser, J.; Lynch, E.; Coetzee, J.F. Nutrient concentrations, digestibility, and cannabinoid concentrations of industrial hemp plant components. Appl. Anim. Sci. 2020, 36, 489–494. [Google Scholar] [CrossRef]
- Zhang, J.M.; An, J. Cytokines, inflammation, and pain. Int. Anesthesiol. Clin. 2007, 45, 27–37. [Google Scholar] [CrossRef]
- Chen, L.; Deng, H.; Cui, H.; Fang, J.; Zuo, Z.; Deng, J.; Li, Y.; Wang, X.; Zhao, L. Inflammatory responses and inflammation-associated diseases in organs. Oncotarget 2018, 9, 7204. [Google Scholar] [CrossRef]
- Libby, P.J.N.r. Inflammatory mechanisms: The molecular basis of inflammation and disease. Nutr. Rev. 2007, 65, S140–S146. [Google Scholar] [CrossRef]
- Liska, M.; Gutova, V.; Panzner, P.; Brodska, P. The clinical relevance of various hypersensitivity tests in patients with atopic dermatitis as assessed by their history, SCORAD changes, and number of days with need of anti-Inflammatory treatment. Pediatr. Allergy Immunol. Pulmonol. 2015, 28, 87–91. [Google Scholar] [CrossRef]
- Orciani, M.; Campanati, A.; Caffarini, M.; Ganzetti, G.; Consales, V.; Lucarini, G.; Offidani, A.; Di Primio, R. T helper (Th) 1, Th17 and Th2 imbalance in mesenchymal stem cells of adult patients with atopic dermatitis: At the origin of the problem. Br. J. Dermatol. 2017, 176, 1569–1576. [Google Scholar] [CrossRef]
- Brandt, E.B.; Sivaprasad, U. Th2 Cytokines and Atopic Dermatitis. J. Clin. Cell Immunol. 2011, 2, 110. [Google Scholar] [CrossRef]
- Chiricozzi, A.; Maurelli, M.; Peris, K.; Girolomoni, G. Targeting IL-4 for the Treatment of Atopic Dermatitis. Immunotargets Ther. 2020, 9, 151–156. [Google Scholar] [CrossRef]
- Napolitano, M.; di Vico, F.; Ruggiero, A.; Fabbrocini, G.; Patruno, C. The hidden sentinel of the skin: An overview on the role of interleukin-13 in atopic dermatitis. Front. Med. 2023, 10, 1165098. [Google Scholar] [CrossRef]
- Renert-Yuval, Y.; Thyssen, J.P.; Bissonnette, R.; Bieber, T.; Kabashima, K.; Hijnen, D.; Guttman-Yassky, E. Biomarkers in atopic dermatitis-a review on behalf of the International Eczema Council. J. Allergy Clin. Immunol. 2021, 147, 1174–1190.e1171. [Google Scholar] [CrossRef]
- Rerknimitr, P.; Otsuka, A.; Nakashima, C.; Kabashima, K. Skin Barrier Function and Atopic Dermatitis. Curr. Dermatol. Rep. 2018, 7, 209–220. [Google Scholar] [CrossRef]
- Agrawal, R.; Woodfolk, J.A. Skin barrier defects in atopic dermatitis. Curr. Allergy Asthma Rep. 2014, 14, 433. [Google Scholar] [CrossRef]
- Sandilands, A.; Sutherland, C.; Irvine, A.D.; McLean, W.H. Filaggrin in the frontline: Role in skin barrier function and disease. J. Cell Sci. 2009, 122, 1285–1294. [Google Scholar] [CrossRef]
