Cellular Morphology and Transcriptome Comparative Analysis of Astragalus membranaceus Bunge Sprouts Cultured In Vitro under Different LED Light
Abstract
1. Introduction
2. Results
2.1. Comparison of the Cellular Morphologies of A. membranaceus Sprouts Germinated In Vitro under Three Different LED Light Sources
2.2. RNA-Seq of A. membranaceus Sprouts Germinated In Vitro under Three Different Light Sources
2.3. Analysis of Differentially Expressed Genes in A. membranaceus Sprouts Germinated In Vitro under Three Different Light Sources
2.4. GO Analysis of A. membranaceus Sprouts Germinated In Vitro under Three Different Light Sources
2.5. qPCR Analysis for Reference Genes by GO Analysis
2.6. Up- and Downregulation of Transcriptomes in A. membranaceus Sprouts Treated with Blue LED Light vs. Red LED Light
2.7. Up- and Downregulation of Transcriptomes in A. membranaceus Sprouts Treated with Blue LED Light vs. White LED Light
2.8. Up- and Downregulation of Transcriptomes in A. membranaceus Sprouts Treated with Red LED-Light vs. White LED-Light
3. Discussion
4. Materials and Methods
4.1. Preparation of In Vitro-Cultured A. membranaceus Sprouts under Artificial Light Source Conditions
4.2. Scanning Electron Microscope Analysis
4.3. RNA-Seq Library Construction and Sequencing
4.4. Analysis of Differential Gene Expression
4.5. qPCR Analysis of Reference Genes
4.6. Gene Annotation and Functional Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kim, J.S.; Kim, Y.T.; Kim, C.S. A Study on the Constituents from the Roots of Astragalus membranaceus(I). Korean J. Pharmacogn. 1996, 27, 336–341. [Google Scholar]
- Kim, M.J.; Lim, K.R.; Jung, T.K.; Yoon, K.S. Anti-Aging Effect of Astragalus membranaceus Root Extract. J. Soc. Cos. Sci. Korea 2007, 33, 33–40. [Google Scholar]
- Jung, T.K.; Kim, M.J.; Lim, K.R.; Yoon, K.S. Moisturizing and Anti-oxdation Effect of Astragalus membranaceus Root Extract. J. Soc. Cos. Sci. Korea 2006, 32, 193–200. [Google Scholar]
- Yin, Y.; Heo, S.I.; Jung, M.J.; Wang, M.H. Antioxidant and Antidiabetic Effects of Various Sections of Astragalus membranaceus. Korean J. Pharmacogn. 2009, 40, 1–5. [Google Scholar]
- Song, B.N.; Lee, D.M.; Lee, S.H.; Park, B.R.; Choi, J.H.; Kim, Y.S.; Park, S.Y. Physicochemical Properties and Antioxidant Activity of Extract from Astragalus membranaceus Bunge Leaf Fermented with Lactic Acid Bacteria. Korean J. Med. Crop Sci. 2020, 28, 428–434. [Google Scholar] [CrossRef]
- Park, Y.C.; Lee, J.S.; Kim, D.Y.; Son, H.Y.; Lee, J.W.; Cheoi, Y.S.; Kim, K.K.; Yu, C.Y.; Chung, I.M.; Im, M.H.; et al. A 90 Day Repeated Dose-oral Toxicity Study of Extracts from Astragalus membranaceus-aboveground Parts in Rats. Korean J. Med. Crop Sci. 2013, 21, 474–485. [Google Scholar] [CrossRef]
- Lee, S.W. Plant Cultivation Using Plant Factory and LED Artificial Light. Opt. Sci. Technol. 2010, 14, 12–19. [Google Scholar]
- Lee, W.S.; Kim, S.G. Analysis of Photosynthetic Photon Flux by Prototype of Rotational Lighting System for Plant Factory. J. Korea Acad.-Ind. Coop. Soc. 2013, 14, 529–534. [Google Scholar]
- Lee, S.W.; Park, S.K. LED Array Design for Optimal Combination of Plant Grown. J. Plant Biotechnol. 2014, 41, 123–126. [Google Scholar] [CrossRef]
- Hwang, M.K.; Huh, C.S.; Seo, Y.J. Optic Characteristics Comparison and Analysis of SMD type Y/G/W HB LED. J. Kllee 2004, 18, 15–21. [Google Scholar]
- Bang, K.S.; Chang, Y.N.; Jin, J.S.; Park, S.A.; Lim, J.S.; Park, J.S.; Kim, J.S.; Lee, J.H. A Comparative Study of Physiological Activity and Ingredient Analysis of Glycyrrhiza uralensis Fischer Stems and Leaves Cultivated with Different Wavelength of LED Lights. Korean J. Plant Res. 2015, 28, 126–134. [Google Scholar] [CrossRef]
- Choi, M.K.; Baek, G.Y.; Kwon, S.J.; Yoon, Y.C.; Kim, H.T. Effect of LED Light Wavelength on Lettuce Growth, Vitamin C and Anthocyanin Contents. Prot. Hort. Plant Fac. 2014, 23, 19–25. [Google Scholar] [CrossRef]
