Species Delimitation and Genetic Relationship of Castanopsis hainanensis and Castanopsis wenchangensis (Fagaceae)
Abstract
:1. Introduction
2. Results
2.1. Nuclear SSR (nSSR) Diversity and Genetic Structure
2.2. Comparative Analysis of Chloroplast Genomes
3. Discussion
4. Materials and Methods
4.1. Sampling and DNA Extraction
4.2. Nuclear SSR Genotyping and Genetic Structure Analysis
4.3. Comparative Analysis of Chloroplast Genomes
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Liu, J.; Zhou, W.; Gong, X. Species Delimitation, Genetic Diversity and Population Historical Dynamics of Cycas Diannanensis (Cycadaceae) Occurring Sympatrically in the Red River Region of China. Front. Plant Sci. 2015, 6, 696. [Google Scholar] [CrossRef]
- De Queiroz, K. Species Concepts and Species Delimitation. Syst. Biol. 2007, 56, 879–886. [Google Scholar] [CrossRef] [PubMed]
- Wilkins, J. Species: A History of the Idea; Doak, D., Ed.; University of California Press: Berkley, CA, USA, 2009; ISBN 978-0-520-26085-6. [Google Scholar]
- Daïnou, K.; Mahy, G.; Duminil, J.; Dick, C.W.; Doucet, J.-L.; Donkpégan, A.S.L.; Pluijgers, M.; Sinsin, B.; Lejeune, P.; Hardy, O.J. Speciation Slowing down in Widespread and Long-Living Tree Taxa: Insights from the Tropical Timber Tree Genus Milicia (Moraceae). Heredity 2014, 113, 74–85. [Google Scholar] [CrossRef] [PubMed]
- Zheng, H.L.; Fan, L.Q.; Milne, R.I.; Zhang, L.; Wang, Y.L.; Mao, K.S. Species Delimitation and Lineage Separation History of a Species Complex of Aspens in China. Front. Plant Sci. 2017, 8, 375. [Google Scholar] [CrossRef]
- Palsbøll, P.J.; Bérubé, M.; Allendorf, F.W. Identification of Management Units Using Population Genetic Data. Trends Ecol. Evol. 2007, 22, 11–16. [Google Scholar] [CrossRef] [PubMed]
- Coates, D.J.; Byrne, M.; Moritz, C. Genetic Diversity and Conservation Units: Dealing with the Species-Population Continuum in the Age of Genomics. Front. Ecol. Evol. 2018, 6, 165. [Google Scholar] [CrossRef]
- Chen, X.M.; Yu, B.P. A Review of the Genus of Castanopsis in Guangdong and Hainan. J. South. China Agric. Univ. 1991, 2, 87–95. [Google Scholar]
- Huang, C.J.; Chang, Y.T.; Bruce, B. Fagaceae. In Flora of China; Wu, Z.Y., Raven, P.H., Hong, D.Y., Eds.; Science Press and Missouri Botanical Garden Press: Beijing, China, 1999; pp. 315–333. ISBN 7030075730. [Google Scholar]
- Chen, L.; Li, X.W.; Li, J.Q. Taxonomic notes on Castanopsis (Fagaceae, Castaneoideae) from China. Phytotaxa 2013, 146, 50–60. [Google Scholar] [CrossRef]
- Fu, G.A.; Huang, C.C. A new species of Castanopsis Bl. from Hainan. Acta Phytotaxon. Sin. 1989, 2, 151–152. [Google Scholar]
- Huang, C.J.; Chang, Y.T. Castanopsis. In Flora Reipublicae Popularis Sinicae; Chen, H.Y., Huang, C.J., Eds.; Science Press: Beijing, China, 1998; pp. 13–80. ISBN 703006108X. [Google Scholar]