- Cho, K.; Kang, M.C.; Parveen, A.; Yumnam, S.; Kim, S.Y. Anti-Inflammatory Effect of Chloroform Fraction of Pyrus Ussuriensis Maxim. Leaf Extract on 2, 4-Dinitrochlorobenzene-Induced Atopic Dermatitis in nc/nga Mice. Nutrients 2019, 11, 276. [Google Scholar] [CrossRef]
- Oh, J.S.; Lee, S.J.; Choung, S.Y. Lithospermum erythrorhizon Alleviates Atopic Dermatitis-like Skin Lesions by Restoring Immune Balance and Skin Barrier Function in 2.4-Dinitrochlorobenzene-Induced NC/Nga Mice. Nutrients 2021, 13, 3209. [Google Scholar] [CrossRef]
- Yang, C.-C.; Hung, Y.-L.; Ko, W.-C.; Tsai, Y.-J.; Chang, J.-F.; Liang, C.-W.; Chang, D.-C.; Hung, C.-F. Effect of neferine on DNCB-induced atopic dermatitis in HaCaT cells and BALB/c mice. Int. J. Mol. Sci. 2021, 22, 8237. [Google Scholar] [CrossRef]
- Mahendra, C.K.; Abidin, S.A.Z.; Htar, T.T.; Chuah, L.-H.; Khan, S.U.; Ming, L.C.; Tang, S.Y.; Pusparajah, P.; Goh, B.H. Counteracting the ramifications of UVB irradiation and photoaging with Swietenia macrophylla King seed. Molecules 2021, 26, 2000. [Google Scholar] [CrossRef]
- Lee, S.-B.; Kang, J.-H.; Sim, E.-J.; Jung, Y.-R.; Kim, J.-H.; Hillman, P.F.; Nam, S.-J.; Kang, T.-B. Inflammasome activation and attenuates imiquimod-induced psoriasis-like skin inflammation. Int. J. Mol. Sci. 2023, 24, 5653. [Google Scholar] [CrossRef]
- Zagórska-Dziok, M.; Bujak, T.; Ziemlewska, A.; Nizioł-Łukaszewska, Z. Positive effect of Cannabis sativa L. herb extracts on skin cells and assessment of cannabinoid-based hydrogels properties. Molecules 2021, 26, 802. [Google Scholar] [CrossRef]
- Mazzantini, C.; El Bourji, Z.; Parisio, C.; Davolio, P.L.; Cocchi, A.; Pellegrini-Giampietro, D.E.; Landucci, E. Anti-Inflammatory Properties of Cannabidiol and Beta-Caryophyllene Alone or Combined in an In Vitro Inflammation Model. Pharmaceuticals 2024, 17, 467. [Google Scholar] [CrossRef]
- Žitek, T.; Leitgeb, M.; Golle, A.; Dariš, B.; Knez, Ž.; Knez Hrnčič, M. The influence of hemp extract in combination with ginger on the metabolic activity of metastatic cells and microorganisms. Molecules 2020, 25, 4992. [Google Scholar] [CrossRef]
- Takeda, S.; Misawa, K.; Yamamoto, I.; Watanabe, K. Cannabidiolic acid as a selective cyclooxygenase-2 inhibitory component in cannabis. J. Drug Metab. Dispos. 2008, 36, 1917–1921. [Google Scholar] [CrossRef]
- Gaweł-Bęben, K.; Czech, K.; Luca, S.V. Cannabidiol and Minor Phytocannabinoids: A Preliminary Study to Assess Their Anti-Melanoma, Anti-Melanogenic, and Anti-Tyrosinase Properties. J. Pharm. 2023, 16, 648. [Google Scholar] [CrossRef]
- Sroka-Tomaszewska, J.; Trzeciak, M. Molecular mechanisms of atopic dermatitis pathogenesis. Int. J. Mol. Sci. 2021, 22, 4130. [Google Scholar] [CrossRef]
- Atherton, D.J. Topical corticosteroids in atopic dermatitis. BMJ 2003, 327, 942–943. [Google Scholar] [CrossRef]