- Kukurba, K.R.; Montgomery, S.B. RNA Sequencing and Analysis. Cold Spring Harb. Protoc. 2015, 11, 951–969. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Chen, J.; Zhou, X.; Chen, X.; Li, Q.; Tan, H.; Dong, X.; Xiao, Y.; Chen, L.; Chen, W. Dynamic Metabolic and Transcriptomic Profling of Methyl Jasmonate-Treated Hairy Roots Reveals Synthetic Characters and Regulators of Lignan Biosynthesis in Isatis indigotica Fort. Plant Biotechnol. J. 2016, 14, 2217–2227. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Wang, Y.; Wang, T.; Ying, X.; Wu, R.; Chen, H. De novo Assembly and Annotation of the Zhe-Maidong (Ophiopogon japonicus (L.f.) Ker-Gawl) Transcriptome in Different Growth Stages. Sci. Rep. 2017, 7, 3616. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Zhang, X.; Sheng, J. Integrative Analysis of the Transcriptome and Metabolome Reveals the Mechanism of Saline–Alkali Stress Tolerance in Astragalus membranaceus (Fisch) Bge. var. mongholicus (Bge.) Hsiao. Food Qual. Saf. 2022, 6, fyac001. [Google Scholar] [CrossRef]
- Liang, J.; Li, W.; Jia, X.; Zhang, Y.; Zhao, J. Transcriptome Sequencing and Characterization of Astragalus membranaceus var. mongholicus Root Reveals Key Genes Involved in Flavonoids Biosynthesis. Genes Genom. 2020, 42, 901–914. [Google Scholar] [CrossRef]
- Seo, J.W.; Lee, J.G.; Yoo, J.H.; Lim, J.D.; Kim, M.J.; Seong, E.S. Growth Characteristics and Biological Activities in Astragalus membranaceus Seedlings of Exposed to Different Types of Artificial Light. Korean J. Med. Crop Sci. 2022, 30, 339–346. [Google Scholar] [CrossRef]
- Cioć, M.; Szewczyk, A.; Żupnik, M.; Kalisz, A.; Pawłowska, B. LED Lighting Affects Plant Growth, Morphogenesis and Phytochemical Contents of Myrtus communis L. in vitro. Plant Cell Tiss. Organ Cult. 2018, 132, 433–447. [Google Scholar] [CrossRef]
- Choi, H.L.; Seo, J.W.; Hwang, M.H.; Lee, H.I.; Kim, M.J.; Yu, C.Y. Growth Characteristics and Functional Analysis of Salvia miltiorrhiza Bunge by Artificial Light Sources. Korean J. Med. Crop Sci. 2020, 28, 200–208. [Google Scholar] [CrossRef]
- Kurilčik, A.; Miklušytė-Čanova, R.; Dapkūnienė, S.; Žilinskaitė, S.; Kurilčik, G.; Tamulaitis, G.; Duchovskis, P.; Žukauskas, A. In vitro culture of Chrysanthemum Plantlets Using Light-Emitting Diodes. Cent. Eur. J. Biol. 2008, 3, 161–167. [Google Scholar] [CrossRef]
- Son, K.H.; Park, J.H.; Kim, D.I.; Oh, M.M. Leaf Shape Index, Growth, and Phytochemicals in Two Leaf Lettuce Cultivars Grown Under Monochromatic Light-Emitting Diodes. Korean J. Hort. Sci. Technol. 2012, 30, 664–672. [Google Scholar]
- Li, H.; Xu, Z.; Tang, C. Effect of Light-Emitting Diodes on Growth and Morphogenesis of Upland Cotton (Gossypium hirsutum L.) Plantlets in vitro. Plant Cell Tiss. Organ Cult. 2010, 103, 155–163. [Google Scholar] [CrossRef]
- Gupta, S.D.; Jatothu, B. Fundamentals and Applications of Light Emitting Diodes (LEDs) in in vitro Plant Growth and Morphogenesis. Plant Biotechnol. Rep. 2013, 7, 211–220. [Google Scholar] [CrossRef]
- Rice-Evans, C. Flavonoid Antioxidants. Curr. Med. Chem. 2001, 8, 797–807. [Google Scholar] [CrossRef]
- Cho, J.J.; Kim, H.S.; Kim, C.H.; Cho, S.J. Interaction with Polyphenols and Antibiotics. J. Life Sci. 2017, 27, 476–481. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, X.; Wang, Z. Antioxidant Activities of Leaf Extract of Salvia miltiorrhiza Bunge and Related Phenolic Constituents. Food Chem. Toxicol. 2010, 48, 2656–2662. [Google Scholar] [CrossRef]
- Manivannan, A.; Soundararajan, P.; Halimah, N.; Ko, C.H.; Jeong, B.R. Blue LED light enhances growth, phytochemical contents, and antioxidant enzyme activities of Rehmannia glutinosa cultured in vitro. Hort. Environ. Biotechnol. 2015, 56, 105–113. [Google Scholar] [CrossRef]
- Petrussa, E.; Braidot, E.; Zancani, M.; Peresson, C.; Bertolini, A.; Patui, S.; Vianello, A. Plant Flavonoids-Biosynthesis, Transport and Involvement in Stress Responses. Int. J. Mol. Sci. 2013, 14, 14950–14973. [Google Scholar] [CrossRef]