- Balloux, F.; Lugon-Moulin, N. The Estimation of Population Differentiation with Microsatellite Markers. Mol. Ecol. 2002, 11, 155–165. [Google Scholar] [CrossRef]
- Rossiter, S.J.; Benda, P.; Dietz, C.; Zhang, S.; Jones, G. Rangewide Phylogeography in the Greater Horseshoe Bat Inferred from Microsatellites: Implications for Population History, Taxonomy and Conservation. Mol. Ecol. 2007, 16, 4699–4714. [Google Scholar] [CrossRef] [PubMed]
- Daniell, H.; Lin, C.S.; Yu, M.; Chang, W.J. Chloroplast Genomes: Diversity, Evolution, and Applications in Genetic Engineering. Genome Biol. 2016, 17, 134. [Google Scholar] [CrossRef]
- Jin, J.J.; Yu, W.B.; Yang, J.B.; Song, Y.; dePamphilis, C.W.; Yi, T.S.; Li, D.Z. GetOrganelle: A fast and versatile toolkit for accurate de novo assembly of organelle genomes. Genome Biol. 2020, 21, 241. [Google Scholar] [CrossRef] [PubMed]
- Liu, K.; Qi, M.; Du, F.K. Population and Landscape Genetics Provide Insights into Species Conservation of Two Evergreen Oaks in Qinghai–Tibet Plateau and Adjacent Regions. Front. Plant Sci. 2022, 13, 858526. [Google Scholar] [CrossRef] [PubMed]
- Lyu, J.; Song, J.; Liu, Y.; Wang, Y.; Li, J.; Du, F.K. Species Boundaries Between Three Sympatric Oak Species: Quercus Aliena, Q. Dentata, and Q. Variabilis at the Northern Edge of Their Distribution in China. Front. Plant Sci. 2018, 9, 414. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.-D.; Zhang, X.; Zhang, H.; Zhou, T.; Zhao, Y.-M.; Yang, J.; Zhao, G.-F. Genetic Differentiation and Demographic History of Three Cerris Oak Species in China Based on Nuclear Microsatellite Makers. Forests 2021, 12, 1164. [Google Scholar] [CrossRef]
- Aoki, K.; Ueno, S.; Kamijo, T.; Setoguchi, H.; Murakami, N.; Kato, M.; Tsumura, Y. Genetic Differentiation and Genetic Diversity of Castanopsis (Fagaceae), the Dominant Tree Species in Japanese Broadleaved Evergreen Forests, Revealed by Analysis of EST-Associated Microsatellites. PLoS ONE 2014, 9, e87429. [Google Scholar] [CrossRef]
- Funk, W.C.; McKay, J.K.; Hohenlohe, P.A.; Allendorf, F.W. Harnessing Genomics for Delineating Conservation Units. Trends Ecol. Evol. 2012, 27, 489–496. [Google Scholar] [CrossRef]
- Zhang, Y.T.; Huang, J.; Song, J.; Lin, L.M.; Feng, R.X.; Xing, Z.B. Structure and Variation Analysis of Chloroplast Genomes in Fagaceae. Bull. Bot. Res. 2018, 38, 757–765. [Google Scholar]
- Yu, S.; Dong, W.P.; Liu, B.; Xu, C.; Yao, X.; Gao, J.; Corlett, R.T. Comparative Analysis of Complete Chloroplast Genome Sequences of Two Tropical Trees Machilus Yunnanensis and Machilus Balansae in the Family Lauraceae. Front. Plant Sci. 2015, 6, 662. [Google Scholar] [CrossRef]