- Barta, K.; Fonacier, L.S.; Hart, M.; Lio, P.; Tullos, K.; Sheary, B.; Winders, T.A. Corticosteroid exposure and cumulative effects in patients with eczema: Results from a patient survey. Ann. Allergy Asthma Immunol. 2023, 130, 93–99.e10. [Google Scholar] [CrossRef]
- Walsh, K.B.; McKinney, A.E.; Holmes, A.E. Minor cannabinoids: Biosynthesis, molecular pharmacology and potential therapeutic uses. J. Front. Pharmacol. 2021, 12, 777804. [Google Scholar] [CrossRef]
- Gęgotek, A.; Atalay, S.; Wroński, A.; Markowska, A.; Skrzydlewska, E. Cannabidiol decreases metalloproteinase activity and normalizes angiogenesis factor expression in UVB-irradiated keratinocytes from psoriatic patients. Oxid. Med. Cell. Longev. 2021, 2021, 7624389. [Google Scholar] [CrossRef]
- Li, Y.; Hao, D.; Wei, D.; Xiao, Y.; Liu, L.; Li, X.; Wang, L.; Gan, Y.; Yan, W.; Ke, B. Photoprotective effects of cannabidiol against ultraviolet-B-induced DNA damage and autophagy in human keratinocyte cells and mouse skin tissue. Molecules 2022, 27, 6740. [Google Scholar] [CrossRef]
- Stella, A.; Palmieri, B.; Laurino, C.; Vadalà, M. A therapeutic effect of cbd-enriched ointment in inflammatory skin diseases and cutaneous scars. Clin. Ter. 2019, 170, e93–e99. [Google Scholar] [CrossRef]
- O’Brien, K. Cannabidiol (CBD) in Cancer Management. Cancers 2022, 14, 885. [Google Scholar] [CrossRef]
- Kubiliene, A.; Mickute, K.; Baranauskaite, J.; Marksa, M.; Liekis, A.; Sadauskiene, I. The Effects of Cannabis sativa L. extract on oxidative stress markers in vivo. Life 2021, 11, 647. [Google Scholar] [CrossRef]
- Zaiachuk, M.; Suryavanshi, S.V.; Pryimak, N.; Kovalchuk, I.; Kovalchuk, O. The Anti-Inflammatory Effects of Cannabis sativa Extracts on LPS-Induced Cytokines Release in Human Macrophages. Molecules 2023, 28, 4991. [Google Scholar] [CrossRef]
- Qushawy, M.; Mortagi, Y.; Alshaman, R.; Mokhtar, H.I.; Hisham, F.A.; Alattar, A.; Liang, D.; Enan, E.T.; Eltrawy, A.H.; Alamrani, Z.H. Formulation and characterization of O/W nanoemulsions of hemp seed oil for protection from steatohepatitis: Analysis of hepatic free fatty acids and oxidation markers. Pharmaceuticals 2022, 15, 864. [Google Scholar] [CrossRef]
- Vitorović, J.; Joković, N.; Radulović, N.; Mihajilov-Krstev, T.; Cvetković, V.J.; Jovanović, N.; Mitrović, T.; Aleksić, A.; Stanković, N.; Bernstein, N. Antioxidant activity of hemp (Cannabis sativa L.) seed oil in Drosophila melanogaster larvae under non-stress and H2O2-induced oxidative stress conditions. Antioxidants 2021, 10, 830. [Google Scholar] [CrossRef]
- Choi, M.-H.; Yang, S.-H.; Kim, N.D.; Shin, H.-J. Nomilin from Yuzu Seed Has in vitro antioxidant activity and downregulates melanogenesis in B16F10 melanoma cells through the PKA/CREB signaling pathway. Antioxidants 2022, 11, 1636. [Google Scholar] [CrossRef]