- Chin, S.; Behm, C.A.; Mathesius, U. Functions of Flavonoids in Plant–Nematode Interactions. Plants 2018, 7, 85. [Google Scholar] [CrossRef]
- Islam, M.Z.; Mele, M.A.; Baek, J.P.; Kang, H.M. Cherry Tomato Qualities Affected by Foliar Spraying with Boron and Calcium. Hortic. Environ. Biotechnol. 2016, 57, 46–52. [Google Scholar] [CrossRef]
LED Light Sources (1) | White | Red | Blue |
---|---|---|---|
Size of leaf cell (μm) | 20.67 ± 6.50 c | 58.57 ± 6.17 a | 36.18 ± 2.25 b |
Thickness of stem cell (μm) | 22.17 ± 2.44 a | 16.81 ± 1.89 b | 19.93 ± 2.79 ab |
Sample | Raw No | Raw Length | Clean No | Clean Length | Clean % |
---|---|---|---|---|---|
White | 33,223,692 | 5,016,777,492 | 31,703,398 | 4,615,844,328 | 92.01 |
Red | 41,164,444 | 6,215,831,044 | 39,275,548 | 5,802,087,803 | 93.34 |
Blue | 38,343,876 | 5,789,925,276 | 36,722,118 | 5,440,840,126 | 93.97 |
Sample Name | White | Red | Blue |
---|---|---|---|
Total Reads No | 31,703,398 | 39,275,548 | 36,722,118 |
Mapped PE Reads No | 20,898,430 | 26,850,570 | 25,740,782 |
% Mapped PE Reads No | 65.9 | 68.4 | 70.1 |
Sample Name | White | Red | Blue |
---|---|---|---|
0 | 3061 | 3125 | 3095 |
>0 | 42,606 | 42,542 | 42,572 |
Sample Name | Blue vs. Red | Blue vs. White | Red vs. White |
---|---|---|---|
Up | 132 | 148 | 144 |
Down | 153 | 93 | 91 |
GO Terms | GO ID | Count | p-Value |
---|---|---|---|
Phosphorylation | GO:0046777 | 5 | 0.0001143 |
DNA biosynthetic process | GO:0006278 | 5 | 6.78 × 10−10 |
Binding | GO:0005488 | 12 | 4.32 × 10−11 |
Membrane | GO:0016020 | 5 | 0.000363 |
DNA integration | GO:0015074 | 6 | 3.69 × 10−5 |
Transport | GO:0015918 | 6 | 2.8 × 10−7 |
Plant-type secondary cell wall biogenesis | GO:0009834 | 5 | 6.67 × 10−8 |
Proteolysis | GO:0006508 | 2 | 9.68 × 10−6 |
DNA replication | GO:0006260 | 2 | 4.26 × 10−5 |
Nucleotide-excision repair | GO:0006289 | 2 | 3.16 × 10−5 |
Regulation of DNA-templated transcription | GO:0006355 | 2 | 1.19 × 10−5 |
Negative regulation of endopeptidase activity | GO:0010951 | 2 | 1.6 × 10−7 |
DNA metabolic process | GO:0006259 | 2 | 0.000323 |
Plant-type primary cell wall biogenesis | GO:0009833 | 2 | 0.000204 |
UDP-glycosyltransferase activity | GO:0008194 | 2 | 0.000103 |
Regulation of catalytic activity | GO:0043086 | 2 | 1.98 × 10−7 |
Phloem development | GO:0010088 | 2 | 5.33 × 10−8 |
Fatty acid biosynthetic process | GO:0006633 | 2 | 1.98 × 10−5 |
Nucleic acid metabolic process | GO:0090304 | 2 | 0.000201 |
Regulation of translation | GO:0006417 | 1 | 0.000227 |
UDP-rhamnose biosynthetic process | GO:0010253 | 1 | 1.36 × 10−5 |
Proteolysis involved in protein catalytic process | GO:0051603 | 1 | 0.000219 |
Signal peptide processing | GO:0006465 | 1 | 6.34 × 10−5 |
Response to light stimulus | GO:0009416 | 1 | 4.57 × 10−5 |
Organelle organization | Go:0006996 | 1 | 3.24 × 10−6 |
Cellulose microfibril organization | GO:0010215 | 1 | 0.000328 |
Arginyl-tRNA aminoacylation | GO:0006420 | 1 | 0.000249 |
Exonucleolytic trimming to generate mature 3’-end of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) | GO:0000467 | 1 | 0.000278 |
Xylan catalytic process | GO:0008194 | 1 | 1.14 × 10−5 |
RNA phosphodiester bond hydrolysis | GO:0090502 | 1 | 0.000142 |
Positive regulation of GTPase activity | GO:0043547 | 1 | 1.95 × 10−8 |
Modulation of process of another organism | GO:0035821 | 1 | 2.93 × 10−5 |
Sucrose biosynthetic process | GO:0010088 | 1 | 2.1 × 10−5 |
Response to water deprivation | GO:0009414 | 1 | 5.51 × 10−8 |
Shikimate O-hydroxycinnamoyltransferase activity | GO:0047172 | 1 | 0.000372 |
Cell cycle | GO:0007049 | 1 | 1.52 × 10−5 |
Double-strand break repair via homologous recombination | GO:0000724 | 1 | 8.6 × 10−5 |
Sterol biosynthetic process | GO:0016126 | 1 | 3.99 × 10−6 |
Chloroplast rRNA processing | GO:1901259 | 1 | 2.59 × 10−6 |
Microtubule-based movement | GO:0007018 | 1 | 3.79 × 10−5 |
Inositol catalic process | GO:0019310 | 1 | 7.33 × 10−6 |