- Frankham, R.; Ballou, J.D.; Briscoe, D.A.; McInnes, K.H. Introduction to Conservation Genetics; Cambridge University Press: Cambridge, UK, 2002. [Google Scholar] [CrossRef]
- Blakesley, D.; Pakkad, G.; James, C.; Torre, F.; Elliott, S. Genetic Diversity of Castanopsis Acuminatissima (Bl.) A. DC. in Northern Thailand and the Selection of Seed Trees for Forest Restoration. New For. 2004, 27, 89–100. [Google Scholar] [CrossRef]
- Aoki, K.; Tamaki, I.; Nakao, K.; Ueno, S.; Kamijo, T.; Setoguchi, H.; Murakami, N.; Kato, M.; Tsumura, Y. Approximate Bayesian Computation Analysis of EST-Associated Microsatellites Indicates That the Broadleaved Evergreen Tree Castanopsis Sieboldii Survived the Last Glacial Maximum in Multiple Refugia in Japan. Heredity 2019, 122, 326–340. [Google Scholar] [CrossRef] [PubMed]
- Hamrick, J.L.; Godt, M.J.W.; Sherman-Broyles, S.L. Factors Influencing Levels of Genetic Diversity in Woody Plant Species. New For. 1992, 6, 95–124. [Google Scholar] [CrossRef]
- Gitzendanner, M.A.; Soltis, P.S. Patterns of Genetic Variation in Rare and Widespread Plant Congeners. Am. J. Bot. 2000, 87, 783–792. [Google Scholar] [CrossRef]
- Furches, M.S.; Small, R.L.; Furches, A. Genetic Diversity in Three Endangered Pitcher Plant Species (Sarracenia; Sarraceniaceae) Is Lower than Widespread Congeners. Am. J. Bot. 2013, 100, 2092–2101. [Google Scholar] [CrossRef] [PubMed]
- Moran, G.F. Patterns of Genetic Diversity in Australian Tree Species. In Population Genetics of Forest Trees, Proceedings of the International Symposium on Population Genetics of Forest Trees, Corvallis, OR, USA, 31 July–2 August 1990; Adams, W.T., Strauss, S.H., Copes, D.L., Griffin, A.R., Eds.; Springer: Dordrecht, The Netherlands, 1992; pp. 49–66. ISBN 978-94-011-2815-5. [Google Scholar]
- Shi, Y.-S.; Zhang, J.; Jiang, K.; Cui, M.-Y.; Li, Y.-Y. Development and Characterization of Polymorphic Microsatellite Markers in Castanopsis Sclerophylla (Fagaceae). Am. J. Bot. 2011, 98, e19–e21. [Google Scholar] [CrossRef]
- Li, C.; Sun, Y.; Huang, H.W.; Cannon, C.H. Footprints of Divergent Selection in Natural Populations of Castanopsis Fargesii (Fagaceae). Heredity 2014, 113, 533–541. [Google Scholar] [CrossRef]
- Ye, L.J.; Wang, J.; Sun, P.; Dong, S.P.; Zhang, Z.Y. The Transferability of Nuclear Microsatellite Markers in Four Castanopsis Species to Castanopsis tibetana (Fagaceae). Plant Divers. Resour. 2014, 36, 443–448. [Google Scholar]
- Holland, M.M.; Parson, W. GeneMarker® HID: A Reliable Software Tool for the Analysis of Forensic STR Data. J. Forensic Sci. 2011, 56, 29–35. [Google Scholar] [CrossRef]
- Goudet, J. FSTAT (Version 2.9.3): A Program to Estimate and Test Gene Diversities and Fixation Indices. 2001. Available online: www.Unil.Ch/Izea/Softw./Fstat.Html (accessed on 6 September 2022).