- Chen, W.T.; Zhang, Y.Y.; Qiang, Q.; Zou, L.L.; Zou, P.; Xu, Y. Pinobanksin from peony seed husk: A flavonoid with the potential to inhibit the proliferation of SH-SY5Y. Food Sci. Nutr. 2024, 12, 815–829. [Google Scholar] [CrossRef]
- Albanesi, C.; Scarponi, C.; Giustizieri, M.L.; Girolomoni, G. Keratinocytes in inflammatory skin diseases. Curr. Drug Targets Inflamm. Allergy 2005, 4, 329–334. [Google Scholar] [CrossRef]
- Gröne, A. Keratinocytes and cytokines. Vet. Immunol. Immunopathol. 2002, 88, 1–12. [Google Scholar] [CrossRef]
- Chieosilapatham, P.; Kiatsurayanon, C.; Umehara, Y.; Trujillo-Paez, J.; Peng, G.; Yue, H.; Nguyen, L.; Niyonsaba, F.J.C.; Immunology, E. Keratinocytes: Innate immune cells in atopic dermatitis. Clin. Exp. Immunol. 2021, 204, 296–309. [Google Scholar] [CrossRef]
- Niwa, Y. Elevated RANTES levels in plasma or skin and decreased plasma IL-10 levels in subsets of patients with severe atopic dermatitis. Arch. Dermatol. 2000, 136, 125–126. [Google Scholar] [CrossRef]
- Zheng, X.; Nakamura, K.; Furukawa, H.; Nishibu, A.; Takahashi, M.; Tojo, M.; Kaneko, F.; Kakinuma, T.; Tamaki, K. Demonstration of TARC and CCR4 mRNA expression and distribution using in situ RT-PCR in the lesional skin of atopic dermatitis. J. Dermatol. 2003, 30, 26–32. [Google Scholar] [CrossRef]
- Kakinuma, T.; Nakamura, K.; Wakugawa, M.; Mitsui, H.; Tada, Y.; Saeki, H.; Torii, H.; Komine, M.; Asahina, A.; Tamaki, K.; et al. Serum macrophage-derived chemokine (MDC) levels are closely related with the disease activity of atopic dermatitis. Clin. Exp. Immunol. 2002, 127, 270–273. [Google Scholar] [CrossRef]
- Arthur, J.S.C.; Ley, S.C. Mitogen-activated protein kinases in innate immunity. Nat. Rev. Immunol. 2013, 13, 679–692. [Google Scholar] [CrossRef]
- Viatour, P.; Merville, M.-P.; Bours, V.; Chariot, A. Phosphorylation of NF-κB and IκB proteins: Implications in cancer and inflammation. Trends Biochem. Sci. 2005, 30, 43–52. [Google Scholar] [CrossRef]
- Nolan, R.; Reeb, K.; Rong, Y.; Matt, S.; Johnson, H.; Runner, K.; Gaskill, P. Dopamine activates NF-κB and primes the NLRP3 inflammasome in primary human macrophages. Brain Behav. Immun. Health 2020, 2, 100030. [Google Scholar] [CrossRef]
- Urwanisch, L.; Luciano, M.; Horejs-Hoeck, J. The NLRP3 inflammasome and its role in the pathogenicity of leukemia. Int. J. Mol. Sci. 2021, 22, 1271. [Google Scholar] [CrossRef]
- Pivarcsi, A.; Homey, B. Chemokine Networks in Atopic Dermatitis: Traffic Signals of Disease. Curr. Allergy Asthma Rep. 2005, 5, 284–290. [Google Scholar] [CrossRef]
- Bao, L.; Zhang, H.; Chan, L.S. The involvement of the JAK-STAT signaling pathway in chronic inflammatory skin disease atopic dermatitis. JAKSTAT 2013, 2, e24137. [Google Scholar] [CrossRef]