Group II intron splicing | GO:0000373 | 1 | 2.82 × 10−6 |
Autophagosome assembly | GO:0000045 | 1 | 1.86 × 10−5 |
Defense response | GO:0006952 | 1 | 7.72 × 10−7 |
transcription initiation at RNA polymerase II promoter | GO:0006367 | 1 | 0.000564 |
Inositol biosynthetic process | GO:0006021 | 1 | 0.000497 |
Negative regulation of translation | GO:0017148 | 1 | 0.000489 |
GO Terms | GO ID | Count | p-Value |
---|---|---|---|
Binding | GO:0005506 | 8 | 6.14 × 10−5 |
DNA integration | GO:0015074 | 7 | 2.01 × 10−11 |
Integral component of membrane | GO:0016021 | 5 | 0.000251 |
Carbon utilization | GO:0015976 | 4 | 4.06 × 10−6 |
Telomere maintenance | GO:0000723 | 3 | 9.85 × 10−6 |
Defense response | GO:0006952 | 3 | 1.79 × 10−5 |
Regulation of DNA-templated transcription | GO:0006355 | 3 | 4.25 × 10−7 |
Protein ubiquitination | GO:0016567 | 3 | 3.97 × 10−7 |
Methylation | GO:0032259 | 3 | 5.3 × 10−5 |
Translational initiation | GO:0006413 | 3 | 2.64 × 10−13 |
Tranmembrane transport | GO:0055085 | 2 | 6.74 × 10−5 |
Response to light stimulus | GO:0009416 | 2 | 0.000494 |
Carbohydrate metabolic process | GO:0005975 | 2 | 0.000487 |
RNA phosphodiester bond hydrolysis, endonucleolytic | GO:0090502 | 2 | 1.53 × 10−7 |
DNA-templated DNA replication | GO:0006261 | 2 | 0.000119 |
Oxidoreductase activity | GO:0016491 | 2 | 0.000173 |
Translational elongation | GO:0006414 | 2 | 4.12 × 10−8 |
Helicase activity | GO:0004386 | 2 | 8.81 × 10−5 |
DNA metabolic process | GO:0006259 | 2 | 0.000277 |
Extracellular space | GO:0005615 | 2 | 5.67 × 10−5 |
Microtuble-based movement | GO:0007018 | 2 | 0.00024 |
Glycogenin glucosyltransferase activity | GO:0008466 | 1 | 0.000138 |
Signal transduction | GO:0007165 | 1 | 8.13 × 10−6 |
Protein phosphorylation | GO:0006468 | 1 | 0.000124 |
‘de novo’ IMP biosynthetic process | GO:0006189 | 1 | 0.000216 |
Transmembrane phosphate ion transport from cytosol to vacuole | GO:1905011 | 1 | 4.24 × 10−6 |
tRNA methylation | GO:0030488 | 1 | 1.72 × 10−14 |
Pseudouridine synthesis | GO:0001522 | 1 | 0.000239 |
Micromolecule biosynthetic process | GO:0009059 | 1 | 1.4 × 10−5 |
Inositol catalic process | GO:0019310 | 1 | 2.07 × 10−5 |
Chloroplast thylakoid membrane | GO:0009535 | 1 | 3.39 × 10−5 |
Catalytic activity | GO:0003824 | 1 | 1.39 × 10−11 |
Circadian regulation of gene expression | GO:0032922 | 1 | 8.33 × 10−5 |
Dephophorylation | GO:0016311 | 1 | 0.000119 |
Gene silencing by RNA-directed DNA methylation | GO:0080188 | 1 | 2.9 × 10−7 |
Monooxygenase activity | GO:0004497 | 1 | 8.06 × 10−5 |
Biosynthetic process | GO:0009058 | 1 | 0.000131 |
Chlorophyllase activity | GO:0047746 | 1 | 1.71 × 10−5 |
4-coumarate-CoA ligase activity | GO:0016207 | 1 | 6.53 × 10−6 |
Gluconeogenesis | GO:0006094 | 1 | 1.41 × 10−7 |
Nucleic acid binding | GO:0003676 | 1 | 1.04 × 10−9 |
Response to oxidative stress | GO:0006979 | 1 | 6.37 × 10−5 |
Naringenin 3-dioxygenase activity | GO:0045486 | 1 | 1.57 × 10−7 |
Response to oomycetes | GO:0002239 | 1 | 1.16 × 10−7 |
Oxidative photosynthetic carbon pathway | GO:0009854 | 1 | 7.15 × 10−19 |
Citrate transport | GO:0015746 | 1 | 3.5 × 10−7 |
Lipid metabolic process | GO:0006629 | 1 | 0.000336 |
Proteolysis | GO:0006508 | 1 | 8.26 × 10−5 |
Chloroplast organization | GO:0009658 | 1 | 1.36 × 10−5 |
Photosynthetic electron transport in photosystem I | GO:0009773 | 1 | 0.000381 |
Triglyceride lipase activity | GO:0004806 | 1 | 0.000525 |
Chaperone-mediated protein folding | GO:0061077 | 1 | 0.000294 |
Glycolytic process | GO:0006096 | 1 | 4.23 × 10−6 |
Nucleoside metabolic process | GO:0009116 | 1 | 3.43 × 10−7 |
Resolution of meiotic recombination intermediates | GO:0000712 | 1 | 1.3 × 10−6 |
DNA repair | GO:0006281 | 1 | 0.000496 |
Photoreactive repair | GO:0000719 | 1 | 1.08 × 10−6 |
UDP-D-Xylose biosynthetic process | GO:0033320 | 1 | 0.000123 |
Glutathione metabolic process | GO:0006749 | 1 | 1.78 × 10−6 |