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic Analysis in Excel. Population Genetic Software for Teaching and Research—An Update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the Number of Clusters of Individuals Using the Software Structure: A Simulation Study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [PubMed]
- Earl, D.A.; vonHoldt, B.M. STRUCTURE HARVESTER: A Website and Program for Visualizing STRUCTURE Output and Implementing the Evanno Method. Conserv. Genet. Resour. 2012, 4, 359–361. [Google Scholar] [CrossRef]
- Jakobsson, M.; Rosenberg, N.A. CLUMPP: A Cluster Matching and Permutation Program for Dealing with Label Switching and Multimodality in Analysis of Population Structure. Bioinformatics 2007, 23, 1801–1806. [Google Scholar] [CrossRef] [PubMed]
- Rosenberg, N.A. Distruct: A Program for the Graphical Display of Population Structure. Mol. Ecol. Notes 2004, 4, 137–138. [Google Scholar] [CrossRef]
- Excoffier, L.; Laval, G.; Schneider, S. Arlequin (Version 3.0): An Integrated Software Package for Population Genetics Data Analysis. Evol. Bioinform. Online 2007, 1, 47–50. [Google Scholar] [CrossRef]
- Shi, L.; Chen, H.; Jiang, M.; Wang, L.; Wu, X.; Huang, L.; Liu, C. CPGAVAS2, an Integrated Plastome Sequence Annotator and Analyzer. Nucleic Acids Res. 2019, 47, W65–W73. [Google Scholar] [CrossRef]
- Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al. Geneious Basic: An Integrated and Extendable Desktop Software Platform for the Organization and Analysis of Sequence Data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef]
- Lohse, M.; Drechsel, O.; Bock, R. OrganellarGenomeDRAW (OGDRAW): A Tool for the Easy Generation of High-Quality Custom Graphical Maps of Plastid and Mitochondrial Genomes. Curr. Genet. 2007, 52, 267–274. [Google Scholar] [CrossRef]
- Amiryousefi, A.; Hyvönen, J.; Poczai, P. IRscope: An Online Program to Visualize the Junction Sites of Chloroplast Genomes. Bioinformatics 2018, 34, 3030–3031. [Google Scholar] [CrossRef]
- Kurtz, S.; Choudhuri, J.V.; Ohlebusch, E.; Schleiermacher, C.; Stoye, J.; Giegerich, R. REPuter: The Manifold Applications of Repeat Analysis on a Genomic Scale. Nucleic Acids Res. 2001, 29, 4633–4642. [Google Scholar] [CrossRef]
Locus | A | HO | He | HS | HT | FIS | FST | GST | RST |
---|---|---|---|---|---|---|---|---|---|
CS92 | 11 | 0.697 | 0.700 | 0.728 | 0.82 | 0.024 | 0.103 | 0.112 | 0.143 |
CC-20303 | 5 | 0.24 | 0.279 | 0.292 | 0.328 | 0.169 | 0.135 | 0.109 | 0.028 |
CS24 | 7 | 0.546 | 0.503 | 0.521 | 0.6 | −0.028 | 0.142 | 0.131 | 0.122 |
CC-30080 | 3 | 0.351 | 0.399 | 0.416 | 0.508 | 0.163 | 0.228 | 0.181 | 0.173 |
CC-935 | 5 | 0.414 | 0.401 | 0.417 | 0.438 | 0.01 | 0.045 | 0.049 | 0.129 |
CS20 | 10 | 0.719 | 0.742 | 0.772 | 0.823 | 0.054 | 0.06 | 0.063 | 0.143 |
CC-39198 | 4 | 0.304 | 0.336 | 0.351 | 0.364 | 0.114 | 0.048 | 0.036 | 0.089 |