- Wittmann, M.; McGonagle, D.; Werfel, T. Cytokines as therapeutic targets in skin inflammation. Cytokine Growth Factor Rev. 2014, 25, 443–451. [Google Scholar] [CrossRef]
- Wollenberg, A.; Christen-Zäch, S.; Taieb, A.; Paul, C.; Thyssen, J.P. ETFAD/EADV Eczema task force 2020 position paper on diagnosis and treatment of atopic dermatitis in adults and children. J. Eur. Acad. Dermatol. Venereol. 2020, 34, 2717–2744. [Google Scholar] [CrossRef]
- Saunders, S.P.; Moran, T.; Floudas, A.; Wurlod, F.; Fallon, P.G. Spontaneous atopic dermatitis is mediated by innate immunity, with the secondary lung inflammation of the atopic march requiring adaptive immunity. J. Allergy Clin. Immunol. 2016, 137, 482–491. [Google Scholar] [CrossRef]
Cannabinoid | CBD | CBDA | Δ9-THC | CBN |
---|---|---|---|---|
Content (μg/mg) | 4.30 ± 0.065 | 4.25 ± 0.051 | 3.18 ± 0.104 | 3.69 ± 0.083 |
Gene | Forward Primer | Reverse Primer | Amplicon Size (bp) |
---|---|---|---|
IL-1β | CTCTCTCACCTCTCCTACTCAC | ACACTGCCTACTTCTTGCCCC | 93 |
IL-4 | ACATTGTCACTGCAAATCGACACC | TGTCTGTTACGGTCAACTCGGTGC | 113 |
IL-6 | CTCCACAAGCGCCTTCGGTC | TGTGTGGGGCGGCTACATCT | 121 |
IL-8 | ACCGGAGCACTCCATAAGGCA | AGGCTGCCAAGAGAGCCACG | 87 |
MCP-1 | TCTGTGCCTGCTGCTCATAG | CAGATCTCCTTGGCCACAAT | 72 |
CXCL10 | TTGCTGCCTTATCTTTCTGACTC | ATGGCCTTCGATTCTGGATT | 148 |
CCL17 | CCATTCCCCTTAGAAAGCTG | CTCTCAAGGCTTTGCAGGTA | 124 |
MDC | TGCCGTGATTACGTCCGTTAC | AAGGCCACGGTCATCAGAGTAG | 129 |
RANTES | CGCTGTCATCCTCATTGCTA | GCACTTGCCACTGGTGTAGA | 143 |
GAPDH | GAAGGTGAAGGTCGGAGT | GAAGATGGTGATGGGATTTC | 133 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Han, J.-Y.; Lee, Y.J.; Lim, D.-W.; Jung, H.-J.; Kwon, E.; Hong, J.; Lee, Y.-M. Cheungsam Seed Husk Extract Reduces Skin Inflammation through Regulation of Inflammatory Mediator in TNF-α/IFN-γ-Induced HaCaT Cells. Plants 2024, 13, 1704. https://doi.org/10.3390/plants13121704
Han J-Y, Lee YJ, Lim D-W, Jung H-J, Kwon E, Hong J, Lee Y-M. Cheungsam Seed Husk Extract Reduces Skin Inflammation through Regulation of Inflammatory Mediator in TNF-α/IFN-γ-Induced HaCaT Cells. Plants. 2024; 13(12):1704. https://doi.org/10.3390/plants13121704
Chicago/Turabian StyleHan, Ji-Ye, Yun Jung Lee, Do-Won Lim, Hyun-Ju Jung, EunJeong Kwon, Jongki Hong, and Young-Mi Lee. 2024. "Cheungsam Seed Husk Extract Reduces Skin Inflammation through Regulation of Inflammatory Mediator in TNF-α/IFN-γ-Induced HaCaT Cells" Plants 13, no. 12: 1704. https://doi.org/10.3390/plants13121704
APA StyleHan, J.-Y., Lee, Y. J., Lim, D.-W., Jung, H.-J., Kwon, E., Hong, J., & Lee, Y.-M. (2024). Cheungsam Seed Husk Extract Reduces Skin Inflammation through Regulation of Inflammatory Mediator in TNF-α/IFN-γ-Induced HaCaT Cells. Plants, 13(12), 1704. https://doi.org/10.3390/plants13121704