Amino acid transport | GO:0006865 | 1 | 2.09 × 10−6 |
RNA-templated DNA biosynthetic process | GO:0006278 | 1 | 3.81 × 10−5 |
Regulation of gene expression | GO:0010468 | 1 | 2.58 × 10−6 |
Dioxygenase activity | GO:0051213 | 1 | 0.000228 |
Protein import into nucleus | GO:0006606 | 1 | 3.83 × 10−5 |
Nitrogen compound metabolic process | GO:0010411 | 1 | 1.47 × 10−5 |
Xyloglucan metabolic process | GO:0010411 | 1 | 0.000216 |
Tropine dehydrogenase activity | GO:050356 | 1 | 0.000337 |
Cell redox homeostasis | GO:0045454 | 1 | 0.000225 |
AP-5 adaptor complex | GO:0016021 | 1 | 0.000196 |
Ubiquinone biosynthetic process | GO:0006744 | 1 | 4.04 × 10−5 |
Sucrose metabolic process | GO:0005985 | 1 | 1.5 × 10−5 |
GO Terms | GO ID | Count | p-Value |
---|---|---|---|
Binding | GO:0005488 | 8 | 9.89 × 10−6 |
RNA-templated DNA biosynthetic process | GO:0006278 | 6 | 2.21 × 10−6 |
DNA metabolic process | GO:0006259 | 5 | 0.000327 |
DNA integration | GO:0015074 | 5 | 3.84 × 10−10 |
Membrane | GO:0016020 | 4 | 4.5 × 10−5 |
Proteolysis | GO:0006508 | 4 | 8.74 × 10−5 |
Plant-type secondary cell wall biogenesis | GO:0009834 | 4 | 1.51 × 10−9 |
Fatty acid biosynthetic process | GO:0006633 | 3 | 5.36 × 10−5 |
Glycosyltransferase activity | GO:0016757 | 3 | 5.12 × 10−5 |
Hydrolase activity | GO:0016787 | 2 | 0.000389 |
Sterol transport | GO:0015918 | 2 | 7.71 × 10−5 |
Pectin catabolic process | GO:0045490 | 2 | 4.38 × 10−7 |
Negative regulation of endopeptidase activity | GO:0010951 | 2 | 3.76 × 10−6 |
Defense response | GO:0006952 | 2 | 9.36 × 10−11 |
Integral component of membrane | GO:0016021 | 2 | 5.81 × 10−5 |
O-hydroxycinnamoyltransferase activity | GO:0050737 | 2 | 1.46 × 10−5 |
Resolution of meiotic recombination intermediates | GO:0000712 | 2 | 1.23 × 10−7 |
Cytoplasm | GO:0005737 | 1 | 0.000342 |
Ubiquitin-dependent protein catabolic process | GO:0006511 | 1 | 1.24 × 10−5 |
Urea cycle | GO:0000050 | 1 | 0.000185 |
Protein phosphorylation | GO:0006468 | 1 | 5.29 × 10−6 |
Regulation of transcription by RNA polymerase II | GO:0006357 | 1 | 0.000445 |
Proteolysis involved in protein catabolic process | GO:0051603 | 1 | 6.45 × 10−5 |
Signal peptide processing | GO:0006465 | 1 | 9.5 × 10−5 |
Response to oxidative stress | GO:0006979 | 1 | 0.00034 |
Cell wall modification | GO:0042545 | 1 | 0.000444 |
Auxin-activated signaling pathway | GO:0009734 | 1 | 6.54 × 10−5 |
DNA replication | GO:0006260 | 1 | 0.000185 |
Nucleic acid phosphodiester bond hydrolysis | GO:0090305 | 1 | 3.7 × 10−5 |
Response to light stimus | GO:0009416 | 1 | 4.13 × 10−5 |
Protein dephosphorylation | GO:0006470 | 1 | 2.99 × 10−6 |
Aldo-keto reductase (NADP) activity | GO:0004033 | 1 | 6.81 × 10−5 |
Glucose metabolic process | GO:0006006 | 1 | 8.37 × 10−6 |
Carbohydrate metabolic process | GO:0005975 | 1 | 0.000252 |
Organelle organization | GO:0006996 | 1 | 7.49 × 10−6 |
Nuclear-transcribed mRNA catabolic process | GO:0000184 | 1 | 0.000245 |
Protein glycosylation | GO:0006486 | 1 | 4.91 × 10−7 |
Cellulose microfibril organization | GO:0010215 | 1 | 6.13 × 10−6 |
Carbohydrate transmembrane transport | GO:0034219 | 1 | 4.54 × 10−7 |
Arginyl-tRNA aminoacylation | GO:0006420 | 1 | 6.82 × 10−6 |
Cellular response to phosphate starvation | GO:0016036 | 1 | 0.000438 |
Positive regulation of GTPase activity | GO:0043547 | 1 | 3.93 × 10−8 |
Aldehyde dehydrogenase (NAD+) activity | GO:0004029 | 1 | 8.81 × 10−5 |
Lipid transport | GO:0006869 | 1 | 2.6 × 10−6 |
Regulation of gene expression | GO:0010468 | 1 | 7.61 × 10−6 |
Regulation of stimulus | GO:0050896 | 1 | 4.24 × 10−5 |
Anthycyanin-containing compound biosynthetic process | GO:0009718 | 1 | 0.000172 |
Plasma membrane | GO:0005886 | 1 | 3.35 × 10−5 |
Monooxygenase activity | GO:0004497 | 1 | 5.4 × 10−7 |
Systemic acquired resistance | GO:0009627 | 1 | 1.71 × 10−6 |
Protein folding | GO:0006457 | 1 | 3.41 × 10−12 |
Threonine biosynthetic process | GO:0009088 | 1 | 5.61 × 10−5 |