CC4323 | 5 | 0.187 | 0.169 | 0.175 | 0.176 | −0.063 | 0.01 | 0.009 | 0.025 |
CC-7378 | 6 | 0.448 | 0.393 | 0.407 | 0.569 | −0.055 | 0.325 | 0.285 | 0.257 |
CC-11089 | 6 | 0.233 | 0.235 | 0.244 | 0.619 | −0.015 | 0.63 | 0.606 | 0.496 |
CC-43042 | 7 | 0.492 | 0.527 | 0.55 | 0.634 | 0.124 | 0.151 | 0.133 | 0.122 |
CC-704 | 5 | 0.6 | 0.516 | 0.534 | 0.579 | −0.1 | 0.089 | 0.078 | 0.162 |
Mean | 6.167 | 0.436 | 0.433 | 0.451 | 0.538 | 0.033 | 0.164 | 0.149 | 0.157 |
Species | Population | A | AR | HO | He | FIS |
---|---|---|---|---|---|---|
C. wenchangensis | WZS | 2.917 | 2.622 | 0.438 | 0.433 | 0.032 |
YL | 3.500 | 2.791 | 0.329 | 0.386 | 0.173 | |
PD | 2.083 | 2.060 | 0.438 | 0.329 | −0.267 | |
CF | 3.083 | 2.799 | 0.429 | 0.466 | 0.119 | |
BCS | 3.417 | 2.803 | 0.477 | 0.447 | −0.039 | |
LFT | 3.250 | 2.681 | 0.436 | 0.435 | 0.023 | |
Mean | 3.042 | 2.626 | 0.424 | 0.416 | 0.007 | |
C. hainanensis | SMX | 3.917 | 3.331 | 0.510 | 0.469 | −0.057 |
QXL | 2.833 | 2.833 | 0.405 | 0.450 | 0.176 | |
DLS | 3.500 | 3.011 | 0.428 | 0.433 | 0.047 | |
JFL | 3.500 | 3.023 | 0.417 | 0.443 | 0.088 | |
QSX | 3.583 | 3.111 | 0.488 | 0.476 | −0.002 | |
Mean | 3.467 | 3.062 | 0.450 | 0.454 | 0.050 |
Sample | Source of Variation | Sum of Squares | Variance Components | Percentage of Variation | Fixation Indices (p < 0.001) |
---|---|---|---|---|---|
C. hainanensis and C. wenchangensis | Among species | 158.053 | 0.90204 | 24.3 | FCT = 0.24296 FSC = 0.03525 FST = 0.26965 |
Among populations within species | 51.378 | 0.09907 | 2.67 | ||
Within populations | 892.099 | 2.71155 | 73.04 | ||
C. hainanensis | Among populations | 25.778 | 0.1202 | 4.08 | FST = 0.04078 |
Within populations | 421.306 | 2.82756 | 95.92 | ||
C. wenchangensis | Among populations | 25.600 | 0.08243 | 3.06 | FST = 0.03055 |
Within populations | 470.793 | 2.61552 | 96.94 |
Species | Total | LSC | SSC | IR | Gene | |||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Length (bp) | GC (%) | Length (bp) | GC (%) | Length (bp) | GC (%) | Length (bp) | GC (%) | rRNA | tRNA | CDS | Total | |
C. hainanensis | 160,406 | 36.8 | 90,103 | 34.7 | 18,929 | 31 | 25,687 | 42.8 | 8 | 37 | 85 | 130 |
C. wenchangensis | 160,635 | 36.8 | 90,280 | 34.6 | 18,957 | 30.9 | 25,699 | 42.8 | 8 | 37 | 85 | 130 |
Species | Sampling Location (Population Code) | Number of Individuals | Altitude (m) | Longitude (E) | Latitude (N) |
---|---|---|---|---|---|
C. wenchangensis | Wenzaoshan Village (WZS) | 12 | 36 | 110°50′52.66″ | 19°47′33.27″ |
Po Dui Village (PD) | 8 | 28 | 110°49′49.78″ | 19°47′52.74″ | |
Longfei Tou Village (LFT) | 22 | 27 | 110°51′0.07″ | 19°48′3.49″ | |
Ya Lang Village (YL) | 20 | 38 | 110°57′56.49″ | 19°47′18.30″ | |
Chang Fa Village (CF) | 13 | 40 | 110°51′53.05″ | 19°49′13.30″ | |
Baocaishan Village (BCS) | 18 | 38 | 110°52′56.88″ | 19°48′30.47″ | |
C. hainanensis | Shuiman Village (SMX) | 16 | 658 | 109°40′33.11″ | 18°42′12.08″ |