Mitochondrion | GO:0005739 | 1 | 0.000105 |
Tricarboxylic acid cycle | GO:0006099 | 1 | 6.71 × 10−5 |
Sterol biosynthetic process | GO:0016126 | 1 | 4.89 × 10−8 |
Phosphate-containing compound metabolic process | GO:0006796 | 1 | 0.00017 |
Flavonoid biosynthetic process | GO:0009813 | 1 | 0.00017 |
Carbonyl reductase (NADPH) activity | GO:0004090 | 1 | 5.11 × 10−8 |
Group II intron splicing | GO:0000373 | 1 | 1.66 × 10−7 |
Sexual reduction | GO:0019953 | 1 | 4.97 × 10−22 |
Mitochondrial cytochrome C oxidase assembly | GO:0033617 | 1 | 1.12 × 10−27 |
mRNA destabilization | GO:0061157 | 1 | 0.000126 |
GO Terms | GO ID | Count | p-Value |
---|---|---|---|
DNA integration | GO:0015074 | 5 | 0.000236 |
Binding | GO:0005488 | 5 | 3.73 × 10−5 |
Inositol catabolic process | GO:0019310 | 3 | 4.17 × 10−9 |
RNA-templated DNA biosynthetic process | GO:0006278 | 3 | 0.000244 |
Translational initiation | GO:0006413 | 3 | 4.51 × 10−14 |
Transmembrane transport | GO:0055085 | 2 | 3.58 × 10−16 |
Hydrolase activity | GO:0016787 | 2 | 0.000351 |
Membrane | GO:0016020 | 2 | 2.23 × 10−8 |
Nucleolus | GO:0005730 | 2 | 0.000147 |
Glycogenin glucosyltransferase activity | GO:0008466 | 1 | 0.000124 |
Protein Phosphorylation | GO:0006468 | 1 | 4.76 × 10−13 |
Response to light stimulus | GO:0009416 | 1 | 1.06 × 10−9 |
Response to heat | GO:0009408 | 1 | 0.000219 |
Nucleic acid metabolic process | GO:0090304 | 1 | 9.48 × 10−5 |
Chloroplast organization | GO:0009658 | 1 | 4.82 × 10−5 |
Catalytic activity | GO:0003824 | 1 | 2.7 × 10−16 |
Regulation of DNA-templated transcription | GO:0006355 | 1 | 4.32 × 10−11 |
Glycine biosynthetic process, by transamination of glyoxylate | GO:0019265 | 1 | 4.23 × 10−5 |
Embryo development ending in seed dormancy | GO:0009793 | 1 | 0.000332 |
Naringenin 3-dioxygenase activity | GO:0045486 | 1 | 2.04 × 10−5 |
Defense response | GO:0006952 | 1 | 0.000244 |
Oxidative photosynthetic carbon pathway | GO:0009854 | 1 | 1.96 × 10−24 |
Citrate transport | GO:0015746 | 1 | 1.79 × 10−8 |
RNA-templated transcription | GO:0001172 | 1 | 4.84 × 10−5 |
Sterol metabolic process | GO:0016125 | 1 | 0.00045 |
Signal transduction | GO:0007165 | 1 | 1.3 × 10−5 |
Organic substance metabolic process | GO:0071704 | 1 | 0.000355 |
Protein-disulfide reductase activity | GO:0015035 | 1 | 1.02 × 10−7 |
Negative regulation of translation | GO:0017148 | 1 | 3.96 × 10−5 |
Nucleoside metabolic process | GO:0009116 | 1 | 2.45 × 10−9 |
Protein ubiquitination | GO:0016567 | 1 | 0.000405 |
Glucose metabolic process | GO:0006006 | 1 | 0.000261 |
Nucleosome assembly | GO:0006334 | 1 | 7.29 × 10−6 |
SCF-dependent proteasomal ubiquitin-dependent protein catabolic process | GO:0031146 | 1 | 0.000239 |
Carbon utilization | GO:0015976 | 1 | 7.75 × 10−6 |
Glutathione metabolic process | GO:0006749 | 1 | 1.9 × 10−5 |
Cellular metabolic process | GO:0044237 | 1 | 6.38 × 10−6 |
Transcription initiation at RNA polymerase II promoter | GO:0006367 | 1 | 0.000147 |
Oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor | GO:0016616 | 1 | 0.000209 |
DNA metabolic process | GO:0006259 | 1 | 2.57 × 10−5 |
Protein stabilization | GO:0050821 | 1 | 8.95 × 10−6 |
Sucrose metabolic process | GO:0005985 | 1 | 4.04 × 10−5 |
GO Terms | GO ID | Count | p-Value |
---|---|---|---|
DNA integration | GO:0015074 | 7 | 1.38 × 10−6 |
Resolution of meiotic recombination intermediates | GO:0000712 | 6 | 1.45 × 10−7 |
Proteolysis | GO:0006508 | 5 | 9.01 × 10−7 |
Flavonoid biosynthetic process | GO:0009813 | 4 | 7.29 × 10−6 |
Defense response | GO:0006952 | 4 | 4.38 × 10−10 |
Signal transduction | GO:0007165 | 3 | 4.57 × 10−5 |
Nucleic acid metabolic process | GO:0090304 | 3 | 0.000198 |
Xyloglucan metabolic process | GO:0010411 | 3 | 0.000246 |
DNA metabolic process | GO:0006259 | 2 | 3.04 × 10−5 |
Hydrolase activity | GO:0016787 | 2 | 2.09 × 10−5 |
RNA-templated DNA biosynthetic process | GO:0006278 | 2 | 2.75 × 10−6 |
DNA-templated DNA replication | GO:0006261 | 2 | 0.000408 |
RNA phosphodiester bond hydrolysis, endonucleoytic | GO:0090502 | 2 | 1.36 × 10−6 |
Regulation of gene expression | GO:0010468 | 2 | 0.000422 |
Telomere maintenance | GO:0000723 | 2 | 0.000115 |
Pectin catabolic process | GO:0045490 | 2 | 1.09 × 10−5 |
Negative regulation of endopeptidase activity | GO:0010951 | 2 | 1.33 × 10−5 |
DNA topological change | GO:0006265 | 2 | 0.000211 |
Pentose-phospho shunt, non-oxidative branch | GO:0009052 | 1 | 7.65 × 10−5 |
Negative regulation of translation | GO:0017148 | 1 | 0.000259 |
Transmembrane phosphate ion transport from cytosol to vacuole | GO:1905011 | 1 | 9.62 × 10−8 |
tRNA methylation | GO:0030488 | 1 | 1.32 × 10−7 |
RNA binding | GO:0003723 | 1 | 0.000337 |
Chromatin remodeling | GO:0006338 | 1 | 3.06 × 10−6 |
Auxin-activated signaling pathway | GO:0009734 | 1 | 6.5 × 10−5 |
Nucleic acid phosphodiester bond hydrolysis | GO:0090305 | 1 | 1.7 × 10−6 |
Dephosphorylation | GO:0016311 | 1 | 1.27 × 10−5 |
RNA phosphodiester bond hydrolysis acid bonding | GO:0090502 | 1 | 2.36 × 10−8 |
Glucose metabolic process | GO:0006006 | 1 | 8.55 × 10−9 |
Fatty acid biosynthetic process | GO:0006633 | 1 | 6.04 × 10−5 |
Carbon utilization | GO:0015976 | 1 | 2.01 × 10−5 |
Aromatic compound biosynthetic process | GO:0019438 | 1 | 1.45 × 10−5 |
Translational elongation | GO:0006414 | 1 | 2.92 × 10−8 |
Gene silencing by RNA-directed DNA methylation | GO:0080188 | 1 | 5.01 × 10−7 |
Iron ion binding | GO:0005506 | 1 | 0.000222 |
Carbohydrate transmembrane transport | GO:0034219 | 1 | 1.31 × 10−9 |
4-coumarate-CoA ligase activity | GO:0016207 | 1 | 0.000427 |
Nucleic acid binding | GO:0003676 | 1 | 1.18 × 10−9 |
Binding | GO:0005488 | 1 | 1.98 × 10−7 |
Lipid transport | GO:0006869 | 1 | 0.000201 |
Carbohydrate transport | GO:0008643 | 1 | 1.97 × 10−5 |
Carboxyl acid metabolic process | GO:0019752 | 1 | 3.18 × 10−6 |
Triglyceride lipase activity | GO:0004806 | 1 | 0.000147 |
Monooxygenase activity | GO:0004497 | 1 | 3.65 × 10−7 |
Isopentenyl diphosphate biosynthetic process, methylerylthritol 4-phosphate pathway involved in terpenoid biosynthetic process | GO:0051484 | 1 | 1.4 × 10−11 |
Protein folding | GO:0006457 | 1 | 2.87 × 10−15 |
Tricarboxylic acid cycle | GO:0006099 | 1 | 5.24 × 10−5 |
Protein ubiquitination | GO:0016567 | 1 | 0.000407 |
Carbonyl reductase (NADPH) activity | GO:0004090 | 1 | 6.15 × 10−12 |
Cysteine biosynthetic process from serine | GO:0006535 | 1 | 6.67 × 10−6 |
UDP-D-xylose biosynthetic process | GO:0033320 | 1 | 8.21 × 10−5 |
Sexual reproduction | GO:0019953 | 1 | 7.63 × 10−31 |
Protein phosphorylation | GO:0006468 | 1 | 0.000117 |
Mitochondrial cytochrome c oxidase assembly | GO:0033617 | 1 | 1.4 × 10−27 |
Protein import into nucleus | GO:0006606 | 1 | 1.43 × 10−6 |
Integral component of membrane | GO:0016021 | 1 | 3.8 × 10−6 |
Cell redox homeostasis | GO:0045454 | 1 | 0.000211 |
Ubiquinone biosynthetic process | GO:0006744 | 1 | 8.1 × 10−5 |
Stress granule assembly | GO:0034063 | 1 | 7.95 × 10−5 |
mRNA destabilization | GO:0061157 | 1 | 9.94 × 10−5 |
GO Terms | GO ID | Count | p-Value |
---|---|---|---|
DNA integration | GO:0015074 | 6 | 6.93 × 10−5 |
Nucleic acid metabolic process | GO:0090304 | 3 | 1.77 × 10−5 |
Binding | GO:0005488 | 3 | 6.91 × 10−7 |
Phosphorylation | GO:0016310 | 2 | 0.000381 |
Diterpenoid biosynthetic process | GO:0016102 | 2 | 2.09 × 10−7 |
Hydrolase activity | GO:0016787 | 2 | 0.000444 |
Membrane | GO:0016020 | 2 | 2 × 10−8 |
Nucleolus | GO:0005730 | 2 | 5.14 × 10−5 |
RNA-templated DNA biosynthetic process | GO:0006278 | 1 | 1.99 × 10−5 |
Protein phosphorylation | GO:0006468 | 1 | 1.43 × 10−5 |
response to red light | GO:0010114 | 1 | 8.83 × 10−5 |
response to heat | GO:0009408 | 1 | 0.000214 |
Chloroplast organization | GO:0009658 | 1 | 2.52 × 10−6 |
Plasma membrane | GO:0005886 | 1 | 0.000189 |
Acyltransferase activity | GO:0016787 | 1 | 0.000432 |