Qixianling Mountain (QXL) | 7 | 264 | 109°39′46.51″ | 18°52′58.66″ | |
Diaoluo Mountain (DLS) | 15 | 377 | 109°54′57.49″ | 18°39′35.21″ | |
Qingsong Village (QSX) | 21 | 396 | 109°16′28.23″ | 19°7′49.38″ | |
Jianfengling Mountain (JFL) | 18 | 283 | 108°50′16.43″ | 18°41′44.58″ |
Locus | Repetitive Unit | Primer Sequence (5′→3′) | Fragment Length |
---|---|---|---|
CC22256 | (ACA)9 | F: <TAMRA> CAAGTCCGATCCTTCCTCTG | 93–111 |
R: AGCTGGGTTTTGAGTAGCGA | |||
CS92 | (GA)12…(AT)3 | F: <HEX> CAGAAACCAAAAAAGAACAG | 140–162 |
R: ACACACAAGAAAACAAAAGC | |||
CC25435 | (ACA)11 | F: <6-FAM> TGAAAATCCTCTGGGTCTGG | 250–268 |
R: CTTCTCGCACAACATCCTCA | |||
CC20303 | (TGT)6 | F: <ROX> AGTGGTGGTGTTTCCCAAAG | 204–225 |
R: AGAAGAGCTTCCTTCCCCTG | |||
CS24 | (CAA)6 | F: <TAMRA> ATCACCGGAGAAAACCCTAACGA | 121–142 |
R: AATGTTTCGGACCAATTCGAGGT | |||
CC30080 | (TTG)4 | F: <HEX> CTCAGATCCGACCGTTTGTT | 158–167 |
R: ATGGGAGGATGGAAGGTAGG | |||
CC935 | (TC)6 | F: <TAMRA> TGCTGAGTTTCTGAGGCTGA | 124–138 |
R: GACACGTCGAATGGGAATCT | |||
CS20 | (AG)13 | F: <ROX> AATTTCACATCCCAACTCTGCGA | 252–280 |
R: TGGAGGGAGTAGTGGACGATCAA | |||
CC39198 | (AG)11 | F: <6-FAM> GGTTGTTGTCGTTGTCGTTG | 204–232 |
R: TCTGTCTCCGTTCACCCTCT | |||
CC4323 | (TGT)7 | F: <6-FAM> TCGGTACAACTTCTGGGTCC | 238–253 |
R: AGCCTCTTCTCCACAACGAA | |||
CC7378 | (CCG)5 | F: <HEX> CACTCTCTCCGGTCCATGAT | 149–170 |
R: AATGTGGCGAGTTCGGTAAC | |||
CC34976 | (GA)7 | F: <ROX> GTGGTGGATTTTGGGTATGG | 260–290 |
R: TCCCAAACCTTGTCACCTTC | |||
CC11089 | (AGA)12 | F: <TAMRA> CAGAACCAGTTTCGTGCTCA | 115–139 |
R: GCTTCTTGGTGGTGCTCTTC | |||
CC-43042 | (CGC)4 | F: <HEX> TAACCAATCACGTTCACCGA | 193–211 |
R: CGCCACATCTAAAACCCCTA | |||
CC-41684 | (ACC)6 | F: <ROX> ATCCTCCAAGCAATCCTCCT | 279–306 |
R: TCAAGTGTGTGCGAGTGACA | |||
CC-704 | (GTT)4 | F: <6-FAM> ATGCCTTGCTTCTCAGCATT | 261–279 |
R: CCAACAATAATGCCCCATTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, X.; Feng, Y.; Chen, S.; Yang, K.; Wen, X.; Sun, Y. Species Delimitation and Genetic Relationship of Castanopsis hainanensis and Castanopsis wenchangensis (Fagaceae). Plants 2023, 12, 3544. https://doi.org/10.3390/plants12203544
Chen X, Feng Y, Chen S, Yang K, Wen X, Sun Y. Species Delimitation and Genetic Relationship of Castanopsis hainanensis and Castanopsis wenchangensis (Fagaceae). Plants. 2023; 12(20):3544. https://doi.org/10.3390/plants12203544
Chicago/Turabian StyleChen, Xing, Yi Feng, Shuang Chen, Kai Yang, Xiangying Wen, and Ye Sun. 2023. "Species Delimitation and Genetic Relationship of Castanopsis hainanensis and Castanopsis wenchangensis (Fagaceae)" Plants 12, no. 20: 3544. https://doi.org/10.3390/plants12203544
APA StyleChen, X., Feng, Y., Chen, S., Yang, K., Wen, X., & Sun, Y. (2023). Species Delimitation and Genetic Relationship of Castanopsis hainanensis and Castanopsis wenchangensis (Fagaceae). Plants, 12(20), 3544. https://doi.org/10.3390/plants12203544