Cation transmembrane transport | GO:0098655 | 1 | 0.000137 |
Photosynthetic electron transport in photosystem I | GO:0009733 | 1 | 2.02 × 10−7 |
Proteolysis | GO:0006508 | 1 | 0.000415 |
Mitochondrion | GO:0005739 | 1 | 2.79 × 10−5 |
Xylan catabolic process | GO:0045493 | 1 | 1.2 × 10−6 |
Coenzyme A biosynthetic process | GO:0015937 | 1 | 0.000408 |
Cellular amino acid biosynthetic process | GO:0008652 | 1 | 0.000421 |
Peptydyl-serine phosphorylation | GO:0018105 | 1 | 0.000298 |
RNA-templated transcription | GO:0005730 | 1 | 8.96 × 10−8 |
Signal transduction | GO:0007165 | 1 | 8.18 × 10−5 |
Protein dimerization activity | GO:0046983 | 1 | 4.92 × 10−7 |
Sucrose biosynthetic process | GO:0005986 | 1 | 7.16 × 10−7 |
Exonucleolytic trimming to generate mature 3′-end of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) | GO:0000467 | 1 | 8.71 × 10−5 |
4 iron, 4 sulfur cluster binding | GO:0051539 | 1 | 0.000264 |
Inositol catabolic process | GO:0019310 | 1 | 9.2 × 10−6 |
Calcium ion binding | GO:0005509 | 1 | 6.83 × 10−5 |
Protein ADP-ribosylation | GO:0006471 | 1 | 5.45 × 10−21 |
Protein-disulfide reductase activity | GO:0015035 | 1 | 1.36 × 10−6 |
Chloroplast rRNA processing | GO:1901259 | 1 | 2.6 × 10−6 |
UDP-D-xylose biosynthetic process | GO:0033320 | 1 | 4.04 × 10−6 |
Microtubule-based movement | GO:0007018 | 1 | 9.91 × 10−7 |
Protein ubiquitination | GO:0016567 | 1 | 0.000136 |
SCF-dependent proteasomal ubiquitin-dependent protein catabolic process | GO:0031146 | 1 | 0.000461 |
Lipid transport | GO:0006869 | 1 | 0.000368 |
Autophagosome assembly | GO:0000045 | 1 | 2.22 × 10−6 |
DNA metabolic process | GO:0006259 | 1 | 3.57 × 10−23 |
Fatty acid biosynthetic process | GO:0006633 | 1 | 1.96 × 10−5 |
Mitochondrial mRNA modification | GO:0080156 | 1 | 0.000184 |
Reference Gene ID | Primer Sequence (5′→3′) |
---|---|
Gene_079740T | forward: TGACGCCTGATGCTGCATAT |
reverse: AAGGTGGCGGTAGTAGTCCT | |
Gene_119030T | forward: TGGCAACCATTTTGCTGA |
reverse: TCCTTCCATGCAAGGCAACA | |
Gene_174710T | forward: AGGAAGAGATAGTGGCGATGA |
reverse: TGATCTCCAAGGCGATGCAA | |
Gene_334410T | forward: CCCGTCGCACAACTAGAGAT |
reverse: GAACGCCTTGCTGCATCTTG | |
Gene_447300T | forward: ATCCAACGCCTCAAACACTC |
reverse: AGAGTGCACCCATGTTGTTG | |
Gene_054270T | forward: GGAGCAATTGGATGAGCCCT |
reverse: ACCAGCACCACGAATATTCCA | |
Gene_102000T | forward: AGCTCCATGCCATCACTAGC |
reverse: AGTGTTGTTGCTCCGGAGTT | |
Gene_277270T | forward: GAGCCCTCTGCAACCAACTC |
reverse: GCAGAGTTCACCTGGTGTGT | |
Gene_344410T | forward: CCTGATGCAAACATGTTCCCC |
reverse: TCATTCATGGCAGTTGCACC | |
Gene_377000T | forward: AATCGACGGGCAAATGGAGA |
reverse: GTGAATTTCTGTGTCGGCGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Seo, J.W.; Lee, J.G.; Yoo, J.H.; Lim, J.D.; Choi, I.Y.; Kim, M.J.; Yu, C.Y.; Seong, E.S. Cellular Morphology and Transcriptome Comparative Analysis of Astragalus membranaceus Bunge Sprouts Cultured In Vitro under Different LED Light. Plants 2023, 12, 1914. https://doi.org/10.3390/plants12091914
Seo JW, Lee JG, Yoo JH, Lim JD, Choi IY, Kim MJ, Yu CY, Seong ES. Cellular Morphology and Transcriptome Comparative Analysis of Astragalus membranaceus Bunge Sprouts Cultured In Vitro under Different LED Light. Plants. 2023; 12(9):1914. https://doi.org/10.3390/plants12091914
Chicago/Turabian StyleSeo, Ji Won, Jae Geun Lee, Ji Hye Yoo, Jung Dae Lim, Ik Young Choi, Myong Jo Kim, Chang Yeon Yu, and Eun Soo Seong. 2023. "Cellular Morphology and Transcriptome Comparative Analysis of Astragalus membranaceus Bunge Sprouts Cultured In Vitro under Different LED Light" Plants 12, no. 9: 1914. https://doi.org/10.3390/plants12091914
APA StyleSeo, J. W., Lee, J. G., Yoo, J. H., Lim, J. D., Choi, I. Y., Kim, M. J., Yu, C. Y., & Seong, E. S. (2023). Cellular Morphology and Transcriptome Comparative Analysis of Astragalus membranaceus Bunge Sprouts Cultured In Vitro under Different LED Light. Plants, 12(9), 1914. https://doi.org/10.3390/plants12